ID: 932515092

View in Genome Browser
Species Human (GRCh38)
Location 2:72338110-72338132
Sequence AGAGCTACTAAGTGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932515092 Original CRISPR AGAGCTACTAAGTGGAAAGC TGG (reversed) Intronic
901246769 1:7737855-7737877 AGAGACACAAAGTGCAAAGCCGG - Intronic
901940320 1:12656842-12656864 AAAGCTACTCAGTGTAAGGCTGG + Intronic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
906679224 1:47713798-47713820 AGAGCTAGAGAGTGCAAAGCCGG - Intergenic
907360717 1:53912299-53912321 AGAGAATCTAATTGGAAAGCCGG - Intergenic
908141511 1:61189704-61189726 AGATCTACTGACTTGAAAGCTGG - Intronic
909874176 1:80781430-80781452 AAAGAAACAAAGTGGAAAGCTGG + Intergenic
911120988 1:94296255-94296277 AGAGCTACTAAGTGACTAGCAGG - Intergenic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
912702848 1:111891070-111891092 ATGGCTAGTAAGTGGAGAGCTGG - Intronic
919545569 1:198913861-198913883 AGAGCAATTACGTGGAATGCTGG + Intergenic
919579925 1:199358761-199358783 AGAGTTACTGAGGGGATAGCTGG - Intergenic
920698339 1:208198851-208198873 AATGCTACTAATTGGAGAGCTGG - Intronic
921162796 1:212485015-212485037 AGGCCTACAAAGTGGAAAACTGG - Intergenic
922037189 1:221860467-221860489 AGTGCTAATAATTGTAAAGCAGG - Intergenic
922062669 1:222107071-222107093 AGAGCTACTGAGAGAAAATCAGG + Intergenic
922290159 1:224203209-224203231 AGTTATACTAAGTAGAAAGCGGG - Intergenic
1063414375 10:5861534-5861556 ATTGCTACAAAGTGCAAAGCAGG + Intergenic
1065141737 10:22725015-22725037 AGATCTAAGAAATGGAAAGCAGG - Intergenic
1066283908 10:33945530-33945552 AGAGCTGTGAAGTGGAAATCAGG + Intergenic
1067285908 10:44907646-44907668 ACAGCTGCTAACTGCAAAGCCGG + Intergenic
1067323425 10:45244105-45244127 AAGGCTACAAAGTGGAAAGGCGG - Intergenic
1068899699 10:62253999-62254021 AGAGCTACTAATTGGAAACTGGG + Intronic
1069109903 10:64434462-64434484 AGAGCTACTCACTGGAAATGAGG + Intergenic
1069596324 10:69673553-69673575 AGAGCTCATGAGTGGAAAGCAGG - Intergenic
1069827830 10:71265240-71265262 AGAGGTACTAAAGGGAAAGGTGG + Intronic
1070089239 10:73268641-73268663 AGAGCTAGTTAGGGGAGAGCTGG + Intronic
1072546684 10:96445492-96445514 TGGTCTACTAAGTGGGAAGCAGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1075685187 10:124359714-124359736 ACAAGTTCTAAGTGGAAAGCAGG + Intergenic
1075944962 10:126424795-126424817 AGAGCTGGTAAGAGAAAAGCTGG - Intergenic
1076056955 10:127383710-127383732 AAAGGCACTAAGTGGGAAGCTGG - Intronic
1076198254 10:128536381-128536403 ACAGCTACTAAGTGACAAGTGGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080220737 11:29900607-29900629 AGAGCTATCAAGTCCAAAGCAGG - Intergenic
1085878609 11:80438943-80438965 AGTGATACTAAATGGAAGGCTGG + Intergenic
1086738255 11:90334161-90334183 AGGGCTACTAAAGGGATAGCTGG - Intergenic
1087061130 11:93978674-93978696 AGGGATACTAAGTGGTAAGGAGG - Intergenic
1087700776 11:101434126-101434148 AAAATTACTAAGTGGAAAGAGGG - Intergenic
1088290069 11:108226431-108226453 AGAGCTACTCAGTGGAATCAAGG + Intronic
1089654090 11:119934519-119934541 AGAGTTACTAAATGGGAGGCTGG - Intergenic
1090043836 11:123313923-123313945 AGAGCTACAAGCTGGAAAGGGGG - Intergenic
