ID: 932498471

View in Genome Browser
Species Human (GRCh38)
Location 2:72159621-72159643
Sequence CGTTCCCTAAGGAGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932498464_932498471 23 Left 932498464 2:72159575-72159597 CCTTAAGGAAAACAAAGGCAACT No data
Right 932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932498471 Original CRISPR CGTTCCCTAAGGAGGCTTGG AGG Intergenic
No off target data available for this crispr