ID: 932526577

View in Genome Browser
Species Human (GRCh38)
Location 2:72475921-72475943
Sequence CTGGTCACTGGCACCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932526571_932526577 -5 Left 932526571 2:72475903-72475925 CCCTGGTGTGGGTGGCCCCTGGT 0: 1
1: 0
2: 1
3: 37
4: 274
Right 932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932526569_932526577 -4 Left 932526569 2:72475902-72475924 CCCCTGGTGTGGGTGGCCCCTGG 0: 1
1: 0
2: 1
3: 33
4: 300
Right 932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932526572_932526577 -6 Left 932526572 2:72475904-72475926 CCTGGTGTGGGTGGCCCCTGGTC 0: 1
1: 0
2: 3
3: 20
4: 259
Right 932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932526577 Original CRISPR CTGGTCACTGGCACCTAAGC TGG Intronic
901082860 1:6593312-6593334 CAGGTAACTGGCACCTCTGCGGG - Exonic
903860432 1:26361255-26361277 TTGGCCACTTGCACCTCAGCCGG - Intergenic
906255723 1:44348438-44348460 CTGGCCGCTGGCACCTCAGGAGG - Intronic
907289485 1:53403555-53403577 GTGGTCAGTGGCACCTCTGCTGG - Intergenic
909030973 1:70539434-70539456 CTGCTCTTTGGCCCCTAAGCTGG - Intergenic
909562361 1:77020861-77020883 CTGGTGGCTTGCACCTCAGCAGG + Intronic
911924988 1:103817921-103817943 CATGTCACTGGGACCTAAGATGG - Intergenic
915092209 1:153434498-153434520 CTGGTGGCTGGCACCTCTGCTGG - Intergenic
915166653 1:153951731-153951753 CTGGTCACTGCCACCCATTCTGG - Intronic
915240326 1:154516618-154516640 ATAGACCCTGGCACCTAAGCTGG + Intronic
915674907 1:157520649-157520671 CAGGTCCCCGGCAGCTAAGCAGG + Intronic
915741316 1:158120429-158120451 CTGGTCACTGGAAGCACAGCTGG - Intergenic
916019593 1:160780219-160780241 GTGGTCACTGGGACCTAGGAGGG - Intergenic
917678976 1:177347077-177347099 CTGGTCACTGGCTGGAAAGCTGG - Intergenic
920542096 1:206786515-206786537 CTGGTCACTGTGACCATAGCTGG + Intergenic
921387551 1:214586251-214586273 CTGGTGACTTGCACTTGAGCTGG + Intergenic
921724579 1:218509230-218509252 CTGGTGACTGGCACCAGAGTGGG + Intergenic
923002824 1:230021767-230021789 ATGGTCTCTGCCACCCAAGCTGG - Intergenic
1063932236 10:11040631-11040653 ATGGTAACGGGCACATAAGCAGG - Intronic
1063966936 10:11353477-11353499 CTGGTCACTGGCACAGAAAAGGG - Intergenic
1067575555 10:47406330-47406352 CAGGTCAGTGGCACCTGGGCAGG - Intergenic
1072122611 10:92417648-92417670 CCCGTCACTGGCACCTCAGTGGG - Intergenic
1077317192 11:1924867-1924889 CTGGTCACTGTCAGCTGGGCTGG - Intronic
1079016265 11:16871371-16871393 GTGGGCTCTGGCACCTGAGCTGG - Intronic
1084144334 11:67256111-67256133 CTGGTGACTGGCTTCTAAGCAGG - Exonic
1084765792 11:71307464-71307486 CTGCTGACTGGGACCTTAGCTGG + Intergenic
1089670616 11:120054496-120054518 CTGTCCACTGGCACTGAAGCAGG + Intergenic
1091766148 12:3120997-3121019 CTGGCCACTGGCTCCTTTGCAGG + Intronic
