ID: 932534293

View in Genome Browser
Species Human (GRCh38)
Location 2:72576007-72576029
Sequence CTGGCCTACTAAGGCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932534293 Original CRISPR CTGGCCTACTAAGGCAAAAC TGG (reversed) Intronic
900581915 1:3413614-3413636 CTGTCCTAATAAAGCAAAAGCGG + Intronic
902539756 1:17145822-17145844 ATGGCCTAGTGAGGCGAAACAGG - Intergenic
914806480 1:150995749-150995771 CTGTAGCACTAAGGCAAAACAGG - Intergenic
920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG + Intronic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
1063350926 10:5354292-5354314 CTGGCCTACAGAGGCATAAGGGG + Intergenic
1070451191 10:76558775-76558797 CTGGCCCACTGAGTCAACACAGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078715430 11:13834733-13834755 CTGGCCTCAGAAGGCATAACAGG + Intergenic
1083129266 11:60608506-60608528 CTGATCTACTAAGGGAAAAATGG - Intergenic
1083500519 11:63103314-63103336 CTGACCTATTAAGGCTAAAGTGG + Intronic
1086433548 11:86759253-86759275 AGGGCCTACCAAGGCACAACAGG - Intergenic
1087262920 11:96030802-96030824 CTGGAGTACTAATACAAAACTGG + Intronic
1091781773 12:3218502-3218524 CTGGCCTTCTCAGGCAAGCCTGG + Intronic
1097815871 12:64072750-64072772 TTAGCCTGCTAAGGCAAACCAGG - Intronic
1104380414 12:128302622-128302644 ATGAGCTACTAAGGGAAAACAGG + Intronic
1109249600 13:60003013-60003035 CTTTTCTACTAAGGAAAAACTGG + Intronic
1110531318 13:76602129-76602151 TTGGCATACTATGTCAAAACAGG + Intergenic
1111044414 13:82796099-82796121 CTGACCTACTAAGCCATAATTGG + Intergenic
1112843210 13:103606023-103606045 CTGGGCTAGGAAGGCAAGACTGG - Intergenic
1117050929 14:51859107-51859129 CTGGAGGATTAAGGCAAAACTGG + Intronic
1117978317 14:61319739-61319761 CTGGAGCACTAAGGCCAAACAGG + Intronic
1120128263 14:80772830-80772852 CTGGACTACTGAGACAAAGCTGG - Intronic
1121156457 14:91689418-91689440 CTGCCCTGCTAAGTCAAAAAAGG - Intronic
1121189805 14:92016542-92016564 CTGGCCAAGTAAAGCAAAAGAGG - Intronic
1126829951 15:52591630-52591652 ATGTCCTGGTAAGGCAAAACAGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1135061410 16:19274246-19274268 CTGGACTACCAAGGGGAAACTGG - Intergenic
1135626233 16:23997216-23997238 CTGGACTACTAAGGGGAAATTGG + Intronic
1140865520 16:79057670-79057692 CTGGCCTACTATGGTATTACAGG + Intronic
1144214090 17:13039373-13039395 ATGGCCTCCTAAAGCAAAATAGG + Intergenic
1149305642 17:55344095-55344117 CTGGCCAACAAGGCCAAAACTGG + Intergenic
1149561269 17:57609495-57609517 CTGGCCTCTTCAGGCCAAACAGG + Intronic
1152128047 17:78459243-78459265 CTGTCCTGCTCTGGCAAAACGGG + Intronic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1158531343 18:58265140-58265162 CTGGCCCACTGAGACAAATCTGG - Intronic
1163852931 19:19676306-19676328 CTGGCCTACATAGTGAAAACTGG - Intronic
930217406 2:48710746-48710768 CTGACTTACTAAGGCAGCACAGG - Intronic
932534293 2:72576007-72576029 CTGGCCTACTAAGGCAAAACTGG - Intronic
932926572 2:75982158-75982180 ATGGCCTACTGGGGCAAAGCAGG - Intergenic
933598144 2:84303306-84303328 CTGACCAACTAAAGCAAAAGAGG + Intergenic
