ID: 932502342

View in Genome Browser
Species Human (GRCh38)
Location 2:72194413-72194435
Sequence CCCAGGTCTCCAAAGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932502342 Original CRISPR CCCAGGTCTCCAAAGTTGTC TGG (reversed) Intronic
900651195 1:3730834-3730856 CCCTGGTGTCCAGAGGTGTCTGG + Intronic
903648230 1:24907357-24907379 TCCAGGTCCCCAAAGCGGTCAGG + Exonic
903741736 1:25562449-25562471 CCCAGGTCTCCAAAGCAGCCTGG - Intronic
906236158 1:44212413-44212435 CCTAGTTCTCCAAAGTTTTGGGG + Intergenic
906313001 1:44767235-44767257 ACCAGGTACCCAAAGTTCTCTGG - Exonic
907282963 1:53362850-53362872 CCCAGTTCTTCAGAGTTGTCAGG - Intergenic
910310640 1:85820191-85820213 CCCAGATCCCCAAACTTATCTGG - Intronic
915094271 1:153448875-153448897 CCCCGGTCTCCAAAAGTGTTGGG + Intergenic
917589097 1:176458859-176458881 CCTTGCTCTCCAAAGTTGCCTGG + Intergenic
919439771 1:197617304-197617326 CCCAGGTGTCAGAATTTGTCTGG - Intronic
919446792 1:197715029-197715051 ACCTGGTCTCCAAAGTCCTCTGG + Exonic
922063747 1:222116365-222116387 CTCTATTCTCCAAAGTTGTCAGG + Intergenic
1063867523 10:10381767-10381789 CCCAGCCCTCCACAGTTGACTGG - Intergenic
1063990628 10:11558172-11558194 GCCAGGGCTCCAAAGTTGTTTGG - Intronic
1067499590 10:46790473-46790495 CCCTGGTCTCCCAAGGTGCCAGG + Intergenic
1067595038 10:47549851-47549873 CCCTGGTCTCCCAAGGTGCCAGG - Intergenic
1067642146 10:48057932-48057954 CCCTGGTCTCCCAAGGTGCCAGG - Intergenic
1067850173 10:49749684-49749706 CCCAGCTCTCCAAGGGTGCCGGG + Intronic
1069456846 10:68560630-68560652 CCCCGGGCTCCAAAGTTGTGGGG + Intergenic
1070142260 10:73747090-73747112 CCCAGTTATCCAAACTTCTCAGG - Intronic
1073370623 10:102985628-102985650 CCCAGGTAACTCAAGTTGTCTGG - Intronic
1075015888 10:118909789-118909811 CCGTGGTCCCCAAAGATGTCAGG + Intergenic
1078530122 11:12130699-12130721 CCCAAGTATTCAAAGTTGGCAGG - Intronic
1079617422 11:22512742-22512764 CCCAGGGCTCAAAAGTTGGCTGG + Intergenic
1080624281 11:34014534-34014556 TCCAGATCTCCAAAGCTGCCAGG + Intergenic
1088386483 11:109263500-109263522 CTCAGATCTCCAAGGTTGGCTGG + Intergenic
1088950441 11:114564285-114564307 CCCAAGTCCCCAAAGTTCACTGG - Intergenic
1090843468 11:130512736-130512758 GCCAGTTCTCCAAAGTTTTAGGG - Intergenic
1091673012 12:2466712-2466734 CCAAGGTCTCCAGGCTTGTCCGG - Intronic
1093762247 12:22923495-22923517 CCCAGTTCTCCAAAGTTCAGTGG - Intergenic
1096675963 12:53226053-53226075 GCCAGGTCCCCAAAGATGTGTGG - Intronic
1102955289 12:117054830-117054852 CCCATGTCTGCAAAGATGGCTGG - Intronic
1103711359 12:122915150-122915172 CCCTGGTCTCCAAATTTTTGGGG - Intergenic
1108125364 13:47237078-47237100 CCCAGGACTCCTGAGTTTTCTGG + Intergenic
1108271281 13:48762043-48762065 CCCAGCTCTACAAATCTGTCTGG - Intergenic
1108499997 13:51061088-51061110 CCCAGATCTTCACAGTTGACAGG - Intergenic
1110565676 13:76955412-76955434 CCAAGGAGTCCAAAGTTTTCTGG + Exonic
1112749364 13:102566390-102566412 CCCAGGTCCCCAAAGTCACCAGG + Intergenic
1112786245 13:102954845-102954867 CCCAGCTCAGCAAAGTTGTGAGG + Intergenic
1113119371 13:106909887-106909909 CCCATGTCTCCAATGTCATCTGG + Intergenic
1114134296 14:19829497-19829519 CACAGGTGACCAATGTTGTCAGG + Intergenic
1116577125 14:46588469-46588491 CCCAGGTCCCTCAAGTTATCTGG + Intergenic
1118214232 14:63793313-63793335 GTCAGGTCTCAAAAGTTGTCTGG - Intergenic
1122476464 14:102013457-102013479 CCCAAGTCTCCCAAGTATTCTGG + Intronic