1091767977 12:3134320-3134342 AAGGTCACTGGCACTTTAGCAGG + Intronic
1092784150 12:12012673-12012695 CTGGACACTGCCAGCAAAGCTGG + Intergenic
1093198801 12:16162156-16162178 GTGGTCACCTGCACCTTAGCTGG + Intergenic
1096525277 12:52206742-52206764 CTGGCCTCTGGCTCCTAAGGAGG - Intergenic
1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG + Intronic
1102146541 12:110658909-110658931 CTGGGGACTGGCCCCTGAGCTGG - Intronic
1104016377 12:124965021-124965043 GAGGTCACTGGCACCCAGGCCGG + Intronic
1112648380 13:101362034-101362056 CTGGTTTCTGGCACCTCAGGTGG + Intronic
1114422512 14:22596717-22596739 ATTCTCACTGTCACCTAAGCTGG - Intergenic
1120930593 14:89844552-89844574 ATTGTCACAGGCATCTAAGCTGG - Intronic
1121164373 14:91777767-91777789 CTGTTCACTGTAACCTTAGCTGG + Intronic
1121912376 14:97803135-97803157 CTGTTCCCTGGCACCTGGGCTGG - Intergenic
1122209349 14:100165108-100165130 GTGGTCACTGGCATCTGAGAAGG - Intergenic
1124344102 15:28909941-28909963 CTGGTCACTTGTACCAGAGCCGG + Intronic
1124579985 15:30945099-30945121 CTGGCCACTAGCACCTAAGGTGG + Intronic
1129135174 15:73542583-73542605 CTGGTCCATGACACATAAGCAGG - Intronic
1133220994 16:4319083-4319105 GGGGTCTCTGGCACCTAAGGAGG + Intronic
1134833760 16:17344728-17344750 CAGGTCTCTGTCACCCAAGCTGG + Intronic
1135978619 16:27128834-27128856 CAGGTCCCTGTCACCAAAGCTGG + Intergenic
1136428792 16:30185469-30185491 CTGGTGACCGTCACCTAATCAGG - Intronic
1138584447 16:57960915-57960937 CTGATCACTGGCCCCTCTGCAGG - Exonic
1139503115 16:67384554-67384576 TGGGTCACTGGCACCTGATCAGG - Intronic
1140998094 16:80280552-80280574 CTGGTCTCTGGCACCTGCTCGGG + Intergenic
1145046218 17:19618919-19618941 CTGGTCAGTGGCACATTGGCAGG - Intergenic
1147198940 17:38786535-38786557 CAGCTCACTGCCACCTGAGCTGG + Intronic
1147704494 17:42416685-42416707 CTGGTCACTGGGTCCAAAGCAGG - Intronic
1148779010 17:50111311-50111333 CTGGTCACTGGCACATCATAAGG + Exonic
1149452838 17:56763469-56763491 CTGGACACTTGCACCTTAACAGG + Intergenic
1153446469 18:5178424-5178446 CTGGTCATTGGCAGCTCTGCAGG - Intronic
1154306291 18:13233196-13233218 CGGGTCACTGGCCGCTAAGAAGG + Intronic
1155482276 18:26302398-26302420 ATGGTCTCTGTCACCTAGGCTGG + Intronic
1156272989 18:35554475-35554497 CTTGTGACTGGCCCCTAAGGTGG - Intergenic
1157003984 18:43559917-43559939 CTCGCCACTGGCAGCCAAGCAGG - Intergenic
1161212701 19:3075857-3075879 CTTGTCACTGCTACCTAGGCTGG - Intergenic
1161801259 19:6417828-6417850 CTGGGCACTGGCACCTGGGGAGG + Exonic
1161912449 19:7204691-7204713 CTGAGCCCTGGCACCTATGCGGG + Intronic
1161957206 19:7502920-7502942 CTGGTCAGAGGCCCCTAAGATGG + Intronic
1162679747 19:12331866-12331888 CTGGGCACAGGCACCTTATCTGG - Intronic
1163404188 19:17112392-17112414 CTGGCCACTGGCTTCTCAGCAGG - Intronic
