ID: 932502049

View in Genome Browser
Species Human (GRCh38)
Location 2:72191469-72191491
Sequence CAACCAGCTGTGGCATCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932502049 Original CRISPR CAACCAGCTGTGGCATCTTG GGG (reversed) Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900544582 1:3221393-3221415 CAAGCAGCTTTTGCATCTTCTGG - Intronic
901652571 1:10751726-10751748 CAGCCAGCCAGGGCATCTTGTGG - Intronic
905350512 1:37343108-37343130 CATCCAGCTCTGGCATTTAGAGG + Intergenic
906201098 1:43960929-43960951 CACACAGCTGTGGCACCATGGGG - Exonic
906708615 1:47912973-47912995 TAACCTGCTGTGGCCTCTGGTGG - Intronic
906966922 1:50466886-50466908 CCACCAGCTAGGGCAGCTTGAGG - Intronic
907077725 1:51593497-51593519 CAGCCAGCAGTGGCATCTTCAGG - Intronic
907545941 1:55260136-55260158 GATGCAGCTGTGGCATCTTGGGG + Intergenic
907954237 1:59213209-59213231 CAACAAACTGTGACATCTTCAGG - Intergenic
908083813 1:60609091-60609113 CAACCAGCTGTGTGACCTTATGG + Intergenic
908596531 1:65694194-65694216 CAACATGCTCTGGCAGCTTGTGG + Intergenic
909715467 1:78702013-78702035 CCAGCAGCTGTGGCATGATGGGG + Intergenic
910134447 1:83950811-83950833 CATGCAGCTTTGGCATCCTGAGG + Intronic
910619347 1:89236030-89236052 ACACCAGCTGTGGCAGATTGTGG - Intergenic
912639723 1:111333298-111333320 CAACCACCAGTGGAAGCTTGTGG + Intergenic
912940722 1:114042393-114042415 CAATCAGCTGTGGCATAGGGAGG + Intergenic
913541165 1:119822398-119822420 CAACCGGCTGTGGCAGTCTGTGG - Intergenic
914093422 1:144524334-144524356 CAACCAGCTGTGGGAGCGGGCGG + Intergenic
914348299 1:146818349-146818371 GAACCAACTGTTGCCTCTTGAGG - Intergenic
914877088 1:151520239-151520261 CCACCATCTATGGCATCCTGAGG + Exonic
915750202 1:158199880-158199902 GAATCAGCTGTGGCATCAGGAGG + Intergenic
917450990 1:175147103-175147125 CCACCAGCTGTGGCAGCTTGGGG + Exonic
917672556 1:177286805-177286827 CAGCCAGCTCTGTCATCGTGAGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
917829362 1:178863083-178863105 CTACCAGCTGTGTGATCTTAGGG - Intronic
918533948 1:185553530-185553552 CAGCTAGCTGTGTGATCTTGGGG + Intergenic
924793406 1:247273479-247273501 CAAGCAGCTGTGGCATGGTGCGG - Intergenic
1063921473 10:10937545-10937567 AAAACAGCTGTGGAATCCTGTGG + Intergenic
1067008686 10:42690520-42690542 CAGCCAGCTGTGGCCACCTGTGG - Intergenic
1067920202 10:50447933-50447955 GAACCAGCTGTGGAATTTGGGGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068544884 10:58334649-58334671 AAACCAGCTGTGGCACCTATTGG + Intergenic
1068894797 10:62187508-62187530 CATCCACCTGTGACATCTTAAGG - Intronic
1069067900 10:63963172-63963194 CAACCTGCTGTGTATTCTTGAGG + Intergenic
1069142236 10:64840504-64840526 AGACCAGCTGTGTCACCTTGAGG - Intergenic
1072927765 10:99631358-99631380 TAACCAGCTGTGTTACCTTGAGG - Intergenic
