ID: 932503166

View in Genome Browser
Species Human (GRCh38)
Location 2:72202835-72202857
Sequence GTGAAATCCATAAAGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932503166_932503172 3 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503172 2:72202861-72202883 CATTTTATAGCACTGAGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 94
932503166_932503174 11 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503174 2:72202869-72202891 AGCACTGAGCCGGGGACAGAGGG 0: 1
1: 0
2: 5
3: 29
4: 277
932503166_932503175 15 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503175 2:72202873-72202895 CTGAGCCGGGGACAGAGGGTAGG 0: 1
1: 1
2: 3
3: 40
4: 367
932503166_932503176 16 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503176 2:72202874-72202896 TGAGCCGGGGACAGAGGGTAGGG 0: 1
1: 0
2: 1
3: 32
4: 268
932503166_932503173 10 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503173 2:72202868-72202890 TAGCACTGAGCCGGGGACAGAGG 0: 1
1: 0
2: 1
3: 24
4: 435
932503166_932503178 24 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503178 2:72202882-72202904 GGACAGAGGGTAGGGAGTTTAGG 0: 1
1: 0
2: 4
3: 34
4: 320
932503166_932503170 1 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503170 2:72202859-72202881 AACATTTTATAGCACTGAGCCGG 0: 1
1: 0
2: 0
3: 8
4: 166
932503166_932503171 2 Left 932503166 2:72202835-72202857 CCTGTCCCCTTTATGGATTTCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 932503171 2:72202860-72202882 ACATTTTATAGCACTGAGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932503166 Original CRISPR GTGAAATCCATAAAGGGGAC AGG (reversed) Intronic
904581096 1:31544849-31544871 GTGAAGTTTATAAAGGGGACAGG - Intergenic
904621545 1:31778337-31778359 GAGAAAACCTTAAAGGGGATGGG - Intergenic
908231927 1:62113776-62113798 GTGAAATCAATGAAAGAGACAGG - Intronic
911707963 1:101037198-101037220 GTGATATCCCTATAGGGCACAGG - Intergenic
912064062 1:105713077-105713099 GGTAAATCCATAAATGGGGCTGG - Intergenic
912504015 1:110143279-110143301 GTGAAAATCTGAAAGGGGACAGG - Intergenic
914321588 1:146567911-146567933 GTGAAATGCAGAAAGTGTACTGG - Intergenic
915211538 1:154313242-154313264 GAGAGATACAGAAAGGGGACGGG - Intergenic
918015067 1:180625239-180625261 GAGAAATTCACAAAGGAGACTGG - Intergenic
920335739 1:205244016-205244038 GTGAAATGCATAGAAGGGGCAGG + Intronic
922342500 1:224669073-224669095 GTGAAATCCAGAGAGGAGAAGGG - Intronic
923086372 1:230706201-230706223 CTGAAATCCAGACAGGAGACAGG + Intronic
1066249340 10:33617933-33617955 ATGAAAGCCACAGAGGGGACAGG - Intergenic
1069625538 10:69865627-69865649 CTGAAATCCCTGTAGGGGACAGG + Intronic
1072764458 10:98084258-98084280 GTGAGATCCAGGCAGGGGACTGG - Intergenic
1077027317 11:446661-446683 GGTAAATCCATAAAGGTGAGTGG - Intergenic
1077983961 11:7332101-7332123 GTGAAACCCATAAAGAAGAAAGG + Intronic
1082822674 11:57554789-57554811 GTGAAATCACCAAAGGGCACTGG + Intronic
1082899141 11:58227068-58227090 GTGAATACCATAAAGGGAAGTGG + Intergenic
1083048064 11:59754433-59754455 TGGAGATCCATAAACGGGACTGG - Intronic
1085096158 11:73761815-73761837 GCAAAATCCATAAAGCGGGCTGG + Intergenic
1085652589 11:78281623-78281645 GGGAAATCTGAAAAGGGGACAGG - Intronic
1087158117 11:94924012-94924034 GTGAAACCCATAAGGGAGAGAGG + Intergenic
1088194279 11:107258169-107258191 GTGAAAACCACAAAGGGGACGGG + Intergenic
1089701766 11:120249001-120249023 GTGAAATCCCCAAGGGGTACTGG + Intronic