1123414090 15:20082529-20082551 CCCAGGTCTCCCCAGTGCTCAGG - Intergenic
1123488956 15:20764802-20764824 CCCTGGTTTCCACAGTTGTGGGG - Intergenic
1123523432 15:21089640-21089662 CCCAGGTCTCCCCAGTGCTCAGG - Intergenic
1123545455 15:21333889-21333911 CCCTGGTTTCCACAGTTGTGGGG - Intergenic
1124685654 15:31779738-31779760 CCTAGGGCTCCAAAGTGGCCCGG - Intronic
1125341952 15:38684092-38684114 CCCGGGTTTCCAGAGTTGTCAGG + Intergenic
1125530062 15:40407233-40407255 GCCAGATCTCAATAGTTGTCAGG - Intronic
1127716400 15:61653226-61653248 CCCAAGTGTCCACAGCTGTCAGG + Intergenic
1202953800 15_KI270727v1_random:61160-61182 CCCTGGTTTCCACAGTTGTGGGG - Intergenic
1134123689 16:11601808-11601830 CCTAGGCCTCCCATGTTGTCGGG + Intronic
1137905664 16:52319504-52319526 CTCAAGTCTACAAAGTTCTCAGG - Intergenic
1139144820 16:64310459-64310481 GCCAGGTATCGAAAGATGTCTGG + Intergenic
1147958944 17:44154481-44154503 CCCAGGTCTCCAAGTGTGCCAGG - Intronic
1148885978 17:50773097-50773119 CCTAGGCCTCCCAAATTGTCAGG - Intergenic
1151278730 17:73055893-73055915 CCCAGGGCTGCAACGTGGTCAGG - Intronic
1160785758 19:899668-899690 CCCAGGTCTCCAGCGTTTCCTGG + Exonic
1161145303 19:2674396-2674418 GCAAGGTCTCCAAAGGTGACTGG + Intronic
1163093877 19:15041533-15041555 CCCAGATCTGCAGAGTTTTCTGG - Intergenic
1165342573 19:35223514-35223536 CCCAGTGCTCCAAGGCTGTCAGG - Intergenic
1165356987 19:35310470-35310492 AGCATGTCTCCAAAGTTCTCAGG + Intronic
1165451610 19:35887159-35887181 CCCAGTTCCCCACAGTGGTCTGG - Intergenic
1166372498 19:42309990-42310012 CCCAGTTCCCCAGAGTTGTCTGG + Exonic
925318262 2:2941287-2941309 CCCAAGGCCCCAAAGCTGTCAGG + Intergenic
928297752 2:30099522-30099544 CCTAGGCCTCCAAAATTGTTAGG + Intergenic
932502342 2:72194413-72194435 CCCAGGTCTCCAAAGTTGTCTGG - Intronic
937082338 2:119149237-119149259 CCTTGGTCTCCTAAGTTGTTGGG - Intergenic
941689413 2:168483678-168483700 CCCAGGGATTCAAAGTTGACTGG - Intronic
944342076 2:198613282-198613304 CCCTGGTCTCCAAAAATGTCAGG + Intergenic
946096996 2:217283237-217283259 CCCTGGTCTCCAAAGGAATCTGG - Intergenic
947100180 2:226612354-226612376 CCCAGGTCTCCAACGCTTGCTGG + Intergenic
948193847 2:236080412-236080434 CACAGGCCTCTAAACTTGTCTGG - Intronic
948638624 2:239358915-239358937 CACTGGTTTCCAAAGTTATCAGG + Intronic
1169109310 20:3021786-3021808 CTCAGGTCTCCAGGGTTGCCTGG - Intronic
1169807325 20:9572868-9572890 CCATGGTCTGCAAAGTTTTCAGG + Intronic
1174978303 20:55360874-55360896 CCCAGGTCTCCATAGTACTGAGG - Intergenic
1175683042 20:61005360-61005382 CCCAGGTCATCAATGTTGTCAGG - Intergenic
1178341941 21:31793165-31793187 CCAAGGTCTCCCAGGTTGTGAGG + Intergenic
1179457509 21:41509089-41509111 CCCAGGTGATAAAAGTTGTCCGG - Intronic
1179896714 21:44367221-44367243 CCCAGGCCACCAAGGTTCTCAGG - Intronic
1179896724 21:44367255-44367277 CCCAGGCCACCAAGGTTCTCAGG - Intronic
1182546025 22:31077039-31077061 CCCAGGTCTCCCCAGTGCTCAGG + Intronic
950072254 3:10162110-10162132 ACCAGGTCTCCAAACTTGATAGG + Intergenic
950531336 3:13553856-13553878 CCCAGGTCTCACACCTTGTCGGG + Intronic
950533520 3:13566688-13566710 CCCAGGTTCCCCAAGTCGTCTGG - Intronic
954146170 3:48635389-48635411 CCCATGGCTCGCAAGTTGTCCGG + Exonic
954861973 3:53697920-53697942 CCCAGTTCTCCAAAGTCCCCTGG + Intronic
958592339 3:96174212-96174234 CCCAGGAGCCCTAAGTTGTCTGG + Intergenic
964486529 3:157190941-157190963 CACATGTCCCCAAGGTTGTCAGG - Intergenic
966474824 3:180331992-180332014 CACAGTTCTCCAAAGTCCTCTGG - Intergenic
967255552 3:187588224-187588246 CTCAGGTCTCCAGTGTTGTGAGG - Intergenic
967255884 3:187591416-187591438 CTCAGGTCTCCAGTGTTGTGAGG + Intergenic
969345602 4:6568003-6568025 GCCAGGTCCCCAACCTTGTCAGG + Intergenic
969574900 4:8031040-8031062 TCCGGTTCTCCAAAGCTGTCAGG + Intronic
969854325 4:9986832-9986854 CCCAGGCCTCCAAACAAGTCAGG - Intronic
971222995 4:24725989-24726011 CCCAGTTCTCTAAAGCTTTCTGG - Intergenic
972354786 4:38270048-38270070 CCCAGGACTCCACACTTCTCTGG + Intergenic
974530786 4:63105915-63105937 CCCAGGTCTGCAAAGTAGTGGGG - Intergenic
974854006 4:67437834-67437856 CCCATGTCTGAAAAGTTATCAGG - Intergenic
975678558 4:76852161-76852183 CCTGGGTCTAAAAAGTTGTCTGG + Intergenic
980035721 4:127880957-127880979 CCCAGGCCTCGGAAGGTGTCAGG + Exonic
981050685 4:140306583-140306605 ACCAGGCCTCCAGTGTTGTCTGG - Intronic
992910538 5:81392492-81392514 CCATGGTTTCCAAAGATGTCAGG + Intronic
995933791 5:117484192-117484214 CCCTGGTCTCCAAAGTTCACAGG - Intergenic
998105601 5:139467167-139467189 CCTAGGTCTCCCAAATTGTTGGG - Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999724296 5:154422180-154422202 CCCATGTCTACAAAGCTGTAAGG - Intergenic
1002711987 5:181200853-181200875 CCCAGGTCTCCCAACTTCACAGG - Intronic
1008344719 6:50412471-50412493 CCCAGGGCCACAAATTTGTCTGG - Intergenic
1017181067 6:151552608-151552630 CCAAATTCTCCAAATTTGTCCGG + Intronic
1018281659 6:162192566-162192588 CCTCGGTCTCCCAAGTTGTTGGG + Intronic
1021457129 7:20841776-20841798 CCTTGGCCTCCCAAGTTGTCGGG + Intergenic
1027977817 7:85181228-85181250 GCCATTTCTCCAAAGGTGTCTGG - Intronic
1028071812 7:86459912-86459934 CCTAGGTCTCCAAAGGTGCTGGG + Intergenic
1033881011 7:145883908-145883930 ATCATGTCTCCAAAGTTGTCAGG - Intergenic
1034266595 7:149783969-149783991 CCCAGCTCTCCACAGTCCTCTGG - Intergenic
1036662853 8:10719054-10719076 CCCAGGTCTCGACTGTTTTCGGG + Intergenic
1038905273 8:31895257-31895279 GCCAGGTCCCCAAAGAAGTCAGG + Intronic
1038917576 8:32041612-32041634 CCCAGGTTTCTAAAGCTCTCAGG + Intronic
1041947290 8:63460258-63460280 CCAAGGTCACTAAAGTTGGCTGG + Intergenic
1049982434 9:916620-916642 CCCTGGCCTCCCAAGGTGTCGGG + Intronic
1052987804 9:34500994-34501016 CCCAGGACTCCCAAGTGGTGAGG + Intronic
1054916600 9:70500256-70500278 CTCAGGGCTCCCAAGATGTCAGG - Intergenic
1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG + Intergenic
1056559896 9:87721044-87721066 CCAAGGACTCCATAGTTGTCTGG - Intergenic
1060103869 9:120861712-120861734 CCCAGGAATCCAAAGTTGGGGGG - Intronic
1061809453 9:133153950-133153972 ACCAGGTCTCCCAAGGTCTCAGG + Exonic
1061950407 9:133932867-133932889 CCCAGGTCTCCCCAGGTGGCAGG + Intronic
1186860773 X:13670397-13670419 CCAATGCCTTCAAAGTTGTCAGG + Intronic
1192330883 X:70174408-70174430 CTCAGCTATCCAAAGCTGTCTGG + Intergenic
1192508736 X:71708892-71708914 CCTAGGTCTCCCAAATTGACGGG - Intergenic
1192517961 X:71772661-71772683 CCTAGGTCTCCCAAATTGACGGG + Intergenic
1193698391 X:84736934-84736956 CCCATGCCTCCTCAGTTGTCAGG + Intergenic
1194978035 X:100412145-100412167 CCCATTTCTCCAACGGTGTCTGG - Intergenic
1195146009 X:102018204-102018226 ACCTGGTCCCCAAAGTTGTCAGG - Intergenic
1196247974 X:113423366-113423388 CTCAGGTGTTAAAAGTTGTCTGG - Intergenic