ID: 932496766

View in Genome Browser
Species Human (GRCh38)
Location 2:72149425-72149447
Sequence CCGGCCAGGACCTCCGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496766_932496779 29 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496779 2:72149477-72149499 GCCCTCGAAACTGTGCCTTAGGG No data
932496766_932496769 -6 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496766_932496778 28 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496778 2:72149476-72149498 AGCCCTCGAAACTGTGCCTTAGG No data
932496766_932496771 -2 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496766 Original CRISPR CCGGCCAGGACCTCCGCTGC CGG (reversed) Intergenic