1090581855 11:128169150-128169172 AGAGATACTGAGTGGAAAGCTGG + Intergenic
1090726401 11:129530882-129530904 TGAGCTACCAAGGGGAAAGGAGG + Intergenic
1092361833 12:7843254-7843276 ATAGCTGCTGAGTAGAAAGCCGG + Intronic
1093287369 12:17281261-17281283 AGAATTACTCAGTGTAAAGCGGG + Intergenic
1095155478 12:38848386-38848408 AGACCTACAAAATGCAAAGCAGG + Intronic
1099712031 12:86240247-86240269 AGAGTTACACAGTGAAAAGCAGG + Intronic
1099963232 12:89416988-89417010 AAAACTACTATGTGGAAAGAAGG - Intergenic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1102821471 12:115912679-115912701 AGAGTTACTGATTAGAAAGCTGG - Intergenic
1104304477 12:127596991-127597013 AGAGATACTAGGAAGAAAGCAGG + Intergenic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1109092090 13:58060803-58060825 AGAGCTACGAAGCAGAAAGCAGG - Intergenic
1114304574 14:21410526-21410548 AGAGGTACTAAGAGTAAAGAAGG + Intronic
1117982851 14:61358872-61358894 GGAGTTACTAAGTCAAAAGCAGG - Intronic
1119589493 14:75872450-75872472 AGAGGTACTGAGTAGTAAGCTGG - Intronic
1120760886 14:88284239-88284261 AGGGCTAGTTAGTGCAAAGCCGG - Intronic
1122349864 14:101082882-101082904 ACAGCTTCCAAGTGGCAAGCTGG + Intergenic
1123783928 15:23649968-23649990 ACAGCTACTAAGTGAATAACAGG - Intergenic
1123951551 15:25282788-25282810 AGAGAGACAAAGTTGAAAGCAGG + Intergenic
1125253370 15:37732510-37732532 ACAGCTACTAAGTGACAAACAGG + Intergenic
1126849156 15:52787124-52787146 AGAGCTAGAGAGTGGAAAACCGG + Intronic
1128620597 15:69146246-69146268 AGAGCCAAAAAGTTGAAAGCAGG - Intergenic
1129544292 15:76378354-76378376 AGAGATTTTAAGTGGAAAGAAGG - Intronic
1131497457 15:92925266-92925288 AGAGCTACCATGTGAAAAGGAGG - Intronic
1131530245 15:93184803-93184825 ACAGCTAGTGAGTGGAAAGGTGG + Intergenic
1135274437 16:21099592-21099614 ATAGCTACTAAGTGGCAAGGTGG - Intronic
1137065890 16:35842873-35842895 ATGGCTGCTAAGTGGAAAACTGG - Intergenic
1140610585 16:76593773-76593795 AGAGCTTCTCAGGGTAAAGCAGG - Intronic
1140731528 16:77860935-77860957 AGTGGTAATAAGTGGAAACCAGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141149372 16:81553361-81553383 AAAGCAACAAAGTTGAAAGCAGG + Intronic
1141925773 16:87168169-87168191 AGAGCTCCTAGGTGGGCAGCTGG + Intronic
1142231266 16:88901310-88901332 GGAGCTACCCAGTGGGAAGCAGG + Intronic
1143882048 17:10037073-10037095 AGAACCACTGTGTGGAAAGCTGG + Intronic
1145783065 17:27576582-27576604 ATAGCTACTAAGTGACAAACAGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1153124699 18:1776824-1776846 AGTGTTACTAATTTGAAAGCAGG + Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1157028510 18:43876355-43876377 AAAGGTACTAAATGGAAAACAGG + Intergenic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1157384576 18:47250399-47250421 AATGCCACTAAGTGGAAAGAAGG + Intergenic
1160008465 18:75086046-75086068 AGTCCTACTAAGTGGAAGGACGG + Intergenic
1160258655 18:77269402-77269424 ATATCTATTAAGTGGAAAGAAGG + Exonic
1161606461 19:5217677-5217699 AGAGATACGAAGTGGAGACCGGG + Intronic
1163325661 19:16601571-16601593 AGAGCTTCTAAGTGTGTAGCAGG + Intronic
1164691700 19:30215641-30215663 AGAGCTTCTGAGTGGGCAGCAGG + Intergenic
1165303748 19:34990312-34990334 AGAGGTACTAGGGGGGAAGCTGG + Intergenic