1074443968 10:113503135-113503157 TCACCAGCTGTGTGATCTTGGGG - Intergenic
1074819400 10:117167402-117167424 TTACCAGCTGTGTGATCTTGGGG - Intergenic
1076067350 10:127459221-127459243 GAACCAGCAGTGGCAGCTGGGGG - Intergenic
1076802691 10:132838584-132838606 TTACCAGCTGTGGCATCTGCAGG - Intronic
1077958671 11:7049247-7049269 AAACATGCTGTGCCATCTTGGGG - Intronic
1078655180 11:13232136-13232158 TTACCAGCTGTGTGATCTTGGGG - Intergenic
1080230797 11:30016633-30016655 CCTCCAGCTGTTGCAGCTTGAGG - Exonic
1080735791 11:35012557-35012579 CAACCTGCTGGGGCATGGTGAGG - Intronic
1081676607 11:44973719-44973741 CAACCAGCTGTGACATCACAAGG - Intergenic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1083602571 11:63958083-63958105 GTCCCAGCTGTGGCATGTTGTGG + Intergenic
1084352971 11:68616736-68616758 CAGCCAGCTGTGCCATCGCGAGG - Intergenic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1089297748 11:117480279-117480301 CAAGCAGCTGTGGCTTCTGAAGG - Intronic
1090458596 11:126870259-126870281 CAGGCAGCCCTGGCATCTTGAGG - Intronic
1091055485 11:132414438-132414460 CATTCAGCTGAGGCTTCTTGTGG - Intergenic
1092091832 12:5810086-5810108 CATCCAGTTGCGGCATTTTGGGG - Intronic
1093176883 12:15922764-15922786 CATCTAGCTGTGGAACCTTGCGG + Intronic
1093630771 12:21406696-21406718 TTACCAGCTGTGAAATCTTGGGG - Intronic
1094069027 12:26392456-26392478 CAACCAGCTGTTTGATCTTCTGG + Intronic
1096071723 12:48779279-48779301 CTAACAGCTGTGTGATCTTGGGG - Intronic
1096924180 12:55124065-55124087 CAGCAAGCTGTGGACTCTTGTGG - Intergenic
1097798560 12:63888855-63888877 GGCCCAGCTGTGGCAGCTTGGGG - Intronic
1098201838 12:68064265-68064287 ACACCAGCTGTGGCAGATTGTGG - Intergenic
1098361656 12:69660079-69660101 CAACCAGCTGTGTGATCTTTGGG + Intronic
1099676245 12:85764374-85764396 CATTCACCTGTGTCATCTTGTGG + Intergenic
1103031201 12:117614676-117614698 CATTCAGCTGTGGAAACTTGGGG + Intronic
1103127128 12:118433392-118433414 CAAACAGCAGTTGGATCTTGTGG + Intergenic
1103583975 12:121937315-121937337 CATCCATCTGTGTCTTCTTGAGG + Intronic
1105439147 13:20401540-20401562 CAATCAGCTGTGGCTTATGGGGG - Intergenic
1106478895 13:30121902-30121924 TAACTAGCTGTGGGACCTTGGGG + Intergenic
1107128190 13:36867302-36867324 CTATCAGCTGTGGCATCTACAGG + Exonic
1108510682 13:51152986-51153008 CAACCAGGGCTGGCTTCTTGGGG + Intergenic
1109952934 13:69525109-69525131 CAACCAGCTTTGCAAACTTGAGG - Intergenic
1110039458 13:70734347-70734369 CAATCACCTGTGGCAACTTCTGG + Intergenic
1110686747 13:78384518-78384540 CTACCAGCTGTGTAACCTTGAGG - Intergenic
1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG + Intronic
1112730158 13:102351741-102351763 CAGCCAGCTGTCACATCCTGAGG - Intronic
