ID: 932529413

View in Genome Browser
Species Human (GRCh38)
Location 2:72512020-72512042
Sequence CCTAAAGAACAGTAGTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932529413_932529416 -1 Left 932529413 2:72512020-72512042 CCCTTGCACTACTGTTCTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 147
Right 932529416 2:72512042-72512064 GACTAAAATGATCATTTAATTGG 0: 1
1: 0
2: 0
3: 24
4: 273
932529413_932529417 17 Left 932529413 2:72512020-72512042 CCCTTGCACTACTGTTCTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 147
Right 932529417 2:72512060-72512082 ATTGGTCTTCTTTGCATAAATGG 0: 1
1: 0
2: 1
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932529413 Original CRISPR CCTAAAGAACAGTAGTGCAA GGG (reversed) Intronic
900958077 1:5900520-5900542 TCAAAAGAACAGTAGTGCCAGGG + Intronic
901248579 1:7754271-7754293 CCTAAAGAAGAGTGGTGTTAAGG - Intronic
902578893 1:17396070-17396092 CCTTTAGATCAGAAGTGCAATGG - Intronic
903583477 1:24390159-24390181 CCAAAAGAACAGTATTCTAAAGG + Intronic
905490179 1:38337360-38337382 CCAAAAGCACAGAAGTCCAAGGG - Intergenic
908485140 1:64584317-64584339 CCAAAATGACAGTAGTGCCAAGG + Intronic
910457850 1:87417037-87417059 CCTAACGACCAGTTGTTCAAGGG - Intergenic
910468931 1:87529932-87529954 TCTTAAGAACAATAGTGCACGGG + Intergenic
912002477 1:104852277-104852299 ACTAAAGAACAGAAGTGTTAAGG + Intergenic
913150016 1:116032392-116032414 CCTAAAGGACAGTTGTGCTGTGG + Intronic
920884383 1:209912295-209912317 CCAAAAGAGCAGTGGTGCCAGGG + Intergenic
923129823 1:231065539-231065561 CCTGAAGAATAGGCGTGCAAAGG + Intergenic
923581811 1:235224410-235224432 CCTAAAGAACAGTAGCAAAATGG - Intronic
924200801 1:241656675-241656697 CCAAAACATCAGTAGTGCCAAGG - Intronic
1063658366 10:8014125-8014147 CCTACAGAACATTACTGGAAAGG - Intronic
1072808411 10:98440757-98440779 CCTAAAAATGAGTAGTGTAAAGG - Intronic
1073084766 10:100881067-100881089 CATAAAGGGCAGTGGTGCAAGGG - Intergenic
1073471306 10:103724127-103724149 GCTAAAGAACAGTGGTCCAAAGG - Intronic
1078924954 11:15866236-15866258 CCTGAAGAACAGGAGTACAGGGG - Intergenic
1080784735 11:35464420-35464442 CTCAAAGATCAGTAGTGCCAAGG - Intronic
1081206506 11:40281666-40281688 TCTAAAGAACTGTAGTACTAAGG - Intronic
1081538457 11:44012957-44012979 CCTAAATATCAATAGTGCCAAGG + Intergenic
1083860095 11:65415762-65415784 CTGAAAAAACAGTGGTGCAAGGG + Intergenic
1086838868 11:91659826-91659848 CCTAAATGTCAGTAGTGCTAAGG + Intergenic
1087879091 11:103393598-103393620 CCTACAGAACACTAATACAAAGG - Intronic
1088039628 11:105362855-105362877 GCTGGAGTACAGTAGTGCAATGG + Intergenic
1088538272 11:110885280-110885302 CCAAAAGAACAGAAGTACAAAGG + Intergenic
1090117723 11:123992553-123992575 CCTACAGAACTGCAGTGCAATGG - Intergenic
1090269402 11:125375385-125375407 ACTCAAGAACAGTAGAGAAAAGG + Intronic
1090669543 11:128936833-128936855 CCTCAAGGTCAGTGGTGCAAAGG + Intronic
1092722698 12:11457650-11457672 CAGCAGGAACAGTAGTGCAAAGG + Intronic
1093555590 12:20469919-20469941 CATAAAGAACAGTTCTGCCATGG - Intronic
1099017461 12:77361072-77361094 CTTCAAGGACAGTAGTGAAATGG + Intergenic
1100328665 12:93565936-93565958 CATAAGAAACAGTAATGCAAGGG + Intergenic
1100743495 12:97620606-97620628 CCTAAAGAACCTTGGTCCAAGGG - Intergenic
1101818506 12:108164559-108164581 CCTAATGAACAGAGGTGCTAGGG + Intronic
1101945721 12:109134902-109134924 CCTAAATATCAGTAGTGCCATGG + Intronic
1103192216 12:119011295-119011317 CCTAAATGTCAGTAGTGCCAAGG - Intronic
1104262020 12:127193380-127193402 CCTAAATAGCAATAGTGCCAAGG - Intergenic
1107781454 13:43907585-43907607 CATAAAGATCAGTATTGAAAAGG + Intergenic
1108597637 13:51963208-51963230 CTTAAAGAACAGTAGTGATATGG - Intronic
1109030570 13:57183282-57183304 CCTTAAGAACTGTAGAGAAAAGG + Intergenic
1110763460 13:79255250-79255272 CTTAAATAACACTATTGCAATGG + Intergenic
1114444307 14:22776500-22776522 ACTAAAGAACATTAGGGGAAAGG + Intronic
1117236729 14:53785746-53785768 GCAAAAGAACAGATGTGCAAGGG + Intergenic
1118247376 14:64124440-64124462 CCTAGAGGCCAGGAGTGCAAGGG - Intronic
1118571007 14:67195421-67195443 CCTAAATGACAGCAGTGGAAAGG + Intronic
1119809239 14:77502291-77502313 CCTACAGAGCAGTAGTTCAAAGG - Intergenic
1120823203 14:88931949-88931971 CCTATAAAACAGTAGTGAAATGG - Intergenic
1121282639 14:92710353-92710375 CCTAAGGACCAGTAGTGGGAAGG + Intronic
1125449770 15:39796091-39796113 CCAAAATATCAGTAGTGCTAAGG - Intergenic
1126623068 15:50659387-50659409 GCTAAAGCACAGTACTGGAAAGG + Intronic
1127839326 15:62817224-62817246 CCAAAAGAACACTAGAGCCATGG - Intronic
1129289139 15:74549937-74549959 CCAAAATAACAGTAGTGCCAAGG + Intronic
1132957819 16:2605247-2605269 CTTAAGGAACAGTAAAGCAAAGG - Intergenic
1132970280 16:2684323-2684345 CTTAAGGAACAGTAAAGCAAAGG - Intronic
1139192022 16:64875515-64875537 TCAAAGGCACAGTAGTGCAAAGG + Intergenic
1141329646 16:83098298-83098320 CCAGAGGAGCAGTAGTGCAAAGG - Intronic
1144080551 17:11760248-11760270 CCTAAAGAACGGGGATGCAAAGG - Intronic
1144852590 17:18251558-18251580 CAGAAAGAACAGCTGTGCAAAGG - Intronic
1145780038 17:27556918-27556940 CCTAAACAACAGGAGGGCTAAGG - Intronic
1146121459 17:30199439-30199461 CCTAAAGATCAGTAAATCAAAGG - Intronic
1146720119 17:35118298-35118320 CCTAAATATCAATAGTGCCAAGG + Intronic
1149991767 17:61387489-61387511 CCCTGAGAACAGTAGTGCCAAGG + Intronic
1150954479 17:69842098-69842120 GAGAAAGAACAGTAGTTCAAGGG + Intergenic
1158232423 18:55272665-55272687 ACAAAAGATCAGTAGTGCTAAGG - Intronic
1160477594 18:79206815-79206837 CCAAGTGAACAGCAGTGCAAAGG - Intronic
1161979150 19:7621486-7621508 CCCCAAGAACAGGGGTGCAATGG + Intronic
1162855333 19:13463838-13463860 ACTAAAAAATAGTAGTGCAGAGG + Intronic
1165986268 19:39771520-39771542 TCTAAAGAACAGTGGTCCATGGG - Intergenic
926292428 2:11541506-11541528 CATAGAGAAGAGTAGTGCATGGG - Intronic
929113855 2:38428131-38428153 CCTTCAAAGCAGTAGTGCAATGG - Intergenic
930636709 2:53814143-53814165 CCTAACGAACAGTATTTTAATGG + Intronic
932529413 2:72512020-72512042 CCTAAAGAACAGTAGTGCAAGGG - Intronic
934545163 2:95207992-95208014 CCTACAGACCAGGAGGGCAATGG - Intronic
934959480 2:98657253-98657275 CATTAAGAACATTTGTGCAAAGG - Intronic
936382676 2:112000715-112000737 TCCAAAGAACAGTAGGGAAAGGG - Intronic
936875447 2:117184019-117184041 CCTAATGAACAGCAGAGGAAGGG - Intergenic
938798255 2:134736599-134736621 CTTAAACAACAGTAGTGAAAAGG - Intergenic
939770901 2:146316620-146316642 CCTAGAAAACAGTAGTGACATGG + Intergenic
940625196 2:156166623-156166645 CCAAAAAAACAGTAGTACAGAGG + Intergenic
941167737 2:162101578-162101600 CCTAAGAACCAGGAGTGCAATGG + Intergenic
942123924 2:172804601-172804623 CCTAAAGCACAGGAGAGCAGAGG - Intronic
1168729607 20:65285-65307 TGGAAGGAACAGTAGTGCAATGG - Intergenic
1169691377 20:8336050-8336072 CCTGGAGAAAAGTAGTCCAAGGG + Intronic
1170679144 20:18509429-18509451 CCTCAAGAAAAGTAGTAAAAAGG - Intronic
1175240311 20:57542754-57542776 CCCAAACATCAGTAGTGCCAGGG - Intergenic
1176691269 21:9913177-9913199 CCTAAATAACCATAGGGCAATGG + Intergenic
1179962686 21:44778844-44778866 CAGAAAGAACAGTCGTGCAGGGG + Intronic
1181626902 22:24128561-24128583 CCTATAGAACACTACTCCAAGGG + Intronic
1183951535 22:41355570-41355592 CCTCAAGTACTGTAGTGCCAAGG + Exonic
949124889 3:435176-435198 CCTAAAGACCATTACTGTAACGG - Intergenic
949162624 3:898987-899009 CCAAAATATCAATAGTGCAAAGG + Intergenic
949363782 3:3258903-3258925 CCTAAAGAACACTGGTCCACAGG - Intergenic
950430456 3:12947922-12947944 CCTATAGGACAGTGTTGCAATGG + Intronic
951526857 3:23661627-23661649 CCTCAACAACAGTCCTGCAAAGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952049234 3:29362850-29362872 ACTAAAGAACAGGAATACAATGG - Intronic
953964735 3:47295421-47295443 CCAAAGGAACACTAGAGCAAAGG - Intronic
955036473 3:55273038-55273060 CCTAAACATCAGTAATGCAAAGG - Intergenic
955948979 3:64223141-64223163 GCTAAAAAACAGTATTGAAAAGG - Intronic
956291803 3:67668488-67668510 CCAAAAGGACAATAGTGCAGAGG - Intergenic
956896296 3:73663940-73663962 TCCAAAGAACAGTAGTGCTAAGG - Intergenic
956966105 3:74462596-74462618 CCTAAAGAACAGTGGGGCTACGG - Intronic
957205593 3:77194315-77194337 CGTAAAGAACAGTAGGTCCAGGG - Intronic
961710915 3:128827591-128827613 CCTGAAGGACAGTGGTGAAAGGG - Intergenic
963536269 3:146532429-146532451 ACTTAAAAATAGTAGTGCAAAGG - Intronic
965173915 3:165305224-165305246 GTTAAAGAACAGTATTGCAATGG - Intergenic
973091628 4:46144851-46144873 CCTATAAAACAATAATGCAATGG - Intergenic
979456599 4:120932704-120932726 CACAGAGAACAGCAGTGCAAAGG - Intergenic
980345488 4:131611246-131611268 CCTAAACAACAGTAATGTAATGG + Intergenic
980363853 4:131773363-131773385 CCTAAATAACCATAGGGCAATGG + Intergenic
981325114 4:143437436-143437458 GTTAAAGAAAAGTAGTGGAAAGG + Intronic
981924889 4:150128231-150128253 CCAAAACATCAGTAGTGCCAAGG + Intronic
984352568 4:178614226-178614248 ACTAATGAAGAGTAGAGCAAAGG - Intergenic
989724579 5:44572914-44572936 ACCAAAGAACAATACTGCAACGG + Intergenic
990122234 5:52469546-52469568 CTTACAGAACAACAGTGCAATGG - Intergenic
991142651 5:63262722-63262744 CCTAAACAACAGTAATGTAGTGG - Intergenic
992920173 5:81507748-81507770 CTTATAGAACATTAATGCAATGG - Intronic
996973609 5:129403301-129403323 CCTAAAGTACAGAAGAGAAATGG + Intergenic
999429045 5:151510398-151510420 CCTAAAGAACAGTAATAAACAGG + Intronic
1000298520 5:159934184-159934206 CCTCTAGATCAGTAGTTCAAGGG - Intronic
1000843422 5:166250441-166250463 CCTAAAGACCAGGATTACAAAGG + Intergenic