1168446556 19:56421847-56421869 AGTGCTATGAAGTGCAAAGCAGG + Intronic
925109674 2:1323155-1323177 AGAGGTAGGAAGTGGAAAGGAGG + Intronic
926876001 2:17479566-17479588 AGAGCCAGTAAGTGGGAAGAAGG + Intergenic
926971783 2:18473944-18473966 ATAGCTAATAAGAGGAAAGACGG - Intergenic
927060957 2:19418903-19418925 TCAGCTACAAACTGGAAAGCAGG + Intergenic
928886800 2:36158574-36158596 ATGGCTACTAAGTGCAACGCAGG - Intergenic
930713021 2:54567034-54567056 ACAGCTGCTCACTGGAAAGCAGG - Intronic
932112094 2:69011124-69011146 AGAGCTTGAATGTGGAAAGCGGG - Intergenic
932431054 2:71673703-71673725 ATAGCTAGGAAGTGGCAAGCTGG - Intronic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
934729626 2:96648420-96648442 AGAGCTTCACAGTGGAAAGAAGG + Intergenic
936498107 2:113040522-113040544 AGAACTAATAAGTGCAAGGCTGG + Intronic
938974826 2:136466272-136466294 AGAGGTAGGAAGTGGAATGCTGG + Intergenic
940583185 2:155607701-155607723 AGATCTGCTAACTGGTAAGCTGG + Intergenic
941877504 2:170449195-170449217 AGAGCTAATAAAGGGAAAGCTGG - Intronic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
945106566 2:206321547-206321569 AGTGATGCTAAGTGGAAAGAAGG - Intergenic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
947134309 2:226961795-226961817 TGAGTTAATATGTGGAAAGCAGG - Intronic
948306221 2:236948848-236948870 AGAGCTATTAAGTAGAATGGTGG + Intergenic
948332814 2:237183435-237183457 AGCACTAGTAAGTGGAGAGCCGG - Intergenic
1173095722 20:40026088-40026110 ACAGCTACTTTGTGGACAGCAGG + Intergenic
1174999025 20:55606012-55606034 ACAGCTCCTAAGTGGGAAGTTGG - Intergenic
1175231468 20:57476200-57476222 AGAGTTGCTGAGTGGCAAGCTGG - Intergenic
1176156321 20:63623257-63623279 AGAGCGCCTAAGGGGAAAGGGGG + Intronic
1177070523 21:16500373-16500395 AGAGGCAGTAAGTGGAAAGACGG - Intergenic
1178136574 21:29634665-29634687 AGAGCTACGGAGTTGAAAGCAGG + Intronic
1178905163 21:36630707-36630729 AGAGCTACTAAGGGCGGAGCAGG - Intergenic
1178914364 21:36698632-36698654 AGAGCTGAAAAGGGGAAAGCCGG - Intergenic
1178950865 21:36984445-36984467 AGAGCTACTAAGTGACAAATGGG + Intronic
1183219639 22:36504392-36504414 AGAGAGACTCAGAGGAAAGCTGG + Intronic
949284051 3:2380578-2380600 AGATCTACTCAGTGTAAAGTGGG - Intronic
949802476 3:7918729-7918751 AGAGCTACTGAGTTGGAAGGAGG + Intergenic
951118047 3:18888555-18888577 AGTGCCACTTAGTGGAAAGGGGG - Intergenic
955326667 3:58013954-58013976 ATAGCTACTTAGTGGCAAGTGGG - Intronic
959137612 3:102443924-102443946 ACAGGTGCAAAGTGGAAAGCAGG - Intronic
959519984 3:107314689-107314711 AAAGGCACAAAGTGGAAAGCTGG - Intergenic
960189021 3:114680846-114680868 AGTGCTGCTAAGTTGTAAGCTGG - Intronic
960841128 3:121960293-121960315 AGCAGTACTAAGTGGAAAGTTGG + Intergenic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
962830680 3:139136561-139136583 AGAGCTACTGATAGGAAAGGAGG - Intronic
963219855 3:142797150-142797172 AGAGAAACTAAGTGGAAAAAAGG + Intronic
965635219 3:170773803-170773825 TGCTATACTAAGTGGAAAGCTGG + Intronic
966222497 3:177564935-177564957 TGAGCTACTGAATGGACAGCTGG - Intergenic
967355048 3:188559877-188559899 AAAGCTGCTATGTGAAAAGCTGG - Intronic
969706827 4:8797191-8797213 TAAGCTACAACGTGGAAAGCAGG + Intergenic
