ID: 932506391

View in Genome Browser
Species Human (GRCh38)
Location 2:72236141-72236163
Sequence GTTCCTCTCCTTACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932506390_932506391 -5 Left 932506390 2:72236123-72236145 CCAAAATGAACTGAGAAGGTTCC 0: 1
1: 0
2: 4
3: 27
4: 187
Right 932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 87
932506388_932506391 15 Left 932506388 2:72236103-72236125 CCTTGGATTCTTGAGCTGAACCA 0: 1
1: 0
2: 0
3: 12
4: 255
Right 932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 87
932506387_932506391 16 Left 932506387 2:72236102-72236124 CCCTTGGATTCTTGAGCTGAACC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932506391 Original CRISPR GTTCCTCTCCTTACTAGAGC AGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900285273 1:1896076-1896098 TTTCCTCTCCCTGCTAGAGTTGG + Intergenic
904428165 1:30445022-30445044 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
904695615 1:32329246-32329268 GAATCTCTCCTTACTAAAGCTGG + Intronic
905008384 1:34729649-34729671 GACCCTCTCCTCACTAGGGCAGG - Intronic
906471339 1:46133332-46133354 GCTCCTCTCCTTACTCGTCCGGG - Intronic
906801077 1:48737416-48737438 GCTGCTCTCCTTACTTGAGCTGG - Intronic
910541504 1:88363393-88363415 GTTTCTCTCTTTGCTTGAGCTGG - Intergenic
912932942 1:113980758-113980780 GAACCTCTCCTTAATAGACCTGG - Intronic
917595565 1:176525926-176525948 GTTCTTCTCCTGAGTAGAGGTGG + Intronic
919753295 1:201051791-201051813 GCTCCCTTCCTTCCTAGAGCAGG + Intronic
921419790 1:214933237-214933259 GTTCCTCTCTTCTCTAGAGTGGG + Intergenic
922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG + Intergenic
1065229633 10:23583863-23583885 GATCCTCCCCTTACTAGAGTTGG - Intergenic
1069932368 10:71891405-71891427 GTCTCTCTCCCTAGTAGAGCTGG - Intergenic
1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG + Intergenic
1074401891 10:113148282-113148304 GCTCTTCTCCTGACGAGAGCCGG + Intronic
1079894834 11:26105283-26105305 GTTCTTATCCTTAGTAGAACTGG - Intergenic
1080795007 11:35555038-35555060 GCTGCTCTTCTTACTATAGCAGG + Intergenic
1089082792 11:115791257-115791279 GTTCCTGTCCATATTACAGCAGG - Intergenic
1090918390 11:131186898-131186920 GTTCCTGTCCTTGCGAGAGGCGG + Intergenic
1098274372 12:68798763-68798785 TTTCCTCCTCTTACCAGAGCAGG + Intergenic
1104131141 12:125895562-125895584 GTTTCTCTTGTTACTAGAACAGG - Intergenic
1105303512 13:19154389-19154411 GTTCCTACCCTTACCAGACCAGG - Intergenic
1105890039 13:24676214-24676236 GTTCCTCTCCCGACGAGAGGAGG - Intergenic
1106073388 13:26435595-26435617 GTTCCTCTGATTAGTAGTGCCGG - Intergenic
1112988410 13:105480806-105480828 GTTTCTCTCCTTCTTAGGGCTGG - Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1124795214 15:32771629-32771651 GTTACTCTCCTTTCTAGTTCAGG + Exonic
1124907500 15:33884975-33884997 ATTCCTCTGCTTTCTAGAGTTGG - Intronic
1125241058 15:37576301-37576323 ATTCCTCTCCTGCCTAGAGTAGG - Intergenic
1126932418 15:53669347-53669369 GTTCCTGACCTTGCTAGAGAGGG - Intronic
1127390321 15:58499995-58500017 CTTACTCTCCTTACTCCAGCTGG - Intronic
1127816936 15:62619336-62619358 GTTTCTCTCCTTAGAGGAGCTGG + Intronic
1130302640 15:82691762-82691784 GTGACTCTCCATACTAAAGCCGG - Intronic
1133256335 16:4518617-4518639 GATCCTCTCCTTGGTAGAGAAGG - Intronic
1134855809 16:17518071-17518093 GTTCCTGTCCTTGCTGGGGCTGG - Intergenic
1147328884 17:39684713-39684735 GTTCCTGTTCTTTCAAGAGCCGG - Exonic
1150437891 17:65168196-65168218 GTTCCTCTCCTTTCCAGCCCTGG - Exonic
1150858509 17:68776579-68776601 GTGCCTCTCTTAACAAGAGCAGG - Intergenic
1163553834 19:17981768-17981790 GTTCCTCATCTCGCTAGAGCTGG + Exonic
1163705785 19:18812430-18812452 GTTCTTCTCTCTACTAGAGTCGG + Intergenic
926704934 2:15830385-15830407 TTTCCTCTCTTTCCTGGAGCTGG + Intergenic
930525465 2:52524440-52524462 GTTGCTATCCTTACTAAAACAGG - Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
936096571 2:109534857-109534879 GTTTCTTACCTGACTAGAGCTGG + Intergenic
