ID: 932535664

View in Genome Browser
Species Human (GRCh38)
Location 2:72592268-72592290
Sequence CTCTGTCACCCCTCCAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932535664_932535666 9 Left 932535664 2:72592268-72592290 CCAATATTGGAGGGGTGACAGAG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 932535666 2:72592300-72592322 GGCACTTTTGACAATGCCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932535664 Original CRISPR CTCTGTCACCCCTCCAATAT TGG (reversed) Intronic
904757486 1:32776151-32776173 CTCTGCCCCCCCTCCAAAAAAGG - Intronic
917487039 1:175464911-175464933 CTCTCTCTCCCCTCCAAGACAGG - Intronic
917558803 1:176122360-176122382 CTCTGTTACCTTTCCAAAATCGG + Intronic
920950414 1:210567055-210567077 CTGTGCCCCCCCTCCAATAAGGG + Intronic
922480219 1:225935422-225935444 CACTGTAACCCCTACAATAGTGG - Intergenic
922679303 1:227578770-227578792 CTGTGTCACCTCTCCAAGAAGGG - Intronic
1071265710 10:83963045-83963067 CTCTCTCACCCCTCCAATCCTGG - Intergenic
1073710243 10:106028517-106028539 TTCTTTCATCCCTCCAATCTAGG + Intergenic
1077526265 11:3067623-3067645 CTCTGTCCCACCTCCCATAAAGG + Intergenic
1077882477 11:6362441-6362463 CCCTGTCAATCCTCCAATACAGG + Intergenic
1077882516 11:6362659-6362681 CTCTGGCATCCCTCAAATAATGG - Intergenic
1084806105 11:71580066-71580088 GTCTGTCATCCCTGCAATTTGGG - Intronic
1086909570 11:92457029-92457051 CTCTGTCTCCCCTCCAGTCTTGG - Intronic
1097767504 12:63542810-63542832 TTCTGTGACCCCTCCACTTTGGG - Intergenic
1099545298 12:83972182-83972204 CTCTGTCACCCATGCAGTTTGGG + Intergenic
1099727970 12:86459364-86459386 CCCTGACACCCACCCAATATAGG - Intronic
1099812325 12:87599291-87599313 CTCACCCACCCCTCCAATTTTGG - Intergenic
1100426668 12:94493789-94493811 CACTCTCACGCCTCCAATCTTGG + Intergenic
1101925892 12:108971067-108971089 CTCTATTAACCCTCCAATACAGG + Intronic
1107299832 13:38954136-38954158 CTCTTCCACCCCTCCAGTCTTGG - Intergenic
1108114163 13:47109561-47109583 CTCTGAGACCTTTCCAATATTGG + Intergenic
1110190697 13:72726829-72726851 CTCTGTCTACCCTCTAATGTCGG - Intronic
1110315100 13:74097236-74097258 CTTTGTAACCCCTCTAAGATGGG - Intronic
1111393954 13:87638617-87638639 CTCTATCTACCTTCCAATATTGG - Intergenic
1111599631 13:90455955-90455977 CACTGTCACTCCTCCATTAGGGG - Intergenic
1115047455 14:29013687-29013709 CTCTTTCACCTCTCCCAAATTGG + Intergenic
1119612949 14:76079083-76079105 CTGTCTCACCCCTTCACTATAGG + Intronic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120232691 14:81857030-81857052 CTATGTCCCACCTCCAACATTGG + Intergenic
1120618904 14:86738869-86738891 CTCAGTAACCCCTTCAGTATTGG + Intergenic
1129452326 15:75658048-75658070 CTCTGACTCCCCTCCACTTTTGG + Exonic
1130219380 15:82006120-82006142 CTCTGTCAGCCCACATATATAGG - Intergenic
1131766595 15:95682397-95682419 CTCTGTCACCTCCCCAGTAATGG - Intergenic
1133552234 16:6867668-6867690 CTCTGTCACCCAGGCAATCTCGG - Intronic
1136634019 16:31508001-31508023 CTCAGTCACCCGTCCATTATTGG + Intronic
1139077314 16:63467154-63467176 GTCTGTCACATCACCAATATTGG + Intergenic
1143550411 17:7627230-7627252 CTTTGTCACAACTCCAATCTCGG - Intronic
1151364048 17:73605653-73605675 CCCTGTCACTCCTCCAAATTCGG + Intronic
1153873334 18:9341152-9341174 CACTGTCACTCCTCCAACAGAGG - Intronic
1153991332 18:10403365-10403387 CTCTGTCACCTCTGCACCATGGG + Intergenic
1155099590 18:22596175-22596197 CTCTGCCACCACTCCAATCCAGG + Intergenic
1156185797 18:34661732-34661754 CTCTGTCACCTCTCCTATCTTGG - Intronic
1156759380 18:40569149-40569171 TTCTGTCTCCCCTCCACTGTGGG - Intergenic
1160118761 18:76108550-76108572 CGCTGACACCCCTTCAATAGAGG + Intergenic
1161221393 19:3119760-3119782 CTGTGAGACCCCTCCCATATGGG - Intronic
1163512534 19:17744217-17744239 CACTGTCAGCCCTCCAAAGTAGG - Intergenic
1166945862 19:46395902-46395924 CTCTGTTTCCCCTCCAATCTGGG + Intergenic
928406956 2:31022282-31022304 CACTGTCACACCCCAAATATGGG + Intronic
930717326 2:54605041-54605063 CTCTGTCTTGCCTCCATTATTGG - Intronic
932535664 2:72592268-72592290 CTCTGTCACCCCTCCAATATTGG - Intronic
932904686 2:75736987-75737009 CTCTGTTTCCCCTCGTATATTGG + Intergenic
933765056 2:85701581-85701603 CTAGGTCCCACCTCCAATATTGG - Intergenic
934809820 2:97269084-97269106 CTCTGTCAGCCCCAGAATATTGG - Intergenic
934827877 2:97438901-97438923 CTCTGTCAGCCCCAGAATATTGG + Intergenic
937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG + Intronic
937708049 2:124944152-124944174 CCCTGCCACACCTCCAACATTGG - Intergenic
938666425 2:133543057-133543079 CTAGGTCCCCCCTCCAACATTGG - Intronic
939396515 2:141637792-141637814 CTAGGTCCCACCTCCAATATTGG - Intronic
941085170 2:161109203-161109225 CTCTCTCTCCCCTTGAATATCGG + Intergenic
942385717 2:175440590-175440612 GTCTGTCCCCCCTCCACTGTGGG - Intergenic
945648445 2:212531025-212531047 TTCAGTAACCCCTACAATATTGG + Intronic
1170395207 20:15918765-15918787 CTCTATCATCCCTCCACCATCGG + Intronic
1170611470 20:17917185-17917207 CTCTGTCACCCAGTCAATCTTGG - Intergenic
1176019947 20:62957424-62957446 CTCTGTCTTCCCTCCAGGATTGG + Exonic
1177791897 21:25731345-25731367 TTTTGTCACCGTTCCAATATGGG - Intronic
1178781265 21:35604976-35604998 CTATGGCACCCCTCCAAGAAGGG + Intronic
1183430523 22:37762930-37762952 CTCTGTCCCCACTGCAATAGTGG - Intronic
1184890418 22:47375694-47375716 CTCTGCCATTCCTCCAAAATAGG - Intergenic
951604948 3:24422757-24422779 CTATGTCACCCCTTCATTGTTGG - Intronic
956633389 3:71338476-71338498 CTCTGTCACCCAGGCAATCTCGG + Intronic
960903519 3:122575543-122575565 CTGTTTCACCTCTCCAACATTGG + Intergenic
961441978 3:126958706-126958728 CTCTGTCAGCCTTCCAAGAGAGG + Intronic
965884699 3:173430632-173430654 CTAGGTCACACCTCCTATATTGG - Intronic
966060456 3:175748843-175748865 ATCTGTAACCCCACCACTATAGG + Intronic
976355903 4:84117441-84117463 CTCTTTGATCCCTCTAATATTGG + Intergenic
982296591 4:153835354-153835376 CTCTTTCACACCTTCAATTTAGG - Intergenic
989128360 5:38079061-38079083 CTCTGTCACTCCTTCTATAGAGG + Intergenic
992647364 5:78823945-78823967 CTGTGCCCCCCCTCCAACATTGG - Intronic
992942569 5:81776813-81776835 CTCTGTCTCTTCTCCAAGATAGG + Intergenic
993293343 5:86103453-86103475 CTCTGTCACCCAGGCAATCTTGG + Intergenic
994099666 5:95879322-95879344 CTCTGTGAGTCCTGCAATATAGG - Intergenic
995572603 5:113496092-113496114 CTCAGTCACCCATTGAATATAGG + Intergenic