1166737661 19:45095731-45095753 CGGGTCTCTGTCACCCAAGCTGG - Intronic
1167807760 19:51800405-51800427 GTGGGCACTGGCACCTCTGCAGG - Intronic
925003695 2:426158-426180 CTGGTCACTTGGTGCTAAGCCGG - Intergenic
929439676 2:41955273-41955295 CCGGGCAGTGGCCCCTAAGCAGG + Intergenic
930880222 2:56261933-56261955 CTGGACACTGGATCCTAAGAAGG - Intronic
932463785 2:71899958-71899980 CTGGGCACTGGGACCTAGGCAGG + Intergenic
932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG + Intronic
933883258 2:86692879-86692901 CTTCTCACTGTCACCCAAGCTGG - Intronic
934070065 2:88375592-88375614 CTGCTCACTGTCACCTAGGCTGG + Intergenic
936998402 2:118439162-118439184 GTGGTCTCTGTCACCTAGGCTGG + Intergenic
938916367 2:135945155-135945177 CTTGTCTCTGTCACCTAGGCTGG + Intronic
942300343 2:174555371-174555393 GGGGTCTCTGGCACCCAAGCTGG + Intergenic
942913712 2:181277364-181277386 TTGGTCAGTGGCACTCAAGCTGG - Intergenic
944569792 2:201032684-201032706 CAGGTCTCTGTCACCTCAGCTGG + Intronic
947309803 2:228788877-228788899 CTGGTCTCTGACTCCTGAGCAGG + Intergenic
947560085 2:231141457-231141479 CTTGTCACTGTCACCCAGGCTGG + Intronic
947764084 2:232624617-232624639 CTGGGCACTGGCAGCCAAGCCGG + Intronic
948302571 2:236919047-236919069 CTTGTCTCAGTCACCTAAGCTGG - Intergenic
1172204849 20:33155974-33155996 CTGATCAATAGCACCAAAGCAGG + Intergenic
1172606337 20:36216766-36216788 CTGGGCACCAGCATCTAAGCTGG - Intronic
1173744958 20:45429188-45429210 CCGGTCACTTTCACCTCAGCGGG - Intergenic
1173865458 20:46309613-46309635 CTGGTCATTGGCAGCTTGGCGGG - Intergenic
1175337746 20:58207069-58207091 CTGGTGACTGCCACCTAGCCTGG - Intergenic
1175912073 20:62409775-62409797 CTGGGCACTGACACCTCTGCTGG - Intergenic
1180151009 21:45947858-45947880 CTGGGCACTGTGCCCTAAGCGGG - Intergenic
1180172995 21:46070165-46070187 CTTCTCACTGGCACCTCTGCAGG + Intergenic
1180248533 21:46564264-46564286 GTGGTCCCTGGCACCCAGGCAGG + Intronic
1181692408 22:24571387-24571409 CTGGGGACTGGCATCAAAGCAGG - Intronic
1182132178 22:27862905-27862927 CAGGCCCCTGGCACTTAAGCTGG + Intronic
1182239758 22:28906295-28906317 CAGATCACTGTCACCTAGGCTGG - Intronic
951320432 3:21238113-21238135 CTGGTTACTAGCACCTTAGCAGG - Intergenic
955315866 3:57938525-57938547 ATGGTCTCTGTCACCTAGGCTGG + Intergenic
955367711 3:58325916-58325938 TGGGTCACTGCCACCTCAGCTGG + Intergenic
960882280 3:122357014-122357036 CTGGACACTGGCACATTAGCAGG + Intergenic
961445456 3:126978944-126978966 CTGGTCACTGGGTTCAAAGCTGG - Intergenic
961801021 3:129449486-129449508 TTGGTGCCTGGCACCTAAGAGGG + Intronic
967135348 3:186508499-186508521 TTGGTCCCTGGCACCTAAAGGGG + Intergenic
969511319 4:7619617-7619639 CGGGACACTGGCACCCAAGGAGG - Intronic
979828120 4:125265787-125265809 CTCGCCACTGGCACCTCAGGAGG - Intergenic