937252959 2:120535554-120535576 CTGGTCTACCCAGACAAAACCGG + Intergenic
937255554 2:120552934-120552956 TTGGCTTCCTCAGGCAAAACTGG + Intergenic
941231102 2:162913469-162913491 CAGGCCTACTAAGGGACAAAAGG + Intergenic
943499413 2:188668335-188668357 CTGCCCCACCAAAGCAAAACTGG + Intergenic
944104385 2:196063620-196063642 CTGGCCCACTGAGGAAAAAGAGG - Intronic
948321873 2:237076320-237076342 CTGGCCTTCTGAGGCATAATGGG - Intergenic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
1170056598 20:12211903-12211925 CTGGCCTCGCAAGGCAACACTGG + Intergenic
1183710431 22:39500236-39500258 CTGGCCTACAAAGGCACCATGGG + Intronic
955138095 3:56240017-56240039 CTGGCCTAATTAGGCAAACTCGG - Intronic
956893807 3:73639331-73639353 CTGGCCTGCTAAGGGAAGGCAGG - Intergenic
971259890 4:25046426-25046448 CTGGCCTACTTAGGGAATTCAGG - Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
978179700 4:105777671-105777693 CTTGCCTAGGTAGGCAAAACTGG - Intronic
979280852 4:118866128-118866150 ATGGGCTACAAAGACAAAACTGG - Intronic
981685070 4:147445158-147445180 CTGGCCTATGAATCCAAAACTGG + Intergenic
986964308 5:13251997-13252019 CTGGCATATTCAGGCACAACTGG + Intergenic
993252246 5:85543591-85543613 CTTGTAAACTAAGGCAAAACCGG - Intergenic
995221670 5:109655178-109655200 CTGGCCTAGTATGGCAAACTAGG + Intergenic
995940282 5:117573671-117573693 CTGGGCTAGCACGGCAAAACTGG - Intergenic
999820041 5:155217772-155217794 CTGGCTTCCTAAGGCAAATGTGG - Intergenic
1008617673 6:53241956-53241978 CTGGCTTGCTTAGGCAAAAGAGG + Intergenic
1014701814 6:124698539-124698561 CCTGCCTACTTATGCAAAACTGG - Intronic
1016352461 6:143183032-143183054 CAGGCCTTCTCAGGCAAAAATGG - Intronic
1016602975 6:145883819-145883841 CTGGCATACAAATGCAAAAATGG - Intronic
1016776613 6:147911466-147911488 CTGAGCTACAAAGCCAAAACTGG + Intergenic
1017554538 6:155548711-155548733 CTGGCAGACTTAGGAAAAACAGG - Intergenic
1021279012 7:18693953-18693975 GTAGCCAACTAAAGCAAAACAGG + Intronic
1022564187 7:31380884-31380906 ATGGCCTATTAAGGAAAAATGGG - Intergenic
1024507517 7:50174850-50174872 CTGCCCTGGGAAGGCAAAACTGG - Intergenic
1035424142 7:158756174-158756196 CTGCTCTACTAAGGGACAACTGG + Intronic
1039660978 8:39464879-39464901 CTGTCCTACAATGTCAAAACTGG - Intergenic
1041693797 8:60714784-60714806 GTGGGCTACGAAGGCAAAACAGG - Intronic
1042668727 8:71235998-71236020 ATGGCATACTAAAGAAAAACTGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1054968175 9:71053849-71053871 CTGGCCAACTATCACAAAACAGG + Intronic
1057087641 9:92226420-92226442 ATGGCCAACTAAGGAACAACTGG - Intronic
1059053432 9:110953166-110953188 CTGGCCCACTCAGGCAAGCCTGG + Intronic
1059490556 9:114662847-114662869 CTAGCCTACTAACCCAAAAGGGG - Intergenic
1060210471 9:121707057-121707079 CAGGCCTCCTAAGCCAACACAGG - Intronic
1062537814 9:137028499-137028521 CCGGCCTACGAAGGCTAAGCCGG - Intronic
1191213647 X:57914151-57914173 CTGGTCTACAGAGGCAGAACTGG + Intergenic
1198475811 X:136996856-136996878 CAGGCTTTCTAAGGCAAAAGTGG + Intergenic