995673471 5:114634658-114634680 TTCTGTCACCACTCCTATCTAGG - Intergenic
996855212 5:127998239-127998261 CTCTGAAACCCATCCAATTTGGG - Intergenic
997665821 5:135628801-135628823 CTCTGACATCCCTCCAAAATAGG - Intergenic
997786249 5:136716742-136716764 CTCTCTCATCCCTCCACTAAGGG - Intergenic
999596532 5:153211259-153211281 CTCTTTCTTCCCTCCAATACTGG - Intergenic
1001834224 5:174817403-174817425 CTCTGTCAGCACTCCAAAACAGG + Intergenic
1002059131 5:176616066-176616088 CTCTGTCACCCCACCAACTGTGG - Intergenic
1002276555 5:178107811-178107833 CTCTGCCAGTCCTCCAAGATTGG - Intergenic
1002945456 6:1756953-1756975 CTCTACCACCCCTCCCATAAGGG - Intronic
1003509127 6:6764794-6764816 CTAGGCCACACCTCCAATATTGG - Intergenic
1006973530 6:38073490-38073512 GGCTGTCACCTCTCCAATTTAGG - Intronic
1007395113 6:41573294-41573316 CTCTCTCTCCCCTCCAGGATAGG - Intronic
1008091885 6:47302214-47302236 CTCTGACACCCCTCAAATCACGG + Intronic
1008821034 6:55630586-55630608 CTCTGTCCCCACTCAAATGTGGG + Intergenic
1010589197 6:77692990-77693012 CTCTGACATCCCTGGAATATTGG - Intronic
1010785100 6:79991817-79991839 CTATGCCTCACCTCCAATATTGG - Intergenic
1011407146 6:87027908-87027930 CTCTGTCACACCTGAATTATAGG + Intergenic
1013678348 6:112492522-112492544 TTCTGTCTCCCATCAAATATAGG + Intergenic
1013797634 6:113904842-113904864 CACTGGCACCCCTCCAAGCTTGG + Intergenic
1015328008 6:131946724-131946746 CACTTTCACCCCCCAAATATCGG - Intergenic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1021197671 7:17690928-17690950 ATCTGTCAACCCTACAATCTTGG - Intergenic
1024358081 7:48438221-48438243 TTCTTTGACCCCACCAATATGGG + Intronic
1027053365 7:75033294-75033316 CTCTGTCTTCCCTCTACTATTGG - Intronic
1031559829 7:123225293-123225315 CTCTGTCCTCCCTCCTATACTGG - Intergenic
1032988400 7:137363658-137363680 CTCTGCCCCTCCTTCAATATTGG - Intergenic
1034449388 7:151129268-151129290 CTCTGTCACCACCCCACTGTGGG + Intronic
1034858892 7:154579683-154579705 CTCTGTCACTCCTGCACTTTGGG - Intronic
1040626649 8:49157458-49157480 ATCTGTCACCTTTCCAGTATTGG + Intergenic
1042964046 8:74331983-74332005 CTGTGTCAGCCCTGCCATATTGG + Intronic
1047219168 8:122904678-122904700 CTCTGACACTGCTCCAACATGGG - Intronic
1047801664 8:128316571-128316593 CTCTGTGAACCCTCAAATATTGG - Intergenic
1049673559 8:143880031-143880053 GCCCGTCACCCCTCCAGTATAGG + Intergenic
1050107535 9:2181334-2181356 TTCTGTCACACATACAATATGGG - Intronic
1054885019 9:70186975-70186997 CTAGGTCACACCTCCAACATTGG + Intronic
1058029656 9:100181233-100181255 CTCTCTCACCACTCCTGTATTGG + Intronic
1059512519 9:114862660-114862682 CTCTGTCACCTCCCCAAAGTTGG - Intergenic
1188609725 X:32081019-32081041 CTCTGTGATCCTTCCAACATGGG + Intronic
1190983965 X:55483988-55484010 CTCTGTCACCCCTCCCCAAGTGG - Intergenic
1192441865 X:71180514-71180536 CTCTGGCAGCCCTGTAATATAGG - Intergenic
1192578329 X:72260417-72260439 CTCTGTCCTCCCTCAAATAGTGG + Intronic
1198620438 X:138502701-138502723 CTCTGTCATCCCTGATATATGGG + Intergenic
1199704266 X:150410453-150410475 CTGTCTCTCCCCTCCAAAATAGG - Intronic
1201949439 Y:19547819-19547841 CTGTGTCCCACCTCCAACATTGG - Intergenic