1113072082 13:106431706-106431728 CACCCAGCTGTGGAAACTAGAGG - Intergenic
1116295694 14:43105397-43105419 CATCCAGCTGCAGCATTTTGAGG + Intergenic
1120637883 14:86974175-86974197 CAAACAGCTGTGTCATGGTGGGG - Intergenic
1121660677 14:95632811-95632833 AAAACAGCTGTGGCAAATTGTGG + Intergenic
1126263780 15:46728712-46728734 CAACAAGCTGTGCCTGCTTGGGG - Intergenic
1126300556 15:47190969-47190991 AAACCAGCTGTGGCAACATTCGG + Intronic
1132085087 15:98901861-98901883 CAACGAGTTGGGGCATCCTGGGG + Intronic
1134048966 16:11123665-11123687 CTAGGAGCTGTGGCATCATGAGG - Intronic
1136930006 16:34410181-34410203 TCACCAGCTCTGGCATCTTAGGG + Intergenic
1136974568 16:35001624-35001646 TCACCAGCTCTGGCATCTTAGGG - Intergenic
1138335924 16:56252781-56252803 CATCCAGCTGTTCCTTCTTGTGG + Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1139985738 16:70897196-70897218 GAACCAACTGTTGCCTCTTGAGG + Intronic
1143130578 17:4674591-4674613 CATCCAGCTTTAGCTTCTTGGGG + Exonic
1144716132 17:17437101-17437123 CAAGCAGCAGTGTCCTCTTGGGG + Intergenic
1144727663 17:17510002-17510024 CAACCAGCTGAGGCCCCTAGAGG - Intronic
1150230225 17:63545662-63545684 CAGCCAGGTGAGGCATCCTGGGG - Exonic
1150936108 17:69637467-69637489 TTCCCAGCTGTGGTATCTTGGGG - Intergenic
1152117305 17:78396430-78396452 CAAAAAGCTGTGGCATGTTGGGG - Intronic
1153918910 18:9771279-9771301 CAACCAGCTATGTGACCTTGAGG + Intronic
1154335724 18:13463102-13463124 AAACCCGGTGTGGCATCTTCAGG - Intronic
1154943063 18:21133205-21133227 TCACCAGGTGTGTCATCTTGGGG - Intergenic
1160200111 18:76788928-76788950 CAGCCAGCTGTCTCAGCTTGCGG - Intergenic
1162338139 19:10074184-10074206 CAACCTGCTCTGGCATAATGTGG + Intergenic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
927562319 2:24082885-24082907 CTTCCAGCTGTTACATCTTGTGG - Exonic
927837550 2:26412399-26412421 AAACCTGCTGTGTCATGTTGAGG + Intronic
930947542 2:57093076-57093098 ACACCAGCTGTGGTATCTAGGGG - Intergenic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
931945518 2:67302199-67302221 CAACCAGCTATGTGACCTTGAGG + Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
932759324 2:74429178-74429200 CAACTAGATGAGGCAGCTTGAGG + Intronic
933824656 2:86148222-86148244 CAACCATCTGTGTGACCTTGGGG + Intronic
935186050 2:100733898-100733920 CTGCCAGCTGTGGCATTGTGTGG + Intergenic
937914052 2:127090285-127090307 CAACCCGCTGTGGCCACATGAGG + Intronic
938578582 2:132626153-132626175 TAACCAGCAGTGTCACCTTGGGG - Intronic
938633656 2:133197577-133197599 CCAACATCTGTGTCATCTTGGGG - Intronic
942088316 2:172463611-172463633 CCACTAGCTGTGAGATCTTGGGG + Intronic
943324297 2:186479649-186479671 CAAGCAGCTGAGGCATCATCAGG + Intergenic
945149397 2:206772682-206772704 CAATCAGCTGTGCAATCATGAGG + Intronic
