ID: 932515119

View in Genome Browser
Species Human (GRCh38)
Location 2:72338788-72338810
Sequence TACCCAAGGCTGCTACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932515119 Original CRISPR TACCCAAGGCTGCTACAGAC AGG Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
905107200 1:35571317-35571339 AACCCAAGGAAGCCACAGACAGG + Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
908768572 1:67575407-67575429 TACCTAAGACTGGTACAGAGTGG - Intergenic
912781841 1:112557390-112557412 TACCCATGCATGCTACAAACTGG - Intronic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
917604388 1:176611680-176611702 TCCCCAAGAATGCTACAGATAGG - Intronic
918475435 1:184919275-184919297 AATCCAAGGCTGCTTCAGGCAGG - Intronic
921608267 1:217180043-217180065 TATCAAAGGCTGCTTCAGGCAGG - Intergenic
922233517 1:223706114-223706136 TACCCTAAGCTCCAACAGACTGG + Intronic
922287676 1:224183727-224183749 TACTCAAGGCTGGCACAGCCGGG - Intronic
923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG + Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG + Intergenic
1071940988 10:90591745-90591767 TACCTAAGTATGCAACAGACAGG - Intergenic
1073286982 10:102395398-102395420 ATCCCAAGGTTGCTCCAGACCGG + Intronic
1078182469 11:9023910-9023932 CACATGAGGCTGCTACAGACGGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG + Intronic
1094261626 12:28507358-28507380 CACCAAATGCTGCTACAGATGGG - Intronic
1102941957 12:116950854-116950876 TACCCACGGATGCTACAGTTTGG + Intronic
1103567501 12:121823826-121823848 CACCGCGGGCTGCTACAGACTGG - Intronic
1108096124 13:46903280-46903302 TAACCATGGCTGAGACAGACTGG + Intergenic
1110867879 13:80418292-80418314 TAGTAAAGGCTGCTGCAGACTGG - Intergenic
1115171210 14:30509485-30509507 CATCAAAGGCTGATACAGACGGG + Intergenic
1121446551 14:93982543-93982565 TTCCCAAGGGTGATTCAGACAGG - Intergenic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG + Intergenic
1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG + Intergenic
1140696048 16:77535407-77535429 TACATGAGGCTGCTACAAACAGG + Intergenic
1141171924 16:81696949-81696971 TACCCAAGGCAGCTAAAGCCTGG + Intronic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1142829973 17:2541546-2541568 TACCCCAGCCTGAGACAGACAGG - Intergenic
1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG + Intronic
1144670432 17:17129744-17129766 TACCCCAGGCCCCTGCAGACTGG - Intronic
1148188716 17:45663824-45663846 TCCCCATTGCTCCTACAGACAGG - Intergenic
1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1156133846 18:34011533-34011555 TTCTCAAGGCATCTACAGACTGG + Intronic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1165110074 19:33497267-33497289 TCACCAAGTCTGCTACAGGCAGG - Intronic
930564696 2:53004666-53004688 TAACCAAGGCAGAGACAGACAGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933258693 2:80108193-80108215 TACCCAAGGCTGCTCCCCTCTGG - Intronic
936045464 2:109184469-109184491 GACCCACGGCTGGGACAGACAGG - Intronic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
940221500 2:151356744-151356766 TACCCAAGGATTCTACACAAAGG + Intergenic
941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG + Intronic
948602257 2:239114034-239114056 GACCCAAGCCTGCCACACACGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1175748510 20:61478304-61478326 CACCCATTGCTGCTAGAGACGGG - Intronic
1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG + Intergenic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1180819536 22:18816568-18816590 TATCCAAGGCTTCTAAAGTCTGG + Intergenic
1181205762 22:21251013-21251035 TATCCAAGGCTTCTAAAGTCTGG + Intergenic
1203221159 22_KI270731v1_random:44400-44422 TATCCAAGGCTTCTAAAGTCTGG - Intergenic
1203269666 22_KI270734v1_random:42421-42443 TATCCAAGGCTTCTAAAGTCTGG + Intergenic
953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG + Exonic
955405068 3:58620762-58620784 TGCCCAGGGCTGCTTCAAACAGG - Intronic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
966513378 3:180789334-180789356 TACCCAAAGCTACTTCATACTGG - Intronic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
971823950 4:31596972-31596994 TAACCTAGGCTGGTATAGACAGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978425100 4:108573731-108573753 TACCAGAAGCTGCTATAGACTGG - Intergenic
979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG + Intergenic
984176949 4:176430706-176430728 TCTCCATGGCTGTTACAGACAGG + Intergenic
986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG + Intergenic
998126801 5:139629448-139629470 TAATCAAGGTTGCTACAGACTGG - Intergenic
999458945 5:151741118-151741140 GACCCAGGGCTGCTGGAGACTGG - Intergenic
1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG + Intronic
1007719308 6:43875936-43875958 TGCCCAAGGCTGCTACCTTCAGG + Intergenic
1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG + Intergenic
1012867501 6:104635402-104635424 TACACATGGATGATACAGACAGG - Intergenic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1020736141 7:11950863-11950885 TACATGAGGCTGCTACACACTGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG + Intronic
1023713561 7:43020267-43020289 TAGCCAAGGAAGCTACAGTCAGG - Intergenic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG + Intronic
1038994242 8:32903710-32903732 TAACAATGCCTGCTACAGACTGG - Intergenic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1048278844 8:133089766-133089788 TACCCAAGGGAGTTATAGACAGG - Intronic
1051314618 9:15815244-15815266 AACCCAAAGCAGCTACAGAAAGG - Intronic
1056303276 9:85263940-85263962 TTCACAAGGCTGTTTCAGACAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1196244205 X:113379909-113379931 TACCAAAGGTTTCTACAGAAAGG - Intergenic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG + Intergenic
1202245871 Y:22819440-22819462 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202398859 Y:24453188-24453210 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG + Intergenic