ID: 932496769

View in Genome Browser
Species Human (GRCh38)
Location 2:72149442-72149464
Sequence GGCCGGACTGCCCCCTCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496758_932496769 11 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496755_932496769 21 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496759_932496769 8 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496764_932496769 -4 Left 932496764 2:72149423-72149445 CCCCGGCAGCGGAGGTCCTGGCC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496766_932496769 -6 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496765_932496769 -5 Left 932496765 2:72149424-72149446 CCCGGCAGCGGAGGTCCTGGCCG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496751_932496769 30 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496752_932496769 27 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496762_932496769 2 Left 932496762 2:72149417-72149439 CCGAAGCCCCGGCAGCGGAGGTC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496757_932496769 12 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496769 Original CRISPR GGCCGGACTGCCCCCTCGAC TGG Intergenic