981701668 4:147614167-147614189 CACGTGACTGGCACCTAGGCTGG + Intergenic
985000531 4:185478235-185478257 CAGGGCACTGGAACCTAAGTGGG - Intergenic
985967535 5:3349000-3349022 CTGGTCACAGGCATCTCACCAGG + Intergenic
988693839 5:33599046-33599068 CATGTGAGTGGCACCTAAGCCGG - Intronic
989000217 5:36752082-36752104 CTGGGCACAGGCACTTCAGCAGG + Intergenic
989215710 5:38902373-38902395 ATGGTCTCTGGCACCTAAAATGG + Intronic
993503134 5:88684219-88684241 CTGTTCTCTGGAACCTAAACTGG - Intergenic
993864632 5:93177777-93177799 CTGCTCACTGGGAACTAGGCTGG - Intergenic
994307572 5:98225309-98225331 CTGCTCACTGACAGCTTAGCAGG + Intergenic
997513275 5:134467144-134467166 CGGGACACTGGCACCCCAGCAGG + Intergenic
998228815 5:140346384-140346406 CTGGGCGCTGGCACCAGAGCTGG + Exonic
999128811 5:149266945-149266967 CTGGTGACTGGCCCCTCAGACGG + Intergenic
1001492880 5:172168172-172168194 CAGGCCACTGGAACCAAAGCAGG + Intronic
1001594153 5:172886990-172887012 CAGGTGACTGGGAGCTAAGCAGG + Intronic
1002080875 5:176736677-176736699 CTGATCCCAGGCACCTAAGGAGG + Intergenic
1002490228 5:179570505-179570527 CTGGTCACCAGCTCCTATGCAGG - Intronic
1017184988 6:151591958-151591980 GTTGTCACTGGCAACTTAGCCGG - Intronic
1018442183 6:163823537-163823559 CTGGACAGAGGCAGCTAAGCAGG + Intergenic
1019364584 7:626738-626760 AGGGTCTCTGTCACCTAAGCTGG + Intronic
1021044668 7:15907741-15907763 CTGGGCACTGGCACCTGGGATGG + Intergenic
1023908502 7:44538333-44538355 CTGGTCTCAGGCACCTGGGCCGG - Intronic
1034688763 7:152997269-152997291 CAGGACCCTGGCACTTAAGCGGG + Intergenic
1037436173 8:18865895-18865917 CTCGTGACTGGCACCCATGCTGG + Intronic
1039256620 8:35725989-35726011 CTAGTCACTAGCACCCAACCTGG + Intronic
1043263884 8:78237793-78237815 CAGGTCTCTGTCACCCAAGCTGG - Intergenic
1043391061 8:79792238-79792260 CAGGTCTCTGTCACCCAAGCTGG + Intergenic
1051328323 9:15997474-15997496 CTGGACTCTGGCAGCCAAGCAGG - Intronic
1053527537 9:38845165-38845187 CTGGCCACTGGCACCGCTGCTGG + Intergenic
1054199762 9:62069594-62069616 CTGGCCACTGGCACCGCTGCTGG + Intergenic
1054638593 9:67518763-67518785 CTGGCCACTGGCACCGCTGCTGG - Intergenic
1056751744 9:89356960-89356982 CTGGTCCCTGGCCCAGAAGCAGG + Intronic
1060182117 9:121541541-121541563 CTGCTCACTGGCAGCTGAGAGGG - Intergenic
1062456756 9:136643629-136643651 CTGGTCAATGGGACCAGAGCAGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186423818 X:9447919-9447941 CTGTTCCAGGGCACCTAAGCAGG - Intergenic
1190870031 X:54416961-54416983 GTGGACACTGGAACCAAAGCAGG - Intergenic
1190980973 X:55456453-55456475 CTGGTCACTGGCAGCCTTGCAGG + Intergenic
1190987724 X:55516727-55516749 CTGGTCACTGGCAGCCTTGCAGG - Intergenic
1192337022 X:70230133-70230155 CTGGTCCCTGGAACCTACCCAGG + Intergenic
1199715960 X:150507590-150507612 CTGGCCACCGGCACCCAGGCTGG + Intronic