947919315 2:233855524-233855546 CTAGCAGCTGTGGCATCTTAAGG - Intergenic
1168924204 20:1566196-1566218 CAACCACCAGTAGCAGCTTGGGG + Exonic
1173364905 20:42376380-42376402 CAACCAGCTGTGGCCTGGAGAGG - Intronic
1174217134 20:48924697-48924719 CCACCAGCTGTAGCATATTAGGG + Intronic
1174933411 20:54841195-54841217 AAAAGAGCTGTGGCATATTGGGG + Intergenic
1177597014 21:23257803-23257825 CAGCCTACTGTGGCACCTTGTGG - Intergenic
1179479014 21:41666086-41666108 CAAACAGCACTGGCATCTTGTGG + Intergenic
1179602536 21:42489762-42489784 CCACCAGCTGTGGGACCTTGGGG - Intronic
1181007257 22:20019814-20019836 CATCCAGCAGTGGGATCATGTGG - Intronic
1184732815 22:46380295-46380317 CGGCCAGGTGTGGCCTCTTGGGG + Intronic
950217277 3:11168582-11168604 CAACCAACTGTGGCATTGTGCGG - Intronic
956177938 3:66491156-66491178 CCTCCAGCTGTGGCTACTTGAGG - Intronic
957752967 3:84446878-84446900 CATTCACCTGTGGCATCTTAGGG + Intergenic
957933788 3:86916019-86916041 CAACCATCTTTGACATCATGTGG - Intergenic
962327726 3:134449756-134449778 CCACCAGCTGCGGCACCTTCAGG + Intergenic
967294890 3:187955158-187955180 CAGCCAGTGGGGGCATCTTGGGG - Intergenic
973711453 4:53633818-53633840 AAACCAGCTGTGGGACTTTGGGG + Intronic
973728849 4:53803932-53803954 GAACCAGGTTTGGCTTCTTGGGG - Intronic
975823602 4:78296486-78296508 CAACCAGCCTTGGCCTCTTGTGG + Intronic
980152492 4:129063938-129063960 AACCGAGCTGTGCCATCTTGGGG + Intronic
980333610 4:131440800-131440822 AAACCAGCTGTGTCATGGTGGGG + Intergenic
980592740 4:134912536-134912558 GAACCTGCTGGGGCATCTTTAGG + Intergenic
984356904 4:178672149-178672171 CAAACAGCTGTGGAATGTTTAGG + Intergenic
986739685 5:10695227-10695249 GGACCAGCAGTGCCATCTTGTGG - Intronic
987244765 5:16037599-16037621 CAACCAGCTGCGTGACCTTGGGG - Intergenic
987850495 5:23346817-23346839 AAACCAGCTGTGGTTTTTTGAGG - Intergenic
989252471 5:39333486-39333508 CACCCAGCTGTTGCAGCTTGAGG + Intronic
993784302 5:92109487-92109509 TAACCAGCTGTGGGGCCTTGGGG + Intergenic
997012860 5:129899645-129899667 GAAGCAACTGTGGCATCTAGTGG - Intergenic
997955503 5:138275585-138275607 CATCCTGCTGTGGCCTCTGGGGG + Intergenic
1001267211 5:170282484-170282506 CCACCAGCTGTAGGACCTTGGGG - Intronic
1001835741 5:174830494-174830516 CAACCAGATATGTCATCTTAGGG - Intergenic
1002411742 5:179084464-179084486 CCAACATCTGTGTCATCTTGGGG - Intergenic
1003164309 6:3663087-3663109 CACCCAGCAGTGTCATCTGGGGG + Intergenic
1004691524 6:17996363-17996385 CAGCCAGGTGTGGGATCCTGGGG - Intergenic
1005203776 6:23377565-23377587 CAGCAAGCTCTGGCATTTTGTGG + Intergenic
1006907238 6:37540908-37540930 CTACCAGCTTTGTTATCTTGAGG + Intergenic
1008564006 6:52749658-52749680 CAACCACCTCTGCCAACTTGGGG + Intergenic
1014670517 6:124298924-124298946 TAACCATGTGTGGCAGCTTGTGG + Intronic
