ID: 932502076

View in Genome Browser
Species Human (GRCh38)
Location 2:72191842-72191864
Sequence TCAGATGGATGAGTTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932502074_932502076 0 Left 932502074 2:72191819-72191841 CCAGCAGCAAGTCTAGAAATAAT 0: 1
1: 0
2: 0
3: 10
4: 160
Right 932502076 2:72191842-72191864 TCAGATGGATGAGTTGCTCATGG 0: 1
1: 0
2: 1
3: 20
4: 196
932502073_932502076 30 Left 932502073 2:72191789-72191811 CCTTGTTAGTGCACACAAATATA 0: 1
1: 0
2: 1
3: 15
4: 177
Right 932502076 2:72191842-72191864 TCAGATGGATGAGTTGCTCATGG 0: 1
1: 0
2: 1
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932502076 Original CRISPR TCAGATGGATGAGTTGCTCA TGG Intronic