1094643995 12:32303236-32303258 GTGAAATGCATTATGAGGACTGG - Intronic
1095938363 12:47709435-47709457 GTGTATTTGATAAAGGGGACTGG + Intergenic
1096451270 12:51743915-51743937 GTGAAACCCATCAAGAGGACAGG + Intronic
1100273139 12:93045274-93045296 TTGAAATCCATTAAGGGCTCTGG + Intergenic
1102726180 12:115066859-115066881 GTGATCTCCCTAAAGGGGTCAGG - Intergenic
1103223469 12:119266445-119266467 GGGAAATCCAAAAAAGTGACAGG - Intergenic
1107563893 13:41582668-41582690 GTGAAAGGCATAAAGGGAATAGG - Intronic
1108007914 13:45971099-45971121 GTGATTTCCATGAAGGGGAAAGG - Intronic
1108912733 13:55577143-55577165 GTGATATGCAGAAAGGGGAAGGG - Intergenic
1122962198 14:105099902-105099924 GGGAAATGCAAAAAGGTGACTGG - Intergenic
1123129414 14:105973666-105973688 GTGAAAGCCTTAAAGGGGTAGGG - Intergenic
1123409930 15:20049832-20049854 GTGAAAACCCTAAAGGGGTAGGG - Intergenic
1123519262 15:21056540-21056562 GTGAAAACCCTAAAGGGGTAGGG - Intergenic
1123715213 15:23023451-23023473 CCTAAATCCATTAAGGGGACTGG + Intronic
1127982325 15:64044520-64044542 CTGAGATCCAGAAAGGGGAAGGG + Intronic
1128830747 15:70766128-70766150 GAAAAATCCATAAAGGCCACTGG - Intergenic
1131861675 15:96660619-96660641 GTGAAAGCATTAAAGGGCACTGG + Intergenic
1132824537 16:1896995-1897017 GTGCAATTAATAAAGGAGACAGG - Intergenic
1133325612 16:4940541-4940563 GTGAACTCCTTGAAGGGGTCTGG + Intronic
1133762997 16:8814603-8814625 CTGAAACCCATAAAGGGTAAGGG + Intronic
1135609382 16:23852953-23852975 GTGAAATCCGTATGGGAGACAGG + Intronic
1138368906 16:56508554-56508576 GTCAAAACCATAAAGGATACAGG + Intronic
1140012042 16:71143232-71143254 GTGAAATGCAGAAAGTGTACTGG + Intronic
1143425280 17:6831453-6831475 GTAGAAGCCATAAAAGGGACTGG - Intronic
1148078376 17:44953131-44953153 GGGAAATCCTGAAAGGGGGCTGG + Intergenic
1150129313 17:62658474-62658496 CTGAAGTCCAGAAAGGGGACGGG - Intronic
1150761341 17:67965043-67965065 ATGAAAAACAAAAAGGGGACTGG + Intronic
1153233342 18:2961795-2961817 GTGAAAGCCATTCTGGGGACTGG + Intronic
1153449765 18:5214041-5214063 GAGAAACCAATAAAGGAGACAGG + Intergenic
1156487136 18:37473523-37473545 GTGAGATTCATAAGGGGGAAGGG - Intronic
1156996911 18:43479681-43479703 CTGTAAACCATAAAGGGGAGGGG + Intergenic
1157804958 18:50651016-50651038 CTGAAATCCAGAAAGAGGAAAGG - Intronic
1158342000 18:56476253-56476275 GTGAAAGAAATAAAGAGGACTGG - Intergenic
1162507644 19:11095984-11096006 TTGAAATGGATAAAGGGGGCTGG + Intronic
930375212 2:50556972-50556994 GAGAAAGCCAGAAAGGGGTCAGG - Intronic
932503166 2:72202835-72202857 GTGAAATCCATAAAGGGGACAGG - Intronic
935508037 2:103931831-103931853 GTGAGATCCACAGAGAGGACTGG + Intergenic
939982478 2:148798109-148798131 AAGAAATCCATAAAGAAGACTGG + Intergenic
943894422 2:193336177-193336199 ATTAACTCCATACAGGGGACAGG + Intergenic
948470658 2:238175750-238175772 GTGAAATGGATAAAGCAGACTGG - Intronic
1180600686 22:17013184-17013206 GATAAAGCCAGAAAGGGGACAGG - Intergenic
1181716264 22:24732092-24732114 GTGAACTTCATAAATGTGACTGG - Intronic
1182310524 22:29402227-29402249 GTAAAATCCATAAAATGGAATGG + Intronic
950142349 3:10624056-10624078 GTGAAATCTACAAGGGGGATGGG - Intronic
952241755 3:31537612-31537634 ATGAAAACCATAAAGGGGGAAGG - Intronic
957987327 3:87589209-87589231 GGGCAATCCATAAAGGGAAGAGG + Intergenic
958834490 3:99128669-99128691 ATAAAATGCATAAAGGGGTCAGG + Intergenic