1017046969 6:150356101-150356123 AGACCAGCTGTGTCACCTTGAGG + Intergenic
1018405533 6:163477956-163477978 AAACCACCTGTGGAATTTTGTGG + Intronic
1018714920 6:166524820-166524842 CCACGAGCTGTGTCATCTTGGGG - Intronic
1022608152 7:31836728-31836750 AAACCAGATGTGGCAATTTGGGG - Intronic
1022865012 7:34408624-34408646 CAAACAGCTTTGACATCTGGTGG - Intergenic
1024437555 7:49376958-49376980 CAGCCACGTGGGGCATCTTGGGG - Intergenic
1026022288 7:66718402-66718424 CCAACATCTGTGCCATCTTGGGG + Intronic
1026886715 7:73953653-73953675 CCAACATCTGTGCCATCTTGTGG + Intergenic
1026906576 7:74066207-74066229 CAACCAGGTGTGGCACCTCATGG - Intronic
1029683363 7:102128133-102128155 CAGCCGGCTGTGGCATCTTGAGG + Intronic
1029887505 7:103888688-103888710 TACCAAGCTGTGGCATCATGGGG - Intronic
1031595515 7:123645616-123645638 CTCCCAGCTGTGCCAGCTTGTGG - Intergenic
1033049614 7:137992256-137992278 AAACCCTCTGTGGCATCCTGTGG - Intronic
1035037388 7:155904066-155904088 CATCCCTCTGTGGCATCCTGTGG - Intergenic
1035471161 7:159109665-159109687 GGAACAGCTGTGGCATATTGGGG - Intronic
1035590946 8:812509-812531 AAATCAGGTGTGGCATTTTGTGG + Intergenic
1036773406 8:11593857-11593879 AAAGCATCTGTGGCATCTGGAGG - Intergenic
1037116185 8:15230935-15230957 CTACCAGTAGTGGCACCTTGGGG - Intronic
1041257830 8:55994698-55994720 CAGCCAGCTTTGGCTTCTTTGGG + Intronic
1043156043 8:76780787-76780809 AAATCAGCTGTGGCATTCTGAGG + Intronic
1044865419 8:96565989-96566011 GTACCAGCTGTGTGATCTTGGGG + Intronic
1045324555 8:101108772-101108794 CAGCAAGCTGGTGCATCTTGTGG - Intergenic
1045772585 8:105760654-105760676 CAAGCAACTGTGACATCTTTAGG + Intronic
1047633734 8:126736297-126736319 CATGCACATGTGGCATCTTGAGG - Intergenic
1052167576 9:25352075-25352097 CATCCATCTGTGCCATCTTTTGG + Intergenic
1056530907 9:87486817-87486839 CAACCAGCTCTGACAGCATGGGG - Intergenic
1057266669 9:93621992-93622014 CAACCACCTGGGGCATTTGGGGG + Intronic
1059648314 9:116288930-116288952 CAACCAGCTATGCCAGATTGGGG + Intronic
1059759035 9:117320919-117320941 AAACCTGCAGAGGCATCTTGGGG + Intronic
1060329828 9:122657363-122657385 TAACCAGTTGTAGTATCTTGGGG - Intergenic
1062013213 9:134277882-134277904 CAACCAGCAGGGGCAGGTTGCGG + Intergenic
1062308361 9:135922055-135922077 CTACCAGCTGGGCCATCCTGGGG - Intergenic
1186482137 X:9904119-9904141 CCCTCAGCTCTGGCATCTTGGGG - Intronic
1186690480 X:11969988-11970010 CCAGTAGCTGTGGCATTTTGGGG + Intergenic
1187524660 X:20043449-20043471 AAGCCAGCTGTGGCATCATTTGG + Intronic
1188563346 X:31495253-31495275 CAGCCAAAGGTGGCATCTTGAGG - Intronic
1196050473 X:111298582-111298604 CAGCCAGCTGTGTGACCTTGGGG + Exonic
1196782782 X:119398705-119398727 TTACCAGCTGTGGGACCTTGGGG - Intergenic
1202082987 Y:21104037-21104059 CAAGCAGCTTGGCCATCTTGAGG - Intergenic