ID: 932499155

View in Genome Browser
Species Human (GRCh38)
Location 2:72166768-72166790
Sequence CAGCCTATACTGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932499155_932499161 17 Left 932499155 2:72166768-72166790 CCCTGCCCCTTCAGTATAGGCTG No data
Right 932499161 2:72166808-72166830 CTAATAAATAGAATCTGGAAAGG No data
932499155_932499162 18 Left 932499155 2:72166768-72166790 CCCTGCCCCTTCAGTATAGGCTG No data
Right 932499162 2:72166809-72166831 TAATAAATAGAATCTGGAAAGGG No data
932499155_932499160 12 Left 932499155 2:72166768-72166790 CCCTGCCCCTTCAGTATAGGCTG No data
Right 932499160 2:72166803-72166825 TGCTTCTAATAAATAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932499155 Original CRISPR CAGCCTATACTGAAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr