ID: 932517456

View in Genome Browser
Species Human (GRCh38)
Location 2:72367732-72367754
Sequence AGGGAGAGTGCAGCAACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 3, 1: 7, 2: 28, 3: 75, 4: 405}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932517449_932517456 2 Left 932517449 2:72367707-72367729 CCTGGAGAGTTTGTGCACTTGGG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517440_932517456 29 Left 932517440 2:72367680-72367702 CCCCATCCCCTGGCAGTGGTTGA 0: 1
1: 1
2: 7
3: 46
4: 281
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517439_932517456 30 Left 932517439 2:72367679-72367701 CCCCCATCCCCTGGCAGTGGTTG 0: 2
1: 6
2: 14
3: 75
4: 389
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517442_932517456 27 Left 932517442 2:72367682-72367704 CCATCCCCTGGCAGTGGTTGAAC 0: 1
1: 0
2: 2
3: 18
4: 149
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517446_932517456 21 Left 932517446 2:72367688-72367710 CCTGGCAGTGGTTGAACGGCCTG 0: 1
1: 0
2: 1
3: 10
4: 84
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517441_932517456 28 Left 932517441 2:72367681-72367703 CCCATCCCCTGGCAGTGGTTGAA 0: 1
1: 0
2: 4
3: 27
4: 184
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517444_932517456 23 Left 932517444 2:72367686-72367708 CCCCTGGCAGTGGTTGAACGGCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405
932517445_932517456 22 Left 932517445 2:72367687-72367709 CCCTGGCAGTGGTTGAACGGCCT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG 0: 3
1: 7
2: 28
3: 75
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932517456 Original CRISPR AGGGAGAGTGCAGCAACTGG GGG Intronic
900002192 1:20878-20900 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900021914 1:191402-191424 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900767735 1:4516445-4516467 AAGGCGAGTGCAGGCACTGGAGG - Intergenic
901203528 1:7480705-7480727 AGGGATAGTCCAGCATCGGGGGG - Intronic
901779196 1:11581804-11581826 AGGCAGAGAGTAGCAACTCGGGG - Intergenic
902650799 1:17836222-17836244 AGGGATAGGGCTGGAACTGGGGG + Intergenic
904567435 1:31436027-31436049 GAGGGGAGTGCAGCAGCTGGGGG + Intergenic
904902562 1:33869028-33869050 AGGGAGGCCGGAGCAACTGGAGG + Intronic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907249884 1:53130935-53130957 AGGGAGAGTTCAGGAACGAGGGG + Intronic
907500485 1:54875973-54875995 GGGGAGAGTCCAGCCAATGGAGG + Exonic
908002746 1:59696688-59696710 AGGAAAAGTGCAGCAAGTGCAGG + Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
910422638 1:87083361-87083383 AGATAGAGTGCAGAAAGTGGGGG - Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913694126 1:121307826-121307848 AGAGAGAGTGAAGGAACTGAAGG + Intronic
914143437 1:144972240-144972262 AGAGAGAGTGAAGGAACTGAAGG - Intronic
914717981 1:150267463-150267485 AAGGAGAGACCAGAAACTGGGGG + Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916988810 1:170220025-170220047 AAGGAGACTGCAACAACTAGGGG + Intergenic
917154578 1:171983108-171983130 AGGGAGAGGGCAGCTACAGAGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917330873 1:173879162-173879184 AAGTAGAGAGAAGCAACTGGGGG - Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917447425 1:175118498-175118520 TGCCAGAGTGCAGAAACTGGTGG - Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918070707 1:181131715-181131737 AGGGTGAGCTCAGCACCTGGCGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919729007 1:200901129-200901151 AGGGGGAGAGCAGCAGCCGGAGG - Exonic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920481453 1:206326213-206326235 AGAGAGAGTGAAGGAACTGAAGG + Intronic
922350318 1:224729856-224729878 AGGGACAGTGTAGCCTCTGGGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067200926 10:44171601-44171623 AGGGAGAGGGCAGCCACCAGGGG + Intergenic