1003380433 6:5620084-5620106 CCAAAATATCAGTAGTGCAGAGG - Intronic
1006286457 6:33098566-33098588 CCTATAAAACAGTAATGCAAAGG + Intergenic
1006452256 6:34112007-34112029 CCTAAATAAACGTAGTGGAAGGG + Intronic
1008995132 6:57650313-57650335 GTTCAAGAACAGTACTGCAATGG - Intergenic
1009514613 6:64598954-64598976 CGAAAAGAACAGCAGTGCAAAGG + Intronic
1011097297 6:83680673-83680695 CCAAAATATCAGTAGTGCCAAGG - Intronic
1013151977 6:107455342-107455364 CATAAAGCACAGAAGTGAAAAGG - Intronic
1013768846 6:113604571-113604593 GCTAAAGAAAACTGGTGCAATGG + Intergenic
1015355999 6:132277681-132277703 CTTAGAGAACGGTAGAGCAAGGG - Intergenic
1018855449 6:167671144-167671166 TCAAAAGAACAGGAGTGCATTGG - Intergenic
1020853653 7:13389811-13389833 CCTAGAGAACAATACAGCAAAGG - Intergenic
1021168558 7:17370356-17370378 CCCAAACATCAGTAGTGCCAAGG - Intergenic
1023652384 7:42386006-42386028 CCTAAATAACAGCATAGCAATGG + Intergenic
1026974191 7:74486596-74486618 CCTACAGAAGAGGAGAGCAAGGG + Intronic
1029188901 7:98758340-98758362 CAGAGAGAACAGCAGTGCAAAGG + Intergenic
1032340530 7:131068382-131068404 ACTAAAAATCAGAAGTGCAATGG + Intergenic
1035148049 7:156840423-156840445 CAGAGAGAACAGTAGTGCCAAGG + Intronic
1036989266 8:13573755-13573777 CTTAAAGATCATGAGTGCAAAGG - Intergenic
1041727925 8:61035469-61035491 CCTAAAGAGTAGATGTGCAATGG + Intergenic
1041904860 8:63021265-63021287 TCAAAAGTCCAGTAGTGCAAAGG - Intronic
1047684613 8:127292370-127292392 GCAAAAGAACATTATTGCAATGG + Intergenic
1048890914 8:138945659-138945681 AGAAAAAAACAGTAGTGCAAGGG + Intergenic
1050448817 9:5757811-5757833 TGGAAGGAACAGTAGTGCAAAGG + Intronic
1050751289 9:8940762-8940784 CCCAAGGAACAGTACTGAAAGGG - Intronic
1051448301 9:17165361-17165383 CCTAAAGAGAAGTAGAGAAAAGG + Intronic
1053649026 9:40144396-40144418 GCTGAAGAACAGGAGTGCACTGG + Intergenic
1053756717 9:41319465-41319487 GCTGAAGAACAGGAGTGCACTGG - Intergenic
1054330002 9:63742332-63742354 GCTGAAGAACAGGAGTGCACTGG + Intergenic
1054535557 9:66231777-66231799 GCTGAAGAACAGGAGTGCACTGG - Intergenic
1057717501 9:97506101-97506123 CCGAAAGAACAGCAGGGGAAAGG - Intronic
1059197371 9:112382662-112382684 CCAAAAGGTCAGTAGTGCAGAGG + Intronic
1059369448 9:113814770-113814792 ATTAAAGAACAGTACTGCAATGG + Intergenic
1186260865 X:7777904-7777926 CTCAAATATCAGTAGTGCAAAGG - Intergenic
1186540782 X:10397859-10397881 CCAAAAGGTCAGTAGTGCTAAGG - Intergenic
1187084211 X:16024927-16024949 CCTAAATGTCAGTAGTGCTAAGG - Intergenic
1187807903 X:23141164-23141186 CTTAAAGGACATTATTGCAAAGG + Intergenic
1187850269 X:23584780-23584802 CTTAAAGATAAGTTGTGCAATGG + Intergenic
1188517648 X:31004816-31004838 TATAAAGAACAGAAATGCAACGG + Intergenic
1190526976 X:51338270-51338292 CTTAAAGAACAGAAGTAGAAGGG - Intergenic
1193401769 X:81054240-81054262 GATATAAAACAGTAGTGCAATGG + Intergenic
1194607162 X:95994865-95994887 GCTAAATAACAGTAGTGCTGCGG - Intergenic
1197705926 X:129634484-129634506 CCTGAGGAACAGTATGGCAAGGG + Intergenic
1199763134 X:150920764-150920786 CCTAGAAAACAGAAGGGCAAAGG - Intergenic
1201214294 Y:11708682-11708704 TGTAATGAACAGGAGTGCAATGG + Intergenic