ID: 932498464

View in Genome Browser
Species Human (GRCh38)
Location 2:72159575-72159597
Sequence AGTTGCCTTTGTTTTCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932498464_932498471 23 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG No data
932498464_932498472 24 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498472 2:72159622-72159644 GTTCCCTAAGGAGGCTTGGAGGG No data
932498464_932498475 29 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498475 2:72159627-72159649 CTAAGGAGGCTTGGAGGGAGTGG No data
932498464_932498467 15 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498467 2:72159613-72159635 TTAGCACCCGTTCCCTAAGGAGG No data
932498464_932498466 12 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498466 2:72159610-72159632 CGATTAGCACCCGTTCCCTAAGG No data
932498464_932498468 20 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498468 2:72159618-72159640 ACCCGTTCCCTAAGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932498464 Original CRISPR AGTTGCCTTTGTTTTCCTTA AGG (reversed) Intergenic
No off target data available for this crispr