1067937004 10:50622025-50622047 AGGCAGAAGGCAGCACCTGGAGG + Intronic
1068613964 10:59091285-59091307 AGGAAGATTTCACCAACTGGGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069112296 10:64462812-64462834 AGGGAGAGTGCAGCAGAAAGAGG + Intergenic
1069403701 10:68075856-68075878 AGGGAGAGTGTAGAAAGTGATGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1072158409 10:92744393-92744415 AGAGAGACTGCAGTAAATGGTGG - Intergenic
1072634637 10:97169958-97169980 AGGGAGAGTCCAGCAACATGAGG - Intronic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075568823 10:123523897-123523919 AGGAAGAGCTCAGCAAATGGTGG + Intergenic
1078418212 11:11183217-11183239 AAGCAGAGTTCAGGAACTGGAGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1083724599 11:64621660-64621682 AGGGTGAGGGCAGGATCTGGGGG - Intronic
1084163693 11:67365161-67365183 AGGGTGACTGCAGCTGCTGGAGG + Exonic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085415631 11:76317496-76317518 AGGTAGAGACCAGCAGCTGGAGG - Intergenic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1085462267 11:76701260-76701282 AGGGAGAGTGCTGCTCCAGGAGG + Intergenic
1085535147 11:77213042-77213064 AGGGATAAGGCAGCAAGTGGGGG + Intronic
1086014218 11:82145852-82145874 AGGGGGTGCGCAGCAAATGGAGG + Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087789566 11:102392106-102392128 AGGGTGAGTGAAGGAACTGTGGG - Intergenic
1087962952 11:104374671-104374693 AGGGAGAGGGTTGAAACTGGAGG + Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1091375607 12:22938-22960 CGGGAGTGTGCAGAGACTGGAGG - Intergenic
1091659406 12:2372314-2372336 AGGAAGAGAGCAGCAAGGGGTGG - Intronic
1092229946 12:6770677-6770699 AGAGAGAGAGGAGCAATTGGGGG - Exonic
1093045585 12:14440458-14440480 TAGGACAGTGAAGCAACTGGTGG - Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095750526 12:45705570-45705592 AGAGATAGTGCAGAAGCTGGAGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101026241 12:100609431-100609453 ACAGGGAGCGCAGCAACTGGAGG - Intronic
1101840597 12:108324975-108324997 AGGTTGAGTGCAGCAACTTTGGG - Intronic
1103940622 12:124499508-124499530 ATGGAGAGTGCTCCAGCTGGAGG + Intronic
1104030152 12:125059086-125059108 AGGGAGAGTACAGAATGTGGGGG - Intergenic
1104948514 12:132428200-132428222 AGGGCGAGAGCAGCAGCTGCTGG + Intergenic
1106217825 13:27719104-27719126 AGGGAGGATGAAGAAACTGGTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901860 13:80834371-80834393 AAGCAGAGTGCAGCATCTTGAGG + Intergenic
1112304484 13:98261297-98261319 TGGGTGACTACAGCAACTGGGGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1113625080 13:111789130-111789152 AGGGAGAGGGCAGCATCTTCAGG - Intergenic
1114246502 14:20919442-20919464 AGCGACAGGGCAGCAACTGAGGG + Intergenic
1114550388 14:23529472-23529494 AGGGAGACAGCAGGAACTTGAGG - Intronic
1114558739 14:23576915-23576937 TGGGAGAGAGCAGAAATTGGGGG + Intronic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116490920 14:45502193-45502215 AGGGTGACTGCAGTAACTGCAGG + Intergenic
1117276739 14:54201756-54201778 ATGGAGCCTGCAGCACCTGGTGG + Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117474918 14:56084333-56084355 AAAGAGAGAGAAGCAACTGGAGG - Intergenic
1118548314 14:66919738-66919760 AAGTAGAGAGAAGCAACTGGGGG - Intronic
1119071201 14:71586398-71586420 GTGGAGAGTGCAGCAAGTGCAGG + Intronic
1119495191 14:75071736-75071758 TGGGTGAGTGCAGCCACTGTGGG + Exonic
1119544055 14:75459219-75459241 AGGCAGAGGGAAGGAACTGGAGG - Intronic
1119956536 14:78804199-78804221 AGGGACAGGGCAGGAAGTGGAGG + Intronic
1120117295 14:80634916-80634938 AGGCAGTGGGAAGCAACTGGTGG - Intronic
1120463088 14:84821826-84821848 AGGGAATGTGTAGCAACTGAAGG + Intergenic
1121048206 14:90803209-90803231 GGGGAGAGTGGAACCACTGGAGG - Intronic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121803556 14:96795559-96795581 AGGGAGGATGCAGTAACTTGTGG + Intergenic