970733996 4:19143920-19143942 AGAGATACAAAGTAGAGAGCAGG - Intergenic
970925567 4:21447799-21447821 AGAGCTACTAAGTGATTAACAGG + Intronic
973634379 4:52848463-52848485 AAATCACCTAAGTGGAAAGCAGG - Intergenic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
980171433 4:129294638-129294660 ATAGCTATTTAGTGGAAAGGAGG + Intergenic
981453874 4:144931531-144931553 AAAGGCACTAAGTGGCAAGCTGG - Intergenic
983264176 4:165490276-165490298 AAAGCTACTGAGTGGAAGGGAGG - Intronic
983990719 4:174116340-174116362 AGAGATACTAACTTGAAAACTGG - Intergenic
987653906 5:20781127-20781149 AGAGCTACTAAGTGTAAAACTGG - Intergenic
988741669 5:34080364-34080386 AGAGCTACTAAGTGTGAAACTGG + Intronic
990373168 5:55141757-55141779 AGAACAACTAACTAGAAAGCAGG + Intronic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
992272828 5:75083421-75083443 ATAGCTAAAAAGGGGAAAGCAGG + Intronic
992363950 5:76072470-76072492 AGAGCTAACAAGTGTGAAGCTGG + Intergenic
993418745 5:87672495-87672517 ACATCTACTAAGTTGAAAGTTGG + Intergenic
996467027 5:123814886-123814908 TAAGCGACTAAGTGGCAAGCAGG + Intergenic
998274116 5:140735669-140735691 AGAGCTACCAAGTGGATATCAGG + Intergenic
1001057041 5:168458290-168458312 ACAGCTGCTAAGTACAAAGCTGG + Intronic
1001807501 5:174600283-174600305 GGAGCTCCCAGGTGGAAAGCAGG + Intergenic
1003454280 6:6266735-6266757 AGAGTTACAAAGTGGAAAGTGGG - Exonic
1003602343 6:7529271-7529293 TGAGCTGGTAAGTGCAAAGCTGG - Intergenic
1004317217 6:14600070-14600092 ATAGCTGCTAAGAGGAAAGATGG + Intergenic
1004370608 6:15049114-15049136 ACACCAACTAAGTGGAAAGTCGG + Intergenic
1007186660 6:39977680-39977702 AGTGGTAGGAAGTGGAAAGCTGG - Intergenic
1007370415 6:41423257-41423279 AGATATATTAAGTGGGAAGCTGG + Intergenic
1010372504 6:75127364-75127386 AAAGCTCCTAAGGGAAAAGCAGG - Intronic
1011392545 6:86869676-86869698 AAAGGCACAAAGTGGAAAGCTGG + Intergenic
1011620655 6:89239375-89239397 AGAGCAAATAAGTGGATAACTGG - Intergenic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1014903197 6:126993829-126993851 AGAGCTACAAAGTTGAAGGAAGG + Intergenic
1018470461 6:164091960-164091982 ATGGCTACTAAGTGGCTAGCAGG - Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1020622797 7:10538044-10538066 ACTGCTACAAAGTGGAAAGATGG - Intergenic
1021801831 7:24315040-24315062 AGAGCTCCTGAGGGTAAAGCTGG - Intergenic
1022692765 7:32673505-32673527 AAATCTAGTATGTGGAAAGCAGG - Intergenic
1022707641 7:32819582-32819604 AGAGCTGCTAAGTGGCAGCCAGG - Intergenic
1022915274 7:34943424-34943446 AGAGCTAGTAAGTGGCAGCCAGG + Intronic
1022920442 7:35008039-35008061 AAATCTAGTATGTGGAAAGCAGG - Intronic
1023873410 7:44274662-44274684 GGAGGTACTATGTGCAAAGCAGG + Intronic
1024848589 7:53681366-53681388 AGAGGCACAAAGTGGCAAGCTGG - Intergenic
1026227144 7:68452420-68452442 AGAGCTACTCATTGGACAGTAGG - Intergenic
1029805757 7:102994669-102994691 AGAGGACCTGAGTGGAAAGCTGG - Intronic
1030866449 7:114706237-114706259 AGAGCTTTGAAGTGAAAAGCTGG - Intergenic
1031132591 7:117849816-117849838 ATAGCTACTAATTAGAATGCAGG - Intronic
1031309587 7:120178878-120178900 AGAGCCTCTAAGTGGTAAGCAGG + Intergenic
