ID: 932496767

View in Genome Browser
Species Human (GRCh38)
Location 2:72149425-72149447
Sequence CCGGCAGCGGAGGTCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496758_932496767 -6 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496749_932496767 17 Left 932496749 2:72149385-72149407 CCCTCCTCCAGCTCCGAGCAGTC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496759_932496767 -9 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496748_932496767 18 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496750_932496767 16 Left 932496750 2:72149386-72149408 CCTCCTCCAGCTCCGAGCAGTCC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496757_932496767 -5 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496755_932496767 4 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496752_932496767 10 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496751_932496767 13 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496767 Original CRISPR CCGGCAGCGGAGGTCCTGGC CGG Intergenic