1122070358 14:99201865-99201887 AGGAAGAGTGCAGCTCCTTGGGG - Intronic
1122378067 14:101280730-101280752 AGGGACAGTGAAACAAATGGAGG + Intergenic
1124152725 15:27196327-27196349 AGAGAGAGAGCAGGAACAGGAGG - Intronic
1124472134 15:29997265-29997287 ATGGAGAGTGCAGGAAGTGCAGG - Intergenic
1124631403 15:31339666-31339688 CGGGAGAGTGCAGCACTGGGTGG - Intronic
1125512240 15:40298321-40298343 AGCCAGAGAGCAGCACCTGGCGG + Exonic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128714935 15:69901099-69901121 AGAGAGAGTGCAGGAGTTGGAGG - Intergenic
1128945139 15:71814674-71814696 AGGCAGAGGGCAGCTACTGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131302986 15:91216122-91216144 GGGGCGAGTGCAGCAATTGTTGG + Intronic
1132404842 15:101535990-101536012 AGAGATAGGGCAGTAACTGGGGG + Intergenic
1132451318 15:101970061-101970083 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
1133407749 16:5539156-5539178 AGGGAAAGTGCAGGAAGTGCTGG + Intergenic
1135334911 16:21593138-21593160 AGGGAGAGAGTAGCAGCTGAGGG - Intergenic
1135404575 16:22189234-22189256 TGGGAGAATCCAGCAGCTGGTGG + Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140083938 16:71777345-71777367 AAAGAGAGAGGAGCAACTGGGGG + Intronic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1141485008 16:84333167-84333189 AGGAAGACTGCAGCCACTGGGGG + Intergenic
1141606328 16:85155841-85155863 ATGCAGAGTACAGCAAGTGGAGG + Intergenic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1143233684 17:5379542-5379564 AGGCAGACTGCAGCAGGTGGAGG - Intronic
1143861852 17:9897065-9897087 AGTCAGAGAGGAGCAACTGGGGG - Exonic
1144081582 17:11768466-11768488 GGGCAGAGTTCAGCAAATGGTGG + Exonic
1144217905 17:13072703-13072725 AGGGAGAACGCAGCACCAGGTGG - Intergenic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1147210058 17:38867854-38867876 AGGGAGAGAACAGCAACCAGAGG + Intergenic
1148546020 17:48519660-48519682 AGAGATAGTGGAGTAACTGGAGG + Intergenic
1148777210 17:50102395-50102417 AGGGAGAGTGCCCCAGCTGCTGG - Intronic
1150325827 17:64256539-64256561 AGGAAGAAACCAGCAACTGGGGG - Intronic
1150445665 17:65225418-65225440 CGGGAGGGTGCAGCCCCTGGGGG + Exonic
1150576403 17:66434475-66434497 AGGGAGAGGTCAGAAACAGGAGG + Intronic
1150727873 17:67666331-67666353 AGGCAGAGTGCAGGACTTGGTGG + Intronic
1152005139 17:77675899-77675921 AGGGGGAGGTCAGCAAATGGAGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155296335 18:24387878-24387900 AGGGAAACTGCAGCTTCTGGTGG - Intronic
1155868599 18:30997396-30997418 AGGGAGAGAGGAGCAACAGGGGG + Intronic
1157454709 18:47815649-47815671 AGGGCAACTGCAGCAAATGGAGG + Exonic
1157488955 18:48108943-48108965 GGGGAGAGTGGAGCACTTGGGGG + Intronic
1157494091 18:48142871-48142893 AGGGAGAGAGGAGCAAAAGGAGG - Intronic
1158437359 18:57442821-57442843 AAGGAGAGTGAAGCAGCTGCTGG - Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1160383389 18:78477994-78478016 AGGGAGAGGGACGCAGCTGGGGG - Intergenic
1160633945 19:62486-62508 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1162341467 19:10093767-10093789 ATGGTGTGAGCAGCAACTGGAGG - Exonic
1162739575 19:12766304-12766326 AGGGAGAGTGGAGCTAGGGGCGG + Intronic
1162792315 19:13069485-13069507 AGTGAGAGAGCAGACACTGGAGG + Intronic
1163468227 19:17481973-17481995 AGGGAGAGAGCAGCCACCCGTGG - Intronic
1163833318 19:19558316-19558338 AGGGAGAGGGCAGGACCTGCCGG - Intergenic
1164394598 19:27851745-27851767 AGGGAGTGAGGAGCAGCTGGTGG - Intergenic
1164723528 19:30450295-30450317 GGGGAGGCTGCAGCAACAGGGGG + Intronic
1165096602 19:33413153-33413175 AGGGTCAGTGCAGAAAGTGGTGG - Intronic
1165735662 19:38173929-38173951 AGGGAGTGTGGAGGAGCTGGGGG + Intronic
1166408459 19:42540421-42540443 AGGGTGAGTGCGGCCACTGGAGG - Intronic
1167525757 19:49982958-49982980 AGAGAGAGTTGAGAAACTGGAGG - Intronic