940598456 2:155825870-155825892 TTTCCTCTCCATTCTAGAGCTGG + Intergenic
942877226 2:180815288-180815310 GCTGCTCTGCTTACTAGAGTTGG - Intergenic
945926954 2:215815551-215815573 GTTCATCTTCATACTACAGCTGG + Intergenic
1169389747 20:5180153-5180175 GTTCCTTTCCTTCCTGGAGAAGG + Intronic
1170814632 20:19703146-19703168 GTTGCTCTCCTTCCTTGAGAGGG + Intronic
1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG + Intergenic
1183116527 22:35696826-35696848 ATTACTCCCCATACTAGAGCAGG + Intergenic
1184493147 22:44821903-44821925 GTTCCTCTCCTTAGAAGAGGTGG + Intronic
950555721 3:13694851-13694873 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
953110626 3:39934523-39934545 GTTCTTCTCCTTTCCTGAGCTGG - Intronic
959614559 3:108332800-108332822 GTTCCTCTCCTTCCTGAAGCTGG + Intronic
964826909 3:160838723-160838745 TTCCATCTCCTTACTAGAGATGG - Intronic
966827615 3:183978268-183978290 GGTCCTCTCCTTACTGGACCTGG - Intronic
968458158 4:708882-708904 ATTCCTTCCCTTACTAGAGAGGG - Intronic
973870028 4:55157526-55157548 GCTCCCTTCCTTCCTAGAGCAGG + Intergenic
975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG + Intergenic
976314694 4:83646774-83646796 GTTCCTCACTTCACTTGAGCTGG - Intergenic
976518683 4:86001793-86001815 GATTCTCTCCCTACTACAGCTGG + Exonic
976589809 4:86837880-86837902 CTCCCTCTCCTTTGTAGAGCAGG - Intronic
976853405 4:89575583-89575605 GTTCCACAGATTACTAGAGCAGG - Intergenic
976899094 4:90151976-90151998 ATTCCTTTACTTAATAGAGCTGG - Intronic
993535825 5:89085124-89085146 TTTCCTCTCCTTTCTGGACCAGG + Intergenic
995627530 5:114095671-114095693 GTTTCTCTGCTTAGTACAGCAGG + Intergenic
998389303 5:141777051-141777073 GTTTCTGTCCTTCCTAGAGCTGG + Intergenic
1002919465 6:1556181-1556203 GTTCCTGTTCTTACTTCAGCTGG + Intergenic
1004184237 6:13408232-13408254 TTTCCTTTCCTTCTTAGAGCAGG + Intronic
1005856020 6:29863929-29863951 GATCCTCTCCTCACTAGCCCAGG - Intergenic
1006255414 6:32828893-32828915 GGTCCTGTCCCTCCTAGAGCTGG + Intronic
1007816184 6:44527233-44527255 CCTCCTCTCCTTACAAGAGAGGG - Intergenic
1008240380 6:49102644-49102666 GTTCCTCCCTTTAAGAGAGCAGG - Intergenic
1008809595 6:55479850-55479872 ATTCCTCTGCTTACTAAAGAAGG + Intronic
1011813117 6:91155706-91155728 ATTTTTCTCCTGACTAGAGCAGG - Intergenic
1019169814 6:170126858-170126880 GTTCCTTTCATTACTAGTGAGGG - Intergenic
1019324525 7:431767-431789 GTTCCCCTCCAGCCTAGAGCTGG + Intergenic
1024917195 7:54515077-54515099 GTTCCTCTCCATACTACCACAGG - Intergenic
1031935863 7:127735151-127735173 GTTCCTCCACTTACCAGAGAAGG - Intronic
1037104981 8:15095866-15095888 GTTCCACTCCTTCCTAAATCAGG + Intronic
1037646054 8:20793726-20793748 GTTCCTATTCTACCTAGAGCTGG - Intergenic
1038746796 8:30261818-30261840 GTTGCTCTCTTTCCTGGAGCTGG + Intergenic
1039722550 8:40180088-40180110 GTTCCTCTCTTGACTTGAGATGG + Intergenic
1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG + Intronic
1045106221 8:98895417-98895439 CTTCCTCTCCATACTGGAGGAGG - Intronic
1045156799 8:99485032-99485054 GTTCCTGACTTTACAAGAGCTGG - Intronic
1052697058 9:31891494-31891516 GTTCCTGCCCTTTCTAGAGCTGG - Intergenic
1054690280 9:68317200-68317222 ATTACTCTCCATAATAGAGCAGG + Intergenic
1056509301 9:87287770-87287792 GTTCCTCTTCTGAGTAGAGGCGG - Intergenic
1060244884 9:121936629-121936651 GGTCCTTTCCTTGCCAGAGCAGG + Intronic
1061643136 9:131975875-131975897 GTTCCTCTCCCTTGGAGAGCTGG - Intronic
1062036266 9:134384028-134384050 TATCTTCTCCTCACTAGAGCTGG + Intronic
1188635974 X:32432071-32432093 GTTCCTCACCTTACAAGAATAGG + Intronic
1188967161 X:36568554-36568576 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG + Intergenic
1190283374 X:48946108-48946130 GTTCCACCCCTTGCTTGAGCTGG - Intronic
1197518944 X:127473303-127473325 GTTCCTCTCCATACTACCACAGG + Intergenic
1200703069 Y:6418685-6418707 GCTCCTCTTCTTTCTAGAGAGGG + Intergenic
1201031041 Y:9746012-9746034 GCTCCTCTTCTTTCTAGAGAGGG - Intergenic
1201484913 Y:14483697-14483719 GTTCCTCTTATTATGAGAGCAGG - Intergenic