ID: 932496771

View in Genome Browser
Species Human (GRCh38)
Location 2:72149446-72149468
Sequence GGACTGCCCCCTCGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496764_932496771 0 Left 932496764 2:72149423-72149445 CCCCGGCAGCGGAGGTCCTGGCC No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496766_932496771 -2 Left 932496766 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496762_932496771 6 Left 932496762 2:72149417-72149439 CCGAAGCCCCGGCAGCGGAGGTC No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496758_932496771 15 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496765_932496771 -1 Left 932496765 2:72149424-72149446 CCCGGCAGCGGAGGTCCTGGCCG No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496757_932496771 16 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496755_932496771 25 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496759_932496771 12 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496771 Original CRISPR GGACTGCCCCCTCGACTGGC AGG Intergenic