925042771 2:746434-746456 AGGGAGCGTGCAGCTGCTGCTGG - Intergenic
925747365 2:7055008-7055030 AGGAAGAGTAAAGCAACTGCAGG - Intronic
927937064 2:27082096-27082118 AGAGAAGGTGCAGCAGCTGGAGG + Exonic
927990453 2:27443340-27443362 AGGGCAAGTGCAGCAAATAGGGG - Intronic
928118215 2:28563335-28563357 AAGGAGAGAGCAGGAAGTGGAGG + Intronic
928305580 2:30167756-30167778 AGGAAGATGGTAGCAACTGGTGG - Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
929924722 2:46198648-46198670 AGGCAGTGTGCAGCTACTCGGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930539856 2:52691433-52691455 AGGGAGTGTGCTGCCAATGGTGG + Intergenic
931248458 2:60510200-60510222 AGGGAGATGGAAGCCACTGGAGG - Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931908512 2:66869019-66869041 AGGGTGAGTGGACCTACTGGAGG - Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933080149 2:77976208-77976230 AGGGAGTGGGGAGCAAATGGAGG - Intergenic
933725730 2:85426094-85426116 TGGGAGAGCGCAGCACGTGGAGG - Intronic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935737702 2:106119516-106119538 TGCGAGAGAGCAGGAACTGGGGG - Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
936567533 2:113592542-113592564 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936758225 2:115740167-115740189 GGGGAGAGAGAAGCAATTGGGGG + Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937628242 2:124068286-124068308 AGACAGAGCGCAGCAACTGGTGG + Intronic
938243168 2:129758689-129758711 AGGGAGAGTGCCGCTCTTGGTGG + Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941819295 2:169828162-169828184 GGGGAGGGTGCAGCCACAGGGGG + Intronic
942814413 2:180034675-180034697 AGGGAAAGTGCGGCAGCTGGGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944427437 2:199598167-199598189 AGGGCTAGTGCAGTAACTAGGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944688790 2:202140864-202140886 AGGGAGGGGGCAGCCAGTGGGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944934910 2:204558064-204558086 AACGAGAGTTCAGCAACAGGAGG - Intronic
946182924 2:217959821-217959843 AGGGAGAGAGGGGCAAGTGGGGG + Intronic
946194912 2:218027164-218027186 AGGGTGACTGGAGCAGCTGGTGG - Intergenic
946251514 2:218416774-218416796 AGGGAGCATGCAGCATGTGGAGG - Intergenic
947229660 2:227871882-227871904 AGGAAGAGTCCAGCATCTGAAGG - Intronic
947412800 2:229859245-229859267 AGGAAGAGTGGGGCCACTGGCGG - Exonic
947439854 2:230109767-230109789 AGGGAGGGTGGGGCAACTGGGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169190112 20:3653375-3653397 AGGGAGGCTGCATCACCTGGAGG + Intergenic
1169782889 20:9328125-9328147 AGGGAGAGTACATCAAATGAGGG + Intronic
1170000027 20:11605423-11605445 AAGTAGAGAGAAGCAACTGGGGG - Intergenic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171989096 20:31681919-31681941 AGAGACAGTGCAGCAAAGGGAGG + Intronic
1172384665 20:34525462-34525484 AGGCAGACTCCATCAACTGGGGG + Intronic
1174219411 20:48941270-48941292 AGGGAGTAGGTAGCAACTGGGGG + Intronic
1175350650 20:58315635-58315657 AGGAAGTGTGCAGTAAATGGTGG + Intronic
1175801670 20:61804546-61804568 AAGGAGAGGGCAGGACCTGGAGG - Intronic
1175834482 20:61984897-61984919 AGGGAGGGTGCAGCAGGAGGAGG + Intronic
1176086200 20:63296659-63296681 AGGCAGAGTGGAGCAACAGAAGG + Intronic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179520737 21:41942776-41942798 AGGGAGAGGCCAGCCCCTGGGGG - Intronic
1179787881 21:43740132-43740154 AGGCACAGTGCGGCATCTGGGGG - Intronic
1180032292 21:45220765-45220787 AGGGAGGGAGCAGCCACGGGCGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180926743 22:19560224-19560246 GGGGAGGGGGCAGCAACTGGAGG + Intergenic
1182186163 22:28404589-28404611 AGAGAGAGGGAAGAAACTGGAGG - Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1185140948 22:49100936-49100958 AAGGTGTGTGCTGCAACTGGGGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951157177 3:19369820-19369842 AGGGAGAGTGCAAAAATAGGTGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952329206 3:32348498-32348520 AGAGAGAGTGAAGAAAATGGAGG - Intronic