1031697153 7:124872481-124872503 ACAGCTACTAAGTGACAAACAGG - Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1033467979 7:141614029-141614051 AGAGCTTCTAAGAAGAAAACAGG + Intronic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1036754327 8:11462279-11462301 AGAACTAGTAAGTGGCAGGCTGG - Intronic
1036780865 8:11646214-11646236 AAAGGTACTAAGTGAAGAGCTGG + Intergenic
1036797346 8:11765880-11765902 AGAGCTAGTAAGTGGAAATCAGG + Intergenic
1037275193 8:17171011-17171033 ATAGCCATTATGTGGAAAGCAGG + Intronic
1037784110 8:21892414-21892436 AGAGCTTCTATGTGGGCAGCAGG - Intergenic
1037794772 8:21983681-21983703 AGAGCTACTAACTGGCTATCCGG - Intronic
1038688182 8:29737690-29737712 AGAGCTATTAAGAGGAAAGAAGG - Intergenic
1038868024 8:31460865-31460887 AGAGCTTGTAAGTGGCAAGAGGG - Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041958408 8:63583051-63583073 AGAGCTACTAAGAGGTAAGCTGG - Intergenic
1042106087 8:65327589-65327611 ACAGCTACTAACTGGAAGACTGG + Intergenic
1043727314 8:83627428-83627450 AAAGACACAAAGTGGAAAGCTGG - Intergenic
1043798141 8:84571753-84571775 AGGGCTACTAAGAGAAAAGTTGG - Intronic
1045209427 8:100080975-100080997 AGAGGTACTTATTGGCAAGCTGG - Intronic
1046024925 8:108711229-108711251 AGAGTTATTAAGTGGCCAGCTGG + Intronic
1046093653 8:109533041-109533063 AGAGCTACTAATGGTAAAGCTGG + Intergenic
1046340312 8:112845724-112845746 AGATTTGCTAATTGGAAAGCTGG + Intronic
1047154791 8:122304612-122304634 AGAGCTAGTAAGTGCCAAGTTGG - Intergenic
1049005276 8:139851491-139851513 ATAGGTACCAGGTGGAAAGCAGG - Intronic
1051369467 9:16345934-16345956 AGAGCTACTCAGTACACAGCTGG - Intergenic
1051592369 9:18789393-18789415 AGAGCTGCTAAGTGGCAAAGCGG + Intronic
1051735496 9:20194116-20194138 AGTTCTACTTAGTGGAAAGATGG - Intergenic
1052404437 9:28041505-28041527 AGAGCTACTTAGAGGAAAATTGG + Intronic
1053857597 9:42354718-42354740 ATAGCTTCTAAGTGTACAGCTGG - Intergenic
1057898501 9:98929208-98929230 AGAGCTGCTTAGTGAAAACCTGG - Intergenic
1058232565 9:102447358-102447380 AGAGGTACCATCTGGAAAGCAGG - Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059024915 9:110616026-110616048 ACAGAAACTAATTGGAAAGCTGG - Intergenic
1059728906 9:117036753-117036775 AGAGGGACCAAGTGGAAAGCAGG - Intronic
1059843824 9:118248665-118248687 GCAACTACCAAGTGGAAAGCAGG - Intergenic
1059936648 9:119318599-119318621 AGAGCCCCCAAGTGGCAAGCAGG + Intronic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1061640287 9:131948834-131948856 AGAGCTACTAAGGAGAAGACAGG - Intronic
1185859870 X:3567518-3567540 AGGGCTCCTAAGTGGACATCTGG + Intergenic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1191935692 X:66424812-66424834 AAGGCTACTAAGTACAAAGCAGG - Intergenic
1193592737 X:83409693-83409715 AGATCTGCTCAGTGCAAAGCTGG - Intergenic
1194635409 X:96340703-96340725 AAATATACAAAGTGGAAAGCTGG - Intergenic
1196116981 X:112008658-112008680 ACAGCTACAAAGTGGAAAATTGG - Intronic
1199483036 X:148318984-148319006 ATAGCTACTAAGTGGCTAACAGG - Intergenic
1199511977 X:148632591-148632613 TGAGATACTTAGGGGAAAGCTGG + Intronic
1200957855 Y:8969945-8969967 ACACCAACTGAGTGGAAAGCTGG + Intergenic
1202176682 Y:22104858-22104880 AGAGCAACTATATGGAAAACAGG + Intergenic
1202214679 Y:22481526-22481548 AGAGCAACTATATGGAAAACAGG - Intergenic