ID: 932502536

View in Genome Browser
Species Human (GRCh38)
Location 2:72196347-72196369
Sequence CTAAATTTACCCAGGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932502536_932502542 22 Left 932502536 2:72196347-72196369 CCTTATACCCTGGGTAAATTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 932502542 2:72196392-72196414 CTATGAAATATGCTTGAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 150
932502536_932502540 -2 Left 932502536 2:72196347-72196369 CCTTATACCCTGGGTAAATTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 932502540 2:72196368-72196390 AGAATAAGCTAGGCTCTCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932502536 Original CRISPR CTAAATTTACCCAGGGTATA AGG (reversed) Intronic
902982581 1:20136386-20136408 CTAAATTTACTCATCTTATAAGG - Intergenic
912214775 1:107596444-107596466 CTAAATTTTCCATAGGTATATGG + Intronic
916098935 1:161376855-161376877 CTAAATAAACCCAGATTATATGG - Intergenic
924705831 1:246501273-246501295 CTAAAATAACCCAAGGTTTAAGG - Intronic
1063269057 10:4486629-4486651 CTGAATCTCCCCAGGGCATAGGG - Intergenic
1066280846 10:33917095-33917117 TTAAAATTACCCAGGGTACCAGG + Intergenic
1069180795 10:65355761-65355783 CTAAATTTCTCCAAGGTCTAGGG + Intergenic
1071460074 10:85885338-85885360 GTATATTCAGCCAGGGTATATGG + Intronic
1071962353 10:90819265-90819287 ATAAAATTACCCAGGGTAAGTGG - Intronic
1078078477 11:8183735-8183757 CTAATTTTACACAGGGTGTGGGG + Intergenic
1080851114 11:36071010-36071032 CTAAATTTGCACCGGGTACAGGG - Intronic
1081284883 11:41255672-41255694 CTCAATTTTTCCAGGGTATCAGG - Intronic
1088258503 11:107923547-107923569 TTAAATTTAGCCAGGGGAAAAGG - Intronic
1088404955 11:109464627-109464649 TTAAATTTATCCAGGCTGTATGG + Intergenic
1089974336 11:122719315-122719337 CTAAATTTAACCAGGAAATTTGG + Intronic
1091098333 11:132845196-132845218 ATAAATTTACCCTGGGTATGAGG - Intronic
1091581019 12:1789783-1789805 CTAAATTTACCTAAGGCAAAAGG - Intergenic
1093236330 12:16612142-16612164 CTAAATTTACCCTGGTCAGAAGG + Intergenic
1093956135 12:25221170-25221192 CTAAAGTTACCCAGAGAATTAGG + Intronic
1097254304 12:57660710-57660732 CTAATTTTAGCCAGGCTAAATGG - Intergenic
1101773586 12:107774211-107774233 CTAATCTCACCCAGGATATAAGG - Intergenic
1104024882 12:125018437-125018459 CTAAATTTCCCCTTCGTATAAGG - Intronic
1109350867 13:61179448-61179470 CTAATTCTACTCGGGGTATAGGG - Intergenic
1110059374 13:71022162-71022184 TGAAATTTACCTAGGGTACAGGG + Intergenic
1115069296 14:29301794-29301816 CCTTATTTACCCAGGGCATATGG - Intergenic
1121315337 14:92957992-92958014 CTACAATGACCCAGGGAATAGGG + Intronic
1125293559 15:38176564-38176586 CTAAATCTACCCAAGGGAGAAGG - Intergenic
1135695586 16:24583370-24583392 CTAAATGTACCTAGGTTAAAAGG - Intergenic
1137259121 16:46808210-46808232 GTAAAATTACCCAAGGAATATGG + Intronic
1139213461 16:65104233-65104255 CTAACTTTCACCTGGGTATAAGG - Intronic
1148405437 17:47409670-47409692 CTAAAATTACCAAAGGTAAACGG + Exonic
1151021831 17:70625720-70625742 GTAAATTTAGCCAGCCTATAGGG - Intergenic
1153383354 18:4463632-4463654 CTTAATTTACACAGGGAATGTGG + Intergenic
1156300858 18:35834714-35834736 CTAAATTTATCAAGGGTTTTTGG - Intergenic
1156985752 18:43349547-43349569 CTAAATTTACCCAACGAGTAAGG - Intergenic
1158095946 18:53771209-53771231 ATAAATATACCAAGAGTATATGG + Intergenic
1164423836 19:28121946-28121968 GGAAATTTCCCCAGGGTAAAAGG + Intergenic
1165338846 19:35195867-35195889 CTGAATTTACCCAGGTTAACTGG - Intergenic
1165746095 19:38230009-38230031 CTAGATGTCCCCAGGGTATGTGG + Intergenic
1166479885 19:43162417-43162439 CAAAATGCACCCAGGGTATGTGG - Intronic
924985853 2:269095-269117 AAAAATATTCCCAGGGTATATGG + Intronic
927831860 2:26358248-26358270 CAAAATTTAGCCAGGCTATGGGG + Intronic
928727675 2:34193715-34193737 CCAATTTTACCCAGAGTTTATGG - Intergenic
931505553 2:62922558-62922580 CTAAATTTAAAAAGGTTATAGGG + Intronic
932145416 2:69311538-69311560 CTAACTCAACCCAGGGTAGACGG + Intergenic
932502536 2:72196347-72196369 CTAAATTTACCCAGGGTATAAGG - Intronic
932534489 2:72578417-72578439 GGAAATTTACCCAGCGTATTAGG - Intronic
933286515 2:80390170-80390192 CTAATCTTACCCAGGGCTTAAGG + Intronic
937922361 2:127139749-127139771 CTACACTTACACAGGCTATAAGG - Intergenic
941885202 2:170520721-170520743 CTACATTTAGCCAGGGTATCGGG - Intronic
942867689 2:180696213-180696235 CTAGATTTACCCAGGCTATGTGG + Intergenic
945609001 2:211974482-211974504 GATAATTTACCCAGGTTATATGG - Intronic
945902309 2:215552791-215552813 CTGAATATACTGAGGGTATAAGG - Intergenic
1172783052 20:37448564-37448586 CAAAATTTACACAGAGTAAATGG - Intergenic
1172853354 20:37982505-37982527 CTAAATTTCCCCAGTGTGTTTGG - Intergenic
1177920166 21:27142924-27142946 GTAAATTTACCTAGAATATAAGG - Intergenic
1177958679 21:27634242-27634264 TGAACTTTACTCAGGGTATATGG + Intergenic
1180833132 22:18916272-18916294 CTAAATTTCATCAGGGTATTCGG - Intronic
1181066693 22:20309977-20309999 CTAAATTTCATCAGGGTATTCGG + Intergenic
1185166418 22:49265263-49265285 CTAACTTTACCAAGGGAATAGGG - Intergenic
1203283216 22_KI270734v1_random:141576-141598 CTAAATTTCATCAGGGTATTCGG - Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950777447 3:15362872-15362894 CTAATTTGACCAAGGGCATAGGG + Intergenic
952332125 3:32373813-32373835 CTAAATGAACCCAGGGCATAGGG + Intergenic
952910326 3:38179181-38179203 CAAAATTTACCCAGGCGTTATGG - Intronic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
975697943 4:77032531-77032553 CTAAACTAACCAAGGATATAGGG + Intronic
976148573 4:82068757-82068779 CTATATTTACCCAAGGTTTTTGG - Intergenic
977839891 4:101690182-101690204 CTAAGTTTAACCAGGCCATAGGG + Intronic
979383100 4:120031736-120031758 GTAAATTAACCCAGGAGATATGG - Intergenic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
983856489 4:172652683-172652705 CAATATTTACCCAGATTATAAGG - Intronic
988132036 5:27119276-27119298 CTAAATTTTGGCAGTGTATATGG - Intronic
989133108 5:38126656-38126678 CAAAGTATACCCAGGGTAAAGGG + Intergenic
990175830 5:53107343-53107365 TTAAATTTACACATAGTATATGG + Intronic
990569518 5:57064030-57064052 CTAAATTGGCCCAGGCAATATGG + Intergenic
993132613 5:83918292-83918314 CTAAATTTACCCTGGGAGAAAGG + Intergenic
994572482 5:101531949-101531971 CTAAATTTACCCTTTGTATAAGG - Intergenic
996529604 5:124514089-124514111 AATAATTTACCCAGGATATATGG - Intergenic
997992307 5:138555107-138555129 CTAAATGTACCAAAGGTCTAAGG + Exonic
998441067 5:142162593-142162615 ATAAATTTACTCAGAGTATTTGG + Intergenic
1000925870 5:167193356-167193378 CTAAGTTTCCCCAGTGCATATGG - Intergenic
1004162113 6:13223557-13223579 CTAAATGTACCCAGGCAAGATGG - Intronic
1004239556 6:13907817-13907839 CTAAATTTAGCCATAATATAAGG - Intergenic
1010001232 6:70951933-70951955 GTAAATGTACCAAGGGTAAAAGG + Intronic
1012316326 6:97785488-97785510 CTAATTTTACAGAGGGTAAAAGG + Intergenic
1012520226 6:100112463-100112485 CTATATTTTCCCAGGGCTTATGG + Intergenic
1012569360 6:100702588-100702610 CTAAATTTATAAAGGGTCTAAGG + Intronic
1014585727 6:123195337-123195359 GTAAATTTTCCCAGGGCAAAAGG + Intergenic
1016074280 6:139777624-139777646 ATAAATGTACACAGTGTATAGGG + Intergenic
1022560479 7:31343786-31343808 CTCAATTCTCCAAGGGTATAAGG + Intergenic
1028415110 7:90571915-90571937 GTATATTTACCATGGGTATATGG - Intronic
1031671130 7:124547776-124547798 TTAAATTTACATTGGGTATATGG + Intergenic
1033622538 7:143075270-143075292 CAAAATATACCTAAGGTATAGGG - Intergenic
1042426664 8:68657028-68657050 CTCAATTTACCTAGGGTTCAGGG - Intronic
1047415029 8:124657683-124657705 CCAAATTTAACCAGGATACAGGG + Intronic
1048053305 8:130839734-130839756 CTAAATGGATCCTGGGTATAAGG + Intronic
1058371672 9:104276172-104276194 CTAAAAATACCCAGGGTCAATGG + Intergenic
1059529886 9:115026160-115026182 CTCAATTTACTCTGGGTGTATGG - Intronic
1059911675 9:119051835-119051857 CTAAATTTTAGCAGTGTATATGG - Intergenic
1060296757 9:122348311-122348333 CTCAATTACCCCAGGGTGTAGGG - Intergenic
1060533015 9:124359682-124359704 TTAAATTTACCCAGGTCTTAAGG - Intronic
1185953045 X:4457694-4457716 CTAAATTTACCCAGTGAGGACGG - Intergenic
1193733052 X:85124842-85124864 ATAAATCTACCCAGGGTGGATGG + Intergenic
1195963912 X:110413215-110413237 TAAAATTTATCCAGGGTGTAGGG - Intronic
1197605613 X:128581942-128581964 CTGTATTTACCCAGGAAATAAGG + Intergenic
1199307731 X:146287177-146287199 CTATATATACCCATGGAATAGGG + Intergenic