952520824 3:34155604-34155626 GGGGAGACTACAACAACTGGGGG - Intergenic
952698057 3:36293544-36293566 GAGGAGAGAGCAGCAACTGAGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953072125 3:39531227-39531249 CGGGAGAGGGCAGCAACAGCAGG - Intergenic
953339129 3:42119028-42119050 AAGGAGAGAGCAGCAGCCGGTGG - Intronic
953813582 3:46134654-46134676 AGCGACAGGGCAGCAGCTGGAGG - Intergenic
953912373 3:46899511-46899533 AGGGAGAGGGCAGCCCCTGGGGG + Intronic
953918229 3:46934332-46934354 TGGCAGAGTGCAGCAGCTGCTGG - Intronic
954283646 3:49602352-49602374 AGGGAAAGGGCACCAGCTGGGGG + Intronic
954669948 3:52285116-52285138 AGGGAGAGAGCTGGAAGTGGGGG + Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956170743 3:66431588-66431610 AGGGACTGGTCAGCAACTGGGGG + Intronic
956733411 3:72217446-72217468 AGTGAGATGGCAGCCACTGGAGG - Intergenic
958134867 3:89475888-89475910 ATGGAGACAGCAGCAACTGGGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959335979 3:105066000-105066022 GGGGAGGGTGCAGGAACTGGAGG + Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959957218 3:112252461-112252483 GGAGAGTGTGAAGCAACTGGAGG + Intronic
960438514 3:117657391-117657413 AGGCAGAGAGGATCAACTGGGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965353153 3:167640772-167640794 AGGGAGAGAGAAGGAAATGGTGG + Intronic
966899453 3:184469742-184469764 AAGGAAAGTACAGCAGCTGGAGG + Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968493245 4:901626-901648 AGGTAGATTTCAGCAGCTGGAGG + Intronic
969661779 4:8534282-8534304 AGGGAGAGTGGAGCATGTGCTGG + Intergenic
970896729 4:21112199-21112221 AGGAAAAATGCAGCAACTTGAGG + Intronic
971028137 4:22608381-22608403 AGGGAGAGTGGAGCCCCTGGCGG - Intergenic
972708592 4:41570901-41570923 AAGGAGAGTGCAGAAATAGGAGG + Intronic
972733998 4:41822410-41822432 AGGCGGGGTGCAGCAACTTGTGG - Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973852661 4:54976759-54976781 AGGGAAAATGCAGCAACTTGGGG + Intergenic
974754689 4:66187675-66187697 TGAGAGATTGCAGCACCTGGTGG - Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975888240 4:78991807-78991829 AGTGAGAGAGCAGCAGCAGGAGG + Intergenic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
979437632 4:120712509-120712531 TGGGAGAGTGCTGCAGGTGGTGG - Intronic
979929767 4:126616664-126616686 AGGGTGAGTGAAGGAACTTGGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981762388 4:148208667-148208689 AGGCAGAGTGCAGAAACTGCTGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983730887 4:170992009-170992031 GGGGTGAGTGAAGGAACTGGGGG - Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984634236 4:182093533-182093555 AGGCAGAGTGCAGAGACAGGTGG + Intergenic
984676751 4:182557737-182557759 GGTGACAGTGCAGCAGCTGGAGG - Intronic
985490264 5:174925-174947 ATGGACAGTGCGGCTACTGGAGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986941960 5:12964363-12964385 AGGGAGAGAGCAGGAACTTAAGG + Intergenic
987064557 5:14276283-14276305 ACTGAGAGTGCGGGAACTGGCGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988510950 5:31864305-31864327 AGGCAGAGTGCAGCACCCTGGGG - Intronic
989133939 5:38134860-38134882 AGGCAGAGGGCAGCCACGGGAGG - Intergenic
990267445 5:54092701-54092723 AGGGAGAGAGCAGCCTCTCGAGG - Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991072247 5:62496984-62497006 AGAAGCAGTGCAGCAACTGGAGG - Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991370269 5:65911447-65911469 AGGGAGGGTGGGGCAGCTGGGGG + Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991923735 5:71683603-71683625 AGGGACAGAGCAGCATGTGGAGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993636513 5:90351263-90351285 AGAGAGACTCCAGCAAATGGAGG - Intergenic