960072458 3:113446546-113446568 GTGAAATGCATATAGGGGTGAGG - Intronic
963073796 3:141328167-141328189 GAGAAGTCCATGAAGGAGACTGG - Intronic
964575999 3:158169107-158169129 GTGAAAACCACAAAAGGGAAAGG - Intronic
965894971 3:173564449-173564471 GTGTAATCCATGAAGAGAACTGG - Intronic
968704308 4:2070925-2070947 GTGACATCCCTGAAGGGTACAGG + Intergenic
972777410 4:42255075-42255097 GTGAAACTAATAAAGGGGATGGG + Intergenic
974658363 4:64854692-64854714 GTGATATCCATAAAGTGGAGTGG + Intergenic
974892720 4:67901267-67901289 GTGAAATCCATAAGAGAAACAGG + Intergenic
976518766 4:86002724-86002746 GTAGAATCCAAAAAGGGGCCAGG + Intergenic
979319442 4:119305153-119305175 GGAAAATCCACAAAGGGGAAAGG - Intergenic
981253004 4:142626328-142626350 GGTAAATCCTTAAAAGGGACAGG + Intronic
982246794 4:153361138-153361160 TTTAAATCCATAAAGTGCACAGG - Intronic
987059767 5:14231369-14231391 GTGAAATCCATAAAAGTGAGTGG - Intronic
991984693 5:72272631-72272653 GTGAAATCAGCAAAGGGGAAAGG - Intronic
994708336 5:103233644-103233666 GTGATACCCATAAAGGGGATGGG + Intergenic
996552531 5:124745243-124745265 GGGGAATCAGTAAAGGGGACAGG + Exonic
997010625 5:129872891-129872913 GTGAAAGCCATAAAGCAGACAGG - Intergenic
997956318 5:138281230-138281252 GCAAAATCCATGAAGTGGACAGG + Intergenic
998879430 5:146631535-146631557 GTGAAATCCTCAAGTGGGACTGG - Intronic
1002477450 5:179475983-179476005 GTCAACTCCATTTAGGGGACTGG + Intergenic
1003448064 6:6203279-6203301 GTGAAATCTATAAACAGAACAGG + Intronic
1005665990 6:28056257-28056279 GTGAAATCCATAGAGGTAAAAGG - Intergenic
1013023328 6:106242406-106242428 GTCAAATCCATAAAGTAGAATGG + Intronic
1017335144 6:153248948-153248970 GTGAAATCAATAAAGGGTTTTGG - Intergenic
1017680158 6:156855451-156855473 GTGAAACACACAAAGTGGACGGG - Intronic
1017958425 6:159199667-159199689 GTGAAATCCATGTAGGAAACAGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1023258937 7:38339460-38339482 GAGAAATCCAGAATGGGGCCTGG + Intergenic
1023939311 7:44759809-44759831 GAGAAATCCATTGAGAGGACAGG + Intronic
1024089768 7:45925602-45925624 GTGAAGTCTTAAAAGGGGACAGG + Intergenic
1028317994 7:89427703-89427725 TTAAAATCCATGAAGGGGCCGGG - Intergenic
1028455498 7:91033887-91033909 GTGAAATCCATAAGGGAATCAGG + Intronic
1029841451 7:103368256-103368278 GTGAAATCCTTAAACGGGTGTGG - Exonic
1041174177 8:55176999-55177021 GTTAAATCCATAAATGTGAGTGG + Intronic
1042067104 8:64890334-64890356 GTGATATTCAAATAGGGGACTGG + Intergenic
1045051931 8:98335290-98335312 GTTAATTCCACAGAGGGGACGGG - Intergenic
1048652319 8:136491779-136491801 GTGAAAACCATAATGGGGAGAGG - Intergenic
1048936670 8:139363314-139363336 GTGACATCCAGCAAGGTGACAGG + Intergenic
1050165536 9:2761071-2761093 GTGAAATTCATGAGGGGGATGGG - Intronic
1050538597 9:6650926-6650948 TTGAAATGAATAAAGGGGCCAGG + Intergenic
1050576560 9:7002206-7002228 TTGAACTCCATAAAGGGAAAGGG + Intronic
1061628618 9:131857141-131857163 TTGAGATCCAGAAAGGGGAGAGG - Intergenic
1062613641 9:137386599-137386621 GTGGAGTCCATAAAGTGGCCTGG - Intronic
1188558162 X:31435590-31435612 GCCAACTCCATAAAGGGGAATGG - Intronic
1189007668 X:37011345-37011367 ATGAAATCCTTAAAGGCGATTGG - Exonic
1192765671 X:74137561-74137583 GTCAATTCCATAAAGAAGACTGG - Intergenic
1195642906 X:107196744-107196766 TTGAAATACATAAAGGAGGCCGG - Intronic
1197049651 X:122042905-122042927 CTGAGATCCATAAAGGGCAGGGG - Intergenic
1200627562 Y:5538288-5538310 GGGAAAACAATAAATGGGACTGG + Intronic