ID: 932502076 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:72191842-72191864 |
| Sequence | TCAGATGGATGAGTTGCTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 20, 4: 196} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932502074_932502076 | 0 | Left | 932502074 | 2:72191819-72191841 | CCAGCAGCAAGTCTAGAAATAAT | 0: 1 1: 0 2: 0 3: 10 4: 160 |
||
| Right | 932502076 | 2:72191842-72191864 | TCAGATGGATGAGTTGCTCATGG | 0: 1 1: 0 2: 1 3: 20 4: 196 |
||||
| 932502073_932502076 | 30 | Left | 932502073 | 2:72191789-72191811 | CCTTGTTAGTGCACACAAATATA | 0: 1 1: 0 2: 1 3: 15 4: 177 |
||
| Right | 932502076 | 2:72191842-72191864 | TCAGATGGATGAGTTGCTCATGG | 0: 1 1: 0 2: 1 3: 20 4: 196 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932502076 | Original CRISPR | TCAGATGGATGAGTTGCTCA TGG | Intronic | ||