994056906 5:95427199-95427221 AGGGAGATGGCAGGAAGTGGTGG + Intronic
995185441 5:109266741-109266763 AGAGAGATTACAGCATCTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995552942 5:113298441-113298463 AGGGAGTGAGGAGAAACTGGGGG + Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996675752 5:126172524-126172546 AGGGGGTGTGCTGCAACTGGGGG - Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000325745 5:160170735-160170757 AGGGAAGGGGCAACAACTGGGGG + Intergenic
1001092448 5:168751250-168751272 AGGCATAGGGCAGCAACAGGAGG + Intronic
1001159752 5:169302139-169302161 AAGGAAAGGGCAGGAACTGGAGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002881244 6:1254416-1254438 AGGGAGAAGGCAGCATCTGCAGG + Intergenic
1006336848 6:33425453-33425475 AGGGAGAATGGAGGAACTGAAGG + Intronic
1006808801 6:36806530-36806552 AGGGATAGAGCATCACCTGGGGG - Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1007351552 6:41277318-41277340 TGGTCGAGTTCAGCAACTGGTGG + Intronic
1007626280 6:43247948-43247970 AGGGAGAGTACAGAAATCGGGGG + Intronic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1013344992 6:109251409-109251431 AGAGAGAGTACAGAAAGTGGGGG - Intergenic
1014026368 6:116651064-116651086 AGGTAGAGTGCAAAAACTTGAGG + Intronic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018989700 6:168664568-168664590 AGGGAGGTTGCAGGAACAGGAGG + Intronic
1019013353 6:168861001-168861023 CTGGAGAGTGCAGAAGCTGGTGG - Intergenic
1019144679 6:169969116-169969138 AGGGAGAGTGGAGTCTCTGGAGG + Intergenic
1019162322 6:170076832-170076854 AGGGAGATAGCAGCAGCTGCAGG - Intergenic
1019922986 7:4174615-4174637 CGGTAGAGTGCAGTCACTGGAGG - Intronic
1020009594 7:4800755-4800777 ATGGAGAGGGCACCAGCTGGTGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022090192 7:27103025-27103047 AGGCAGAGGGCAGCCACCGGCGG - Intergenic
1023735621 7:43233774-43233796 AGGAAGAGAGGAGCAAGTGGAGG - Intronic
1023883474 7:44334856-44334878 AGGGAGCGTCCAGCAACCGAGGG - Intergenic
1024055635 7:45658452-45658474 AGGGAGATTACAGGACCTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026850825 7:73722066-73722088 AGGGAGAGGGCAGGAAAGGGAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028432121 7:90759630-90759652 AGGTAGGGTGCAGAACCTGGGGG - Intronic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029176153 7:98665980-98666002 AGGGAAAATGAAGGAACTGGGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991689 7:128202849-128202871 AGGGACAGTGCAGGATCTGGTGG + Intergenic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033812403 7:145031147-145031169 AGGGAGACTGCAGCAAAAAGGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034105932 7:148489871-148489893 CTGGAGAGTGCAGGAACAGGAGG - Intergenic
1034291053 7:149932082-149932104 AGGAAGTGTCCAGCAACTGATGG + Intergenic
1034491506 7:151395545-151395567 AGGGAGAAGGCAGCATCTGCAGG + Intronic
1034815047 7:154164856-154164878 AGGAAGTGTCCAGCAACTGATGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035075287 7:156173758-156173780 AGGGAGAGAGAGGAAACTGGAGG - Intergenic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035756581 8:2037272-2037294 AAAGAGAGAGCAGCAGCTGGAGG + Intergenic
1040596090 8:48839167-48839189 AGGGAGATGGCAGCCAATGGAGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041770622 8:61468943-61468965 AGGCAGAGGGCAGCACCTCGTGG - Intronic
1042703703 8:71644345-71644367 AGAGGGAGTGTAGCACCTGGTGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1043732041 8:83694656-83694678 AGGGAGAGGGCAGCAGATGAAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044774831 8:95677437-95677459 AGGGTGAGTGCAGCAGCAAGGGG + Intergenic
1047420566 8:124704702-124704724 AGGGACAGTATAGCAACAGGTGG + Intronic
1049225491 8:141448736-141448758 GGGGGGAGGGCAGGAACTGGCGG + Intergenic
1049856457 8:144865016-144865038 GGGGAGAGGGAAGCATCTGGTGG + Intergenic
1049885000 9:20991-21013 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051858850 9:21601126-21601148 TGGGAGAGTGGAGGAAGTGGAGG + Intergenic
1052027553 9:23590399-23590421 AGAGAGAGAGCAGGAAGTGGAGG + Intergenic
1053684841 9:40511517-40511539 AGGGAAAGTGAAGAAAGTGGGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054278886 9:63113439-63113461 AGGGAAAGTGAAGAAAGTGGGGG + Intergenic
1054297933 9:63346980-63347002 AGGGAAAGTGAAGAAAGTGGGGG - Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054395950 9:64651498-64651520 AGGGAAAGTGAAGAAAGTGGGGG - Intergenic
1054430594 9:65156693-65156715 AGGGAAAGTGAAGAAAGTGGGGG - Intergenic
1054499786 9:65864828-65864850 AGGGAAAGTGAAGAAAGTGGGGG + Intergenic
1054746177 9:68856180-68856202 AGGGAAAGTGCCAGAACTGGAGG - Intronic
1056243387 9:84670307-84670329 AGGGAGAGTGCCCCAATTAGTGG + Intronic
1056470901 9:86903660-86903682 AGGGAGTGAGCAGCAGCAGGTGG - Intergenic
1056522287 9:87412132-87412154 AGAGAGAGTGGAGAAACTGAGGG - Intergenic
1056710539 9:88989467-88989489 AGGAAGAGGGCAGCAGATGGGGG + Intergenic
1056935940 9:90914762-90914784 AGAGAGAGTGCAGCAGCAGTGGG - Intergenic
1057313905 9:93957191-93957213 AGGGAGTCCGAAGCAACTGGCGG - Intergenic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059697650 9:116744087-116744109 AGGGAGAGGGCAGAAAAAGGAGG + Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061271674 9:129547239-129547261 AGGGAGAGTGCAGCCCATGGGGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062054370 9:134463365-134463387 AGGGACACTGCAGCAGCTGCAGG - Intergenic
1062160762 9:135078418-135078440 AGGGGGAGTGGAGCACATGGCGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185463366 X:342433-342455 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463374 X:342460-342482 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463465 X:342784-342806 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463473 X:342811-342833 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463481 X:342838-342860 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463489 X:342865-342887 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463497 X:342892-342914 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463793 X:343919-343941 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463801 X:343946-343968 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463809 X:343973-343995 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463856 X:344135-344157 AGGGAGACCTCAGCAACGGGAGG + Intronic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189277530 X:39797587-39797609 AGGGTGAGTGCAGAATCTTGAGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190245275 X:48686783-48686805 AGGGAGAGCGGACCCACTGGAGG - Exonic
1190364731 X:49680997-49681019 AGGGATAGGGGAGCAAGTGGAGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190598522 X:52068209-52068231 AGGGAGGGTGAAGCAGCTGCAGG + Exonic
1190610302 X:52185864-52185886 AGGGAGGGTGAAGCAGCTGCAGG - Exonic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193138717 X:78002696-78002718 AGGTAGAGAGCAGCGAGTGGAGG + Intronic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194414517 X:93593870-93593892 AGGGAGAGAGCACCAAGTGATGG + Intergenic
1194518576 X:94890358-94890380 AGGGAGGGTGTATCAACTAGGGG + Intergenic
1194586960 X:95746937-95746959 ATGGAGACTGGAGCAGCTGGGGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195585996 X:106566253-106566275 AGGGAAAATGGAGCAAATGGAGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196151635 X:112380968-112380990 ACGGGGAGTGGAGCCACTGGAGG + Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199428828 X:147735594-147735616 AGGGAGACTGGAGCAATGGGAGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic