ID: 932537942

View in Genome Browser
Species Human (GRCh38)
Location 2:72619495-72619517
Sequence TTTAAAAAGAATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1698
Summary {0: 1, 1: 0, 2: 18, 3: 194, 4: 1485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932537942 Original CRISPR TTTAAAAAGAATGAGGAGGA GGG Intronic
900201472 1:1409150-1409172 CTTAAAAAAAAAGAGGAGGCCGG + Intergenic
900297873 1:1961179-1961201 TTTCAAAAGGAGGAGCAGGAGGG + Intronic
900500858 1:3003844-3003866 TTTGACAATAATGAGAAGGAAGG - Intergenic
900675562 1:3883316-3883338 TTTAAAAAGTAAGAGGAGCCAGG + Intronic
901310987 1:8269590-8269612 TTTAAATAGAGTGTGGAGAAGGG + Intergenic
901826534 1:11865548-11865570 CTTAAAATGAATGATGATGATGG + Intergenic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902131828 1:14268420-14268442 TTTGTATAGAATGAGAAGGATGG + Intergenic
902979120 1:20110372-20110394 ATTAAAAAGACAGAGGAGGCCGG + Intergenic
903298487 1:22361252-22361274 TTTAACAAAAATCAGGAGGCTGG + Intergenic
903425220 1:23248659-23248681 TTTAAAAAGACTAATGAGGCCGG + Intergenic
903928328 1:26847841-26847863 TATAAAAAGAGAGAGGAGGTCGG - Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904649272 1:31992247-31992269 AAAAAAAAGAATGAGTAGGAGGG - Intergenic
905080190 1:35312501-35312523 TTTAAAAAGAATATGGTAGAGGG - Intronic
905220524 1:36443315-36443337 ATTTAAAATATTGAGGAGGATGG + Intronic
906023159 1:42649151-42649173 TTCAAAAAAAATAAAGAGGAGGG + Intronic
906145350 1:43557276-43557298 TTTCAAAGGGTTGAGGAGGATGG + Intronic
906271956 1:44486404-44486426 TTTAAAAAGAAAGATGACGGGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906555017 1:46703402-46703424 TTTAAAAAAATTGAGCAGGCCGG - Intronic
906895650 1:49768130-49768152 TTCCAAAAAATTGAGGAGGAGGG + Intronic
907027430 1:51134954-51134976 TTCAAAAAAATTAAGGAGGAGGG + Intronic
907160906 1:52368214-52368236 TTTAAAAGGAATGAGAAATATGG - Intergenic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
907419576 1:54337789-54337811 TTCAAAAAGTTTGAGGAGGCCGG - Intronic
907591688 1:55679580-55679602 TTTAAAAAAAAAGAAGAGCAGGG - Intergenic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
908664301 1:66472947-66472969 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
908688785 1:66753453-66753475 TTTAACAAGTATTAGTAGGAAGG + Intronic
908818682 1:68059668-68059690 GAAAAAAAGAATGAAGAGGAAGG + Intergenic
908864693 1:68533832-68533854 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
909686563 1:78355277-78355299 AGAAAAAAGAATGAGGAGAAGGG - Intronic
909706258 1:78588160-78588182 TTTAAAAAAGCAGAGGAGGAAGG + Intergenic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
909733975 1:78933034-78933056 TTCCAAAAAATTGAGGAGGAGGG + Intronic
909797834 1:79765433-79765455 TTAATCAAGAAAGAGGAGGATGG - Intergenic
909882793 1:80901162-80901184 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
909898720 1:81107246-81107268 TTCCAAAAAATTGAGGAGGATGG - Intergenic
910083095 1:83365265-83365287 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
910097468 1:83539792-83539814 TTTAAAAAGAATCAGGTGAATGG - Intergenic
910299185 1:85686255-85686277 TTTAAAAAGAATGTTAAGGGTGG - Intronic
910300223 1:85697631-85697653 TGAAAAAAGAATGATGAGGCTGG - Intronic
910404402 1:86871961-86871983 TTTTAAAAGATTCTGGAGGAGGG + Intronic
910433857 1:87185335-87185357 GTTTCAAAGAATGAGGTGGAGGG - Intergenic
910563924 1:88622176-88622198 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
910748061 1:90595330-90595352 TTTCAAAAGATTGAGGAGAAGGG + Intergenic
910770743 1:90829347-90829369 TTTAAAATTACTGAGGAGTATGG + Intergenic
910819499 1:91330609-91330631 TTTCAAAAAATAGAGGAGGAGGG + Intronic
911008129 1:93248999-93249021 TTTCAAAAAATTGAAGAGGAGGG - Intronic
911310410 1:96285851-96285873 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
911329454 1:96510399-96510421 TTTGAAAAGGATTAGGAGAACGG - Intergenic
911458271 1:98155218-98155240 TTACAAAAAATTGAGGAGGAGGG + Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
911667527 1:100570951-100570973 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
912016531 1:105044133-105044155 TTCAAAAAAAGTGAAGAGGAGGG + Intergenic
912156138 1:106922769-106922791 TTTGTTAAGATTGAGGAGGAGGG - Intergenic
912373975 1:109195191-109195213 TTTAAAAATATGCAGGAGGAAGG + Intronic
912385279 1:109268368-109268390 TATGTAGAGAATGAGGAGGAGGG + Intronic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912599258 1:110911459-110911481 CTCAAAAATATTGAGGAGGAGGG + Intergenic
912601437 1:110938165-110938187 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
912613354 1:111071623-111071645 TAAAAAAACATTGAGGAGGAGGG - Intergenic
912639094 1:111327389-111327411 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
912934942 1:113994879-113994901 ATTAAAAAGAATGAAGAGGCCGG + Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913193104 1:116430334-116430356 TCTCAAAAGAAAGAGGAAGAAGG - Intergenic
913325915 1:117628855-117628877 GATCAAAGGAATGAGGAGGAAGG - Intergenic
913359987 1:117969949-117969971 TTTAAAAGGAATGGGCAGAATGG + Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913707284 1:121438636-121438658 TCCAAAAAAAAAGAGGAGGAAGG + Intergenic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914564642 1:148854207-148854229 TTCAGAAAGAATGAGGAAGTGGG - Intronic
914608184 1:149276035-149276057 TTCAGAAAGAATGAGGAAGTGGG + Intergenic
914895915 1:151672527-151672549 TTCAAAAAAAGAGAGGAGGAGGG - Intronic
914960780 1:152204536-152204558 TTCAAAAAGAATGAGGAGTCAGG + Intergenic
915000786 1:152588197-152588219 TTCCAAAAAATTGAGGAGGAAGG + Intronic
915005608 1:152632506-152632528 TTCCAAAATATTGAGGAGGAGGG + Intergenic
915640746 1:157224005-157224027 TTCTAAAAGATTGAAGAGGAGGG - Intergenic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
915779471 1:158530462-158530484 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
915803823 1:158823243-158823265 TTCAAAAAAATTGAGGAGGAAGG - Intergenic
915880124 1:159661035-159661057 TTTAAAAAAATTGAAGAAGATGG - Intergenic
916195602 1:162219407-162219429 TTAAAAAAGAAAGAGGCAGAAGG - Intronic
916593907 1:166223568-166223590 TTCCAAAAGATTGAGGAGGAGGG - Intergenic
916712512 1:167424591-167424613 TTTAACATGACTGAGGAGGGAGG - Exonic
916904386 1:169266069-169266091 TTCCAAAAAATTGAGGAGGAGGG + Intronic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917223668 1:172759051-172759073 TGTAAAAAAAATGAGTATGATGG - Intergenic
917363725 1:174205321-174205343 TTCCAAAAAACTGAGGAGGAGGG - Intronic
917375298 1:174346276-174346298 TTTCAAAAAAAGGAGGAGAAAGG - Intronic
917673278 1:177294616-177294638 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
917713246 1:177708845-177708867 TTTTAAATGATTGAGAAGGAAGG + Intergenic
917952999 1:180060889-180060911 TTTAAAAAGAATGTGCTGGAAGG + Intronic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918380393 1:183948190-183948212 TCCAAAAAAAAAGAGGAGGAGGG + Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
918732552 1:188016301-188016323 TTTAAAAAGAAAGAAAAGGAAGG - Intergenic
918746977 1:188215051-188215073 TTCCAAAATATTGAGGAGGAAGG - Intergenic
918827100 1:189338094-189338116 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
918854119 1:189729020-189729042 ATTCAAAAGACTGAGAAGGAGGG - Intergenic
918877880 1:190073045-190073067 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
918959141 1:191248899-191248921 TTTAAAAAAAAAGAAAAGGAGGG - Intergenic
919045049 1:192440858-192440880 TTTAAGTAGAATGATCAGGATGG + Intergenic
919207800 1:194439461-194439483 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
919269031 1:195314426-195314448 TTTCAAAAAATTGAGGAAGAGGG + Intergenic
919281244 1:195492281-195492303 TTTCAAAAGATAGAGAAGGAGGG - Intergenic
919376946 1:196807070-196807092 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919389481 1:196964410-196964432 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919453266 1:197795780-197795802 TCCAAAAAAATTGAGGAGGAAGG - Intergenic
919503615 1:198369627-198369649 ATTTAAAGGAATGAGGAGAAGGG - Intergenic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
919568143 1:199215127-199215149 TTCCAAAATATTGAGGAGGAGGG - Intergenic
919886362 1:201937953-201937975 TATAAAACGAATGAAGAGAATGG + Intronic
920016945 1:202919496-202919518 TTTAAAAAAAAAATGGAGGAAGG - Intronic
920145638 1:203858989-203859011 TCTAAAAAGAAGGTGGGGGAGGG + Intergenic
920410054 1:205752052-205752074 TTTAAAAAAATTGCGGGGGACGG - Intergenic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
921252131 1:213308013-213308035 TTTAAAGAGAAAGAAGAGGCTGG + Intergenic
921751640 1:218800975-218800997 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
921760730 1:218911169-218911191 TTTTAAAAGAATGTGGATGTTGG + Intergenic
921775931 1:219100175-219100197 TTTAAAGAGGATGAAGAGGCTGG + Intergenic
921797444 1:219363045-219363067 TTTAAAAACAATGAAGACGGTGG - Intergenic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
921970709 1:221146256-221146278 CTCAAAAAGAAAGAGAAGGAAGG + Intergenic
922762999 1:228143945-228143967 GTTAAAAAGACTCAAGAGGAAGG - Intronic
923154158 1:231261832-231261854 ATTAAAAGGGATGAGGAGGAAGG - Intronic
923364061 1:233242282-233242304 TTTAAAAAATAAGAGTAGGATGG - Intronic
923366889 1:233270547-233270569 TTTAAAAATGATGAGGTAGATGG + Intronic
923548737 1:234944186-234944208 TTTAAGGACAAGGAGGAGGAAGG + Intergenic
923751370 1:236749498-236749520 TTAAAAAAGAATGCTGAGGCTGG + Intronic
923936881 1:238771237-238771259 ATAAAAGAGAATGAGGAGGCCGG - Intergenic
924262307 1:242244567-242244589 TTTAGAAACAATGGAGAGGATGG + Intronic
924375340 1:243402129-243402151 TTTAAAAAGTAAAAGGAGGCTGG + Intronic
1063054446 10:2489227-2489249 TTTAAAAGCAAAGAGAAGGAGGG + Intergenic
1063449121 10:6139775-6139797 TCCAAGAAGAGTGAGGAGGAGGG - Intergenic
1063535092 10:6875762-6875784 TTTAAAATGAAGTAGAAGGAGGG - Intergenic
1063759288 10:9054770-9054792 TTTTAAAACAGTGAAGAGGAGGG - Intergenic
1063802810 10:9600206-9600228 ATTTAAAAGAATGAAGAGGGAGG + Intergenic
1064038222 10:11934114-11934136 TTTAAAGAGAAAGAGAATGAAGG + Intronic
1064554207 10:16532469-16532491 ATTAAAAATAATGAGTAGGGAGG + Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064777811 10:18798686-18798708 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1065059644 10:21886435-21886457 TTCCAAAAAACTGAGGAGGAAGG + Intronic
1065379153 10:25071933-25071955 TTTATAAAGAAGGAGGAGGTCGG + Intergenic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1065530813 10:26668621-26668643 ATTATAAAGAATGAAGAGGCTGG + Intergenic
1065551108 10:26869241-26869263 TCTCAAAAGAAAGAGGAAGAAGG - Intergenic
1065672311 10:28133370-28133392 TTCAAGTTGAATGAGGAGGAGGG - Intronic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066165271 10:32781264-32781286 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1066307286 10:34158035-34158057 TTTAAAGAGAATGAGGTAAAAGG - Intronic
1066381711 10:34907273-34907295 TTTATAAAGAGTTAGGAGGCTGG + Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066522856 10:36242154-36242176 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1066753033 10:38679198-38679220 TTCCGAAAAAATGAGGAGGAAGG + Intergenic
1067114714 10:43426315-43426337 TTTAAAGAGATTGAGGGGGAGGG - Intergenic
1067245907 10:44543256-44543278 TCCCAAAACAATGAGGAGGAGGG - Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1067396735 10:45927023-45927045 GTTAATAAGAATGAAGAGCATGG + Intergenic
1067865052 10:49896126-49896148 GTTAATAAGAATGAAGAGCATGG + Intronic
1068370329 10:56104349-56104371 TTAAAAAAGAATGAGCAATATGG - Intergenic
1068462666 10:57347952-57347974 TTTTAAAAAATTGAGGAGGAGGG - Intergenic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1068707869 10:60096958-60096980 TTTAAAAAGAGAGAGGAGAGAGG - Intronic
1069190933 10:65488780-65488802 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1069355984 10:67585371-67585393 TTACAAAAAATTGAGGAGGAAGG - Intronic
1069714915 10:70514497-70514519 TTTAAAGAGAAAGAGGCTGAGGG + Intronic
1070191960 10:74119175-74119197 TTTAGAAAGGATGTGGAGGAAGG - Exonic
1070315203 10:75303556-75303578 TTAAGAAAGAATCAGGAGCAGGG - Intergenic
1070326571 10:75393433-75393455 TTTCAAAATAATGAGTTGGAGGG + Intergenic
1070391519 10:75974945-75974967 TTAAAAACCAATGAGGAAGATGG + Intronic
1070431543 10:76344590-76344612 TTTAAAAAGAATTATAATGAGGG + Intronic
1070434731 10:76379262-76379284 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1070463452 10:76692750-76692772 TTTAAGAAGAAAGGGGAGCAAGG + Intergenic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1070886963 10:79909107-79909129 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1070936422 10:80300800-80300822 TTTAAATAAAATGAGAAAGAGGG - Intergenic
1070957830 10:80475879-80475901 TATAAAAAGGATGGGGAGGCCGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071199492 10:83203050-83203072 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1071357826 10:84816156-84816178 TTTCAAAATATTGAGGAGGAAGG - Intergenic
1071454036 10:85828914-85828936 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1071611428 10:87034934-87034956 TTCCAAAAAAGTGAGGAGGAGGG - Intergenic
1071891820 10:90016533-90016555 TTCAAAAAAATTGAAGAGGAAGG - Intergenic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1072368530 10:94740409-94740431 TTCCCAAAAAATGAGGAGGAGGG - Intronic
1072862138 10:99017560-99017582 TTTCAAAAAATTGAGGAGGAGGG - Intronic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1073545179 10:104341942-104341964 TTTAAAAAGAATAGGGGTGAAGG - Intergenic
1073671773 10:105598827-105598849 TTTAGAAAGAATGAAAAGAATGG + Intergenic
1074000294 10:109365405-109365427 TTTCAAAAAATTGAGGAAGAGGG - Intergenic
1074013887 10:109512908-109512930 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1074029412 10:109670205-109670227 TTTAAAAGGACTGAGAAAGAGGG - Intergenic
1074629714 10:115239077-115239099 TTTAAATATAATGAAGAAGAAGG - Intronic
1074672945 10:115815852-115815874 TTTAAAAAGAATTATAAGGCAGG - Intronic
1075012032 10:118881116-118881138 TTAAAAAAAATTGAAGAGGAGGG + Intergenic
1075496681 10:122926804-122926826 TTTCAAAAGATAAAGGAGGAAGG + Intergenic
1075543855 10:123338664-123338686 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1075828428 10:125381511-125381533 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1075851359 10:125590414-125590436 TTTAAAATAAAAGAGAAGGAGGG - Intronic
1075947483 10:126448992-126449014 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1077542458 11:3153662-3153684 TTTAAAAATAATGAACAGGGCGG + Intronic
1077821288 11:5744313-5744335 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1078135777 11:8650371-8650393 TCAAAAAAGGATGAGGAAGAAGG + Intronic
1078229614 11:9427588-9427610 TTTATAAACAAAGAGAAGGATGG - Intronic
1078244097 11:9557709-9557731 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1078302902 11:10151787-10151809 TTTAAATATAAAGAGGAAGATGG - Intronic
1078304584 11:10171673-10171695 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1078452874 11:11453281-11453303 TTTAACAAGAAGGTGGCGGAAGG - Intronic
1078816408 11:14826774-14826796 TTACAAAAAAATGAGGAGGAAGG + Intronic
1079303536 11:19301323-19301345 ATTAAAAAGACTGACAAGGATGG + Intergenic
1079331868 11:19540276-19540298 TTTAGAAAGAGTGAGGAGCAAGG - Intronic
1079588554 11:22154933-22154955 TTTAGCAAGAAGGATGAGGAAGG - Intergenic
1079678024 11:23256771-23256793 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1079739782 11:24043640-24043662 CTTAAGAAGTATGTGGAGGAGGG + Intergenic
1079757617 11:24284623-24284645 TTTCAAAAAATTAAGGAGGAAGG + Intergenic
1079777209 11:24546807-24546829 TTTTAAAAAATTGAGGAGGAAGG - Intronic
1079920951 11:26433933-26433955 TATCAAAAAATTGAGGAGGAAGG - Intronic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1080018903 11:27537937-27537959 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1080094344 11:28387650-28387672 TTTCAAAAAACTGAAGAGGAAGG + Intergenic
1080148491 11:29019795-29019817 TTTAATAATAATGACGATGATGG + Intergenic
1080384770 11:31804814-31804836 TTTGAAATGAGTGAGGAGGGAGG - Intronic
1080385359 11:31807645-31807667 TTTAAAAAGTACGAACAGGAGGG + Intronic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1080790757 11:35520616-35520638 TTTAAAATAAAAGAGGAGGGAGG + Intronic
1081010058 11:37799826-37799848 TTCTCAAAAAATGAGGAGGAGGG + Intergenic
1081026624 11:38022744-38022766 TTCAAAAAAATTGAGAAGGAGGG + Intergenic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1081387349 11:42487387-42487409 TTTAAAAAGAGAGAGGATAATGG + Intergenic
1081389371 11:42511566-42511588 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1081397003 11:42598273-42598295 TGAATAAAGAATGAGGATGAAGG + Intergenic
1081563862 11:44244092-44244114 TTTGAGCAGAATGAGAAGGATGG - Intronic
1081706312 11:45183690-45183712 TTTCAAGGGTATGAGGAGGAAGG + Intronic
1082886110 11:58084397-58084419 TTCTAAAAAATTGAGGAGGAGGG + Intronic
1083040787 11:59684040-59684062 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
1083051227 11:59778533-59778555 GTTAAAAAGAAAGAGAGGGAAGG + Intronic
1083190271 11:61046569-61046591 TTAAGAAAGAATGAGGTTGATGG - Intergenic
1083398419 11:62407047-62407069 TTTAAAAACAATGATAAGGCTGG + Intronic
1083447221 11:62716098-62716120 TTTAAAAAGTCTGAGGGGGGAGG + Intronic
1084536106 11:69758123-69758145 TTAAAAAAGAAAAAGGATGATGG - Intergenic
1085068180 11:73517325-73517347 TTTAAAAAGTATGTAGAGGCTGG - Intronic
1085134080 11:74069096-74069118 TTTAAAAATAAACTGGAGGATGG - Intronic
1085548139 11:77340057-77340079 TTTAATAGCAATGAGGAGAAAGG + Intronic
1085567066 11:77523712-77523734 TTTTAAAAGTATGAAGAGGCCGG - Intronic
1086299185 11:85406915-85406937 TTTAAAAGGAATGAGAGGAAAGG + Intronic
1086523160 11:87695046-87695068 TTCCAAAATATTGAGGAGGAGGG - Intergenic
1086767368 11:90714151-90714173 TTCAAAAAGATTGAAGATGAGGG - Intergenic
1087091506 11:94278395-94278417 TGTAAACAGAATGTAGAGGAGGG + Intergenic
1087310075 11:96531209-96531231 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1087337249 11:96860223-96860245 TCCAAAAAAAATGAGGAAGAGGG - Intergenic
1087378813 11:97378559-97378581 TCTAAAAATACTGAGGTGGAGGG + Intergenic
1087513236 11:99125071-99125093 TTACAAAAAATTGAGGAGGAAGG + Intronic
1087555856 11:99720131-99720153 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1088297890 11:108320756-108320778 TTTCAAATGTGTGAGGAGGAGGG - Intronic
1088314713 11:108496316-108496338 TTAAAAAAAAAAAAGGAGGAGGG + Intronic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1088552725 11:111030337-111030359 TTTCAAAAGATTGAGAAGGAGGG + Intergenic
1088778376 11:113109049-113109071 TTTAAGAGGAGTGAGGAGGCCGG + Intronic
1089003040 11:115068113-115068135 TTTAAAAACAATTAGGATCATGG + Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1089998392 11:122930550-122930572 TTTAAAAATACTGAGAATGATGG + Intronic
1090105316 11:123848539-123848561 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1090572589 11:128063907-128063929 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
1091094443 11:132806792-132806814 TTTGAAAAGAATGTGTATGATGG - Intronic
1091131940 11:133153712-133153734 TTTAAACAGAATAAGGAGATGGG - Intronic
1091398109 12:166334-166356 TTTAAAAAAAATGAAGTGGAGGG - Intronic
1091528941 12:1335759-1335781 TTCAAATAAATTGAGGAGGAGGG - Intronic
1091980694 12:4861525-4861547 TTTAAAAAGAGTGGTCAGGAAGG - Intergenic
1092629911 12:10365980-10366002 TGTCAAAAGAATAAGGAGAATGG + Intergenic
1092694775 12:11158986-11159008 AATAAAAAAAAGGAGGAGGAAGG + Intronic
1093060391 12:14596256-14596278 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1093100822 12:15026834-15026856 ATTACAAAAATTGAGGAGGAGGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093219729 12:16405521-16405543 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1093285079 12:17249220-17249242 TTTACTAAGAATGAGGTGGAAGG + Intergenic
1093294935 12:17377789-17377811 CTTAAAAAGTATGAGGACCAAGG - Intergenic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093659116 12:21734107-21734129 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1093702372 12:22236503-22236525 TTTAAAAAGAGGGCTGAGGAGGG + Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094225920 12:28045963-28045985 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1094758973 12:33506722-33506744 TTAAAAAACAATGAGCATGATGG + Intergenic
1095051188 12:37555472-37555494 TTTAAAATGAATGAAAACGAGGG - Intergenic
1095244969 12:39908833-39908855 TATGAAAAGCATGAGGAAGATGG + Intronic
1095398853 12:41791688-41791710 TTTAAAAAGTAGGATTAGGATGG - Intergenic
1095551526 12:43447095-43447117 ATTTAAAAAATTGAGGAGGAGGG + Intronic
1095558720 12:43539724-43539746 TTTAAAAAGCATGCTGAAGAGGG + Intronic
1095607641 12:44089176-44089198 TTTGAAATGAATGAAAAGGAAGG + Intronic
1095625904 12:44314793-44314815 TTTCAAAAAATGGAGGAGGATGG - Intronic
1095680145 12:44964803-44964825 TTTCAACAAACTGAGGAGGAGGG + Intergenic
1095827796 12:46548318-46548340 ATTAAAAAGATTGAGAAAGAGGG - Intergenic
1095856711 12:46867618-46867640 TTTGAATAGAATGAGGAGGCAGG + Intergenic
1095897817 12:47297872-47297894 TTTAAAAAGACTGTTGAGGCTGG - Intergenic
1096035320 12:48463524-48463546 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1096087253 12:48874056-48874078 CTAAAAAAAAATTAGGAGGAAGG + Intergenic
1096850102 12:54429854-54429876 TTTAAAAAGAAAAAGAAGAATGG - Intergenic
1096863520 12:54547542-54547564 CTTAAAATGAATCAGGAGCAGGG + Exonic
1097253890 12:57657245-57657267 TTTAAAATGAAAGAGGGGAAAGG + Intergenic
1097558950 12:61177180-61177202 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1098022138 12:66167585-66167607 TTTAAAAAGAAAGAAAAGAACGG + Intronic
1098145470 12:67493266-67493288 TTTTAAAAAGTTGAGGAGGATGG + Intergenic
1098268236 12:68745210-68745232 TTTAAAATAAATGAGGAAGTAGG - Exonic
1098347570 12:69522297-69522319 TCCAAAAAAACTGAGGAGGAGGG - Intronic
1098714920 12:73817977-73817999 TTTTCAAAGAATGAAGATGAGGG - Intergenic
1099032343 12:77542530-77542552 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1099130859 12:78828927-78828949 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099497885 12:83375250-83375272 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099559227 12:84151471-84151493 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1099845383 12:88021948-88021970 TTTCAAAAAATTGAGGATGAAGG + Intronic
1099966895 12:89456561-89456583 TATAAAAAGAATAAAGAGTAAGG + Intronic
1100078680 12:90822115-90822137 TTTAAAGAGAATTAGAGGGAGGG - Intergenic
1100306324 12:93353112-93353134 TTTAAAAAGAAGTTGGAGAAGGG + Intergenic
1100427432 12:94500379-94500401 TTTAAAAAGAAAGAAAAGAAAGG + Intergenic
1100505160 12:95212807-95212829 TTTTAAAAAAAAGAGGAGTAGGG + Intronic
1100878516 12:98990398-98990420 TTTCAAAAAAATGAGGCTGATGG + Intronic
1100889106 12:99104135-99104157 TTTGAAAAGAATGAGATTGAGGG + Intronic
1100903418 12:99269857-99269879 TTTAAAAATAATGAGCAAGTCGG - Intronic
1101288015 12:103336472-103336494 TTTACAAAGAGTGAGGAGAGAGG + Intronic
1101627610 12:106461019-106461041 TTTCAGGAGAATGAGGAGGTAGG - Intronic
1101919031 12:108917939-108917961 ATTAAAAAGAATGAGGTGGTGGG - Intronic
1102653428 12:114460283-114460305 TTTAAAAAAAAAAAGGAAGAAGG + Intergenic
1102911587 12:116718787-116718809 TTTAAAGGAAATGAGGAGGAAGG - Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103653512 12:122452190-122452212 GTTTAAAAAAATGAGGAGGCTGG - Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1103973095 12:124684494-124684516 GTTAAAAAGAATGAGGTGACTGG - Intergenic
1103998904 12:124847697-124847719 TTTAGAAAGCAGGTGGAGGAAGG + Intronic
1104056325 12:125233622-125233644 TTTAACAAGAAAGGGGTGGAAGG + Intronic
1104514533 12:129412514-129412536 TGTAGGAAGAATGAGGAGGAGGG - Intronic
1105063584 12:133176877-133176899 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1105711790 13:23017071-23017093 TTCAAAAACACAGAGGAGGAAGG - Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1105770744 13:23609483-23609505 ATTAATACGAGTGAGGAGGATGG - Intronic
1106079291 13:26487335-26487357 TTTAGAAAGAATGACCAGAATGG + Intergenic
1106387865 13:29305743-29305765 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1106723442 13:32459762-32459784 TCCAAAAAAAATGAAGAGGAGGG + Intronic
1106773555 13:32986498-32986520 CTTAAAGGGAATGAGGAGGGTGG + Intergenic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1106843788 13:33714846-33714868 TATAAAAAGCATGAGGTGGTTGG + Intergenic
1107071035 13:36269379-36269401 TTTCAAAAGACTGAGAAAGAGGG + Intronic
1107157683 13:37188762-37188784 TATAAAAAAATTGAGGAGAAGGG + Intergenic
1107165269 13:37276246-37276268 TTCAAAAAGAAAGAGGACTAGGG + Intergenic
1107211186 13:37856485-37856507 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1107249434 13:38340750-38340772 CATAAAAAGAATCAGTAGGATGG - Intergenic
1107310948 13:39077035-39077057 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1107468437 13:40668807-40668829 TTTAAAAAAATTGACGAGGCAGG + Intergenic
1107776967 13:43854582-43854604 TTCCAAAAAATTGAGGAGGATGG + Intronic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1107896626 13:44971267-44971289 TTTAAAGAGAATGAGGAAATGGG - Intronic
1108031818 13:46239594-46239616 TCCAAAAAAATTGAGGAGGAGGG + Intronic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1108273568 13:48786281-48786303 TGTAAAAATAATGAGAAGGAGGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1109018428 13:57051541-57051563 TTCAAAAATATTTAGGAGGAGGG + Intergenic
1109057655 13:57572371-57572393 TTTCAAAAAATTGAGGAGAAAGG - Intergenic
1109065776 13:57688079-57688101 TTTAAAAAAAATGGGGTGGGGGG - Intronic
1109325816 13:60866595-60866617 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1109332893 13:60952311-60952333 TTTAAAAAAAAGGAGGAGGGTGG - Intergenic
1109374994 13:61480938-61480960 TTTCAAAAAGTTGAGGAGGAGGG - Intergenic
1109436038 13:62304021-62304043 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1109619525 13:64884104-64884126 TTTAAAAAGTATGTGTATGAAGG - Intergenic
1109666753 13:65550037-65550059 TTCCAAAACATTGAGGAGGAGGG - Intergenic
1109695782 13:65955333-65955355 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1109783547 13:67144257-67144279 TTTAAAATGAAAGAGGAAGAAGG + Intronic
1109836758 13:67868889-67868911 TTTAAAAAGAATAAAGAGAAAGG - Intergenic
1109910958 13:68909305-68909327 TTTCAAAAAATGGAGGAGGAGGG - Intergenic
1109960959 13:69629951-69629973 TTGAAAAAGATTGAGGAGCCAGG + Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110307023 13:74000053-74000075 TTTAAAAAAAGTGGGGAGGAGGG - Intronic
1110600602 13:77368188-77368210 TTTCAAAAAATTGAGGAGAAGGG + Intergenic
1110782190 13:79479731-79479753 TTTAAAAAGAACTATGAGGAAGG + Intergenic
1110989017 13:82013021-82013043 TTTATAAAGATTCAGGAGTATGG - Intergenic
1111029579 13:82577665-82577687 TTTCAAAAAACTAAGGAGGAGGG - Intergenic
1111569622 13:90066105-90066127 TGTAAAGAGACAGAGGAGGAAGG + Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111757191 13:92413608-92413630 TTTAAACAAAATGAGGATCAAGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112254070 13:97812684-97812706 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1112658410 13:101477941-101477963 TTTCAAAAAATGGAGGAGGAGGG + Intronic
1113218525 13:108071079-108071101 ATTAGAAAGAATGAAGGGGAGGG + Intergenic
1113321833 13:109240839-109240861 TTTAAAAAGAAGGAAGAAAAGGG + Intergenic
1113540569 13:111104807-111104829 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1114033565 14:18598200-18598222 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1114078355 14:19177396-19177418 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1114125134 14:19717151-19717173 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1114274305 14:21128383-21128405 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1114368366 14:22055703-22055725 TTCCAAAATATTGAGGAGGACGG + Intergenic
1114779883 14:25526971-25526993 TTTAAAAAAAATGAGGACACTGG + Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1114907337 14:27146785-27146807 TTCAAAAAAATTGAGCAGGAGGG - Intergenic
1115021545 14:28686888-28686910 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1115139211 14:30149273-30149295 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1115182599 14:30646654-30646676 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1115473380 14:33791280-33791302 TGTAAAAAGACTGAAGGGGAAGG - Intronic
1115548165 14:34481647-34481669 TTTGAAAAGAATGAGTTGGCCGG + Intergenic
1115885423 14:37966458-37966480 TCCAAAAAAATTGAGGAGGAAGG - Intronic
1116077957 14:40136087-40136109 TTCCACAAAAATGAGGAGGAAGG - Intergenic
1116148432 14:41105422-41105444 TTTCAAAAAATTGAGGAGGATGG + Intergenic
1116431429 14:44849578-44849600 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1116456259 14:45123912-45123934 TTTTAAAAGAATGAGGGGGCTGG - Intronic
1116471649 14:45292640-45292662 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1116578647 14:46609098-46609120 TTAAAAAAAATTGAGGAGAAGGG + Intergenic
1116796555 14:49397034-49397056 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117363097 14:54997614-54997636 ATTAAAAAAAATGGGGAGGCCGG + Intronic
1117856902 14:60043842-60043864 TTTAAAAAAATTGAAGAGGAAGG - Intronic
1117948962 14:61061468-61061490 TCCAAAAAAATTGAGGAGGAGGG - Intronic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118522970 14:66607536-66607558 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1118557778 14:67044884-67044906 TTTAAAAAGAAAGAGAGGGAGGG - Intronic
1118557856 14:67045841-67045863 TTTAAAAAGAAAGAGAGGAAAGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1119651283 14:76385451-76385473 TTTAAGAAGGATTAGGAGAAAGG + Intronic
1120306031 14:82771715-82771737 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1120933212 14:89869244-89869266 TTTTTAAAGTGTGAGGAGGAGGG - Intronic
1120960371 14:90119249-90119271 TTCCAAAATATTGAGGAGGAAGG + Intronic
1121160345 14:91733112-91733134 TCTAAAAAGAATGATGAAGCAGG + Intronic
1121723046 14:96125124-96125146 TTTAAAAAGACAGATGAGGCTGG + Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122004394 14:98690063-98690085 TTCAAAAAGATTACGGAGGAAGG + Intergenic
1122169283 14:99858479-99858501 TGTAAAAGGAATGAGGAGGCTGG - Intronic
1122401037 14:101467567-101467589 TTTAGAGAGCATGGGGAGGAGGG - Intergenic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1122495765 14:102153600-102153622 TTTATAAAGAAAGAGGTGGCCGG - Intronic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125822403 15:42643489-42643511 TTTAAAAAGAACGAGGGGCCGGG - Intronic
1126452243 15:48821003-48821025 TTTAAAAAGAACAAGGTGGGAGG - Intergenic
1126502709 15:49364148-49364170 TTCCAAAACATTGAGGAGGAGGG - Intronic
1126504366 15:49387099-49387121 TTCCAAAAGATTGAGAAGGAAGG + Intronic
1126880322 15:53087860-53087882 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1126976076 15:54182545-54182567 TTCCAAAAAACTGAGGAGGACGG - Intronic
1127021941 15:54757956-54757978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1127097104 15:55523467-55523489 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1127143747 15:56003271-56003293 ATTAAAAAAAATGAAGAGGCCGG - Intergenic
1127376912 15:58393498-58393520 TTTAAAAAAAATGAGGTGGGTGG + Intronic
1127400643 15:58582103-58582125 TTAAAAAAAAAAGAAGAGGAGGG + Intergenic
1127494170 15:59493882-59493904 TTAGAAAAGAAGGAGGAGGCCGG - Intronic
1127612617 15:60651706-60651728 TTTAAAAAGACTGGGGCTGAAGG - Intronic
1127933544 15:63614117-63614139 TATATAAAGAAAGAGGAGGAAGG + Intronic
1128123108 15:65169396-65169418 TTTGAAAAGAAAGAGTAGGCTGG - Intronic
1128294868 15:66509874-66509896 TTAAAAATCAATGAGGAAGATGG + Intronic
1128320008 15:66686604-66686626 GGAAAAAAGAATGAGTAGGAGGG + Intergenic
1128850639 15:70952296-70952318 TTTCAAAAAATTGAGAAGGAGGG - Intronic
1128900243 15:71414159-71414181 CATCTAAAGAATGAGGAGGATGG + Intronic
1129564925 15:76611534-76611556 TTGCAAAAAATTGAGGAGGAGGG + Intronic
1129568934 15:76657500-76657522 ATTCCAAATAATGAGGAGGAGGG + Intronic
1130185824 15:81680805-81680827 TTTCAAAAAACTGAGGAGGAGGG + Intergenic
1130220330 15:82014127-82014149 CTTAAAAAGAAAGAAGAGGTCGG + Intergenic
1130238054 15:82156772-82156794 TTTAAAAACAAAAAGAAGGAAGG + Intronic
1130366697 15:83247124-83247146 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130560877 15:84957757-84957779 TTTAAAAAGAATAACAAAGATGG - Intergenic
1130605189 15:85309438-85309460 TTCCAAAAGAATGAGAAAGAGGG + Intergenic
1130619730 15:85449952-85449974 TTACAAAAAATTGAGGAGGAAGG - Intronic
1130791860 15:87163872-87163894 TTTAAAGAGAATGAACTGGATGG - Intergenic
1130835433 15:87645520-87645542 TTTTAAAAGCATGAGGAGAGGGG + Intergenic
1130971466 15:88737021-88737043 GTTAACAAGAACCAGGAGGACGG + Intergenic
1131569308 15:93517880-93517902 TTTAAAAAGAACGATGTTGAAGG + Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131762648 15:95641173-95641195 GCTAAAAGGAATGGGGAGGAAGG - Intergenic
1131849242 15:96521003-96521025 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
1131852121 15:96554632-96554654 GTAAAAAGGAAGGAGGAGGAGGG - Intergenic
1131901749 15:97095219-97095241 TATAATAAGAAAGTGGAGGAAGG - Intergenic
1132302586 15:100785315-100785337 TGTAGACAGAGTGAGGAGGAAGG + Intergenic
1132353447 15:101154717-101154739 TTTAAAGAAAATGAGAAGGGCGG - Intergenic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1132924319 16:2420591-2420613 TATAAAAAGAAGGAGGAAAAGGG + Intergenic
1133110110 16:3542999-3543021 TTTGAAATGGAAGAGGAGGAAGG - Intronic
1133471577 16:6081071-6081093 TTTTAAATGAATGTGGAGCATGG + Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133713826 16:8427966-8427988 TTTAAAAAAAAAAAGGAAGAGGG + Intergenic
1133974948 16:10594063-10594085 TTTTAAAAGAATTTGGAGGCCGG - Intergenic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134377512 16:13691257-13691279 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1134802994 16:17102868-17102890 TTTGAAAACAATGAAGGGGACGG + Exonic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1136138833 16:28275945-28275967 AAAAGAAAGAATGAGGAGGACGG + Intergenic
1136159723 16:28411337-28411359 TTTAAAAAGAATGACTGGGCTGG - Intergenic
1136203366 16:28703957-28703979 TTTAAAAAGAATGACTGGGCTGG + Intronic
1136729661 16:32397793-32397815 TTCTGAAAAAATGAGGAGGAAGG - Intergenic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137227362 16:46526402-46526424 TTTTAAAAGATTGGGAAGGAGGG + Intergenic
1137422759 16:48350087-48350109 TTTAAAAATAGTAAGGAGGCTGG + Intronic
1137671130 16:50279978-50280000 TTCAAAAAAATTGAGGAAGAGGG - Intronic
1138069368 16:53976513-53976535 TCTAAAAAGAAAATGGAGGAGGG - Intronic
1138129518 16:54467760-54467782 TTTAAAAAAGAAAAGGAGGAAGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138727196 16:59152707-59152729 TTTACAAAGAAAAAGGAAGATGG + Intergenic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1138883544 16:61047094-61047116 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1139119872 16:64003228-64003250 TTCCAAAAGATAGAGGAGGAGGG + Intergenic
1139186894 16:64816943-64816965 TTTCAAATAATTGAGGAGGAGGG - Intergenic
1139712973 16:68790557-68790579 CTCAAAAAGAATAAGGAGAATGG - Intronic
1139809814 16:69605141-69605163 TTAAAAAAGAAAGTGGAGGCCGG + Intronic
1140117110 16:72051448-72051470 TTTTAAAATATTAAGGAGGAGGG - Intronic
1140120282 16:72077604-72077626 TTTAAAGCGAATTAGGAGAAAGG + Intronic
1140245872 16:73248838-73248860 TTCCAAAAGACTGAGCAGGATGG + Intergenic
1140494328 16:75370406-75370428 TTTAAAAATAATGTGGAGGGAGG + Intronic
1140595306 16:76402077-76402099 TTCCAAAAAACTGAGGAGGAAGG - Intronic
1140671261 16:77281500-77281522 TGTAAAAATAAAGAGGGGGAAGG - Intronic
1140750638 16:78020213-78020235 TTTAAAAGGATTTAGGAAGATGG + Intergenic
1141061801 16:80880152-80880174 TTTAAATAAAATGAAGAGAATGG - Intergenic
1141258691 16:82430299-82430321 TTCAAAAAAATTCAGGAGGATGG + Intergenic
1142235334 16:88919724-88919746 TCTAAAAAGAAAGACAAGGATGG + Intronic
1202996735 16_KI270728v1_random:119501-119523 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203023422 16_KI270728v1_random:431843-431865 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1142813925 17:2410776-2410798 TTTCAAAAGAAAGAGTAGAATGG - Intronic
1142816367 17:2429152-2429174 TTTAAAAATAATGAGTTGGCTGG - Intronic
1143257334 17:5570697-5570719 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1143915346 17:10288061-10288083 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1144325937 17:14179931-14179953 TTTGAAATGAATGATGAAGATGG + Intronic
1144474810 17:15576819-15576841 TTTGAAATGAATGATGAAGATGG + Intronic
1146068026 17:29652950-29652972 TTTAAATAAAATAAGGAGGCCGG - Intronic
1146206570 17:30910043-30910065 TTTAAAAGGAAACAGGAGGCTGG + Intronic
1146223495 17:31047001-31047023 TTAAAGGAGAATGAGGAGAAGGG + Intergenic
1146341491 17:32022967-32022989 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1146415548 17:32629371-32629393 CTTAAAAAAAATTAGGAGGTTGG + Intronic
1146543080 17:33714595-33714617 TTTAAAAACCATGAACAGGAAGG + Intronic
1146810257 17:35897629-35897651 ACTAAAAAAAATGAGGAGGCCGG + Intergenic
1147043921 17:37739151-37739173 TTCAAAGAGAAGGAGGTGGAAGG + Intronic
1147846175 17:43405282-43405304 TTTAAAAAGAAGGAGCTGGCCGG - Intergenic
1148173846 17:45547563-45547585 TTAAAAGAGAATGAGGAGAAGGG + Intergenic
1148275422 17:46297884-46297906 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148297527 17:46515463-46515485 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148362079 17:47019942-47019964 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1148487286 17:47998684-47998706 TTTAAAAAGAAGGACCAGGCTGG + Intergenic
1149014100 17:51888178-51888200 TTTAAAAAAAAGGAGAAGAAAGG + Intronic
1149114518 17:53076297-53076319 TTCAAAAAAATTGAGGAGAAGGG - Intergenic
1149127932 17:53257854-53257876 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1149505901 17:57193699-57193721 TCTACAAAAAATGAGGTGGAAGG + Intergenic
1149646894 17:58247595-58247617 TTTAAAGAGACTGAGGCAGAAGG + Exonic
1149894212 17:60416495-60416517 ATTAAAAAAAATGTGGTGGAGGG + Intronic
1150000023 17:61429145-61429167 TTTAAAAAGAATGCACAGGTAGG - Intergenic
1150090655 17:62322307-62322329 ATTAAAAAGTTTGAGGAGGAGGG + Intergenic
1150405059 17:64894485-64894507 TTAAAAGAGAATGAGGAGAAGGG + Intronic
1150441510 17:65195270-65195292 TTTAAATAAAATGGGGAGCATGG + Intronic
1150517822 17:65832809-65832831 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1150533468 17:66010993-66011015 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1150940195 17:69684709-69684731 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151172325 17:72257515-72257537 TTCAAAAAGAATGTGATGGATGG + Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1152090631 17:78245105-78245127 ATTAAAAAGAATAAAGAGGCTGG - Intergenic
1152156441 17:78636767-78636789 CTCAAAAAGAATGAGGGGGCTGG + Intergenic
1152356848 17:79811658-79811680 TTTGAAGAGAAGGAGGACGAGGG - Intergenic
1152707298 17:81851224-81851246 TTTAAGAAGTTTGAGGAGGCCGG - Intronic
1152986131 18:322922-322944 TTTAAAAAAAATGAGTATGAAGG + Intronic
1153097986 18:1430950-1430972 TTTAAATAAAATGATGAGGGTGG + Intergenic
1153206689 18:2711178-2711200 TTTAAAAATATTGACGAGGTTGG + Intronic
1153411047 18:4793251-4793273 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1153500996 18:5749965-5749987 TTTAAAAGGAATGGGGGTGATGG + Intergenic
1154229879 18:12546283-12546305 TTTAAAAATAATAACGAGGCTGG - Intronic
1154344383 18:13530250-13530272 TTTTAAAAGTAAGAAGAGGAAGG + Intronic
1155384750 18:25265535-25265557 GTGAGAATGAATGAGGAGGATGG - Intronic
1155463525 18:26110220-26110242 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1155529403 18:26750821-26750843 TTTAAAAGAAATGATGAGGCTGG - Intergenic
1155535723 18:26815221-26815243 TTTCAAAAGATTGAAGAGGACGG - Intergenic
1155831405 18:30519326-30519348 TCTGAACAGAATGAGGAGTAAGG + Intergenic
1156143988 18:34153000-34153022 TTTAAGAAGAAAGAGAAGCATGG + Intronic
1156291096 18:35749065-35749087 CTTAAAAAGTATGGGGCGGATGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156702270 18:39840229-39840251 TTTCAAAATGATGAGGAGGTGGG - Intergenic
1156735273 18:40250030-40250052 AAAAAAAAGAATGATGAGGATGG + Intergenic
1156770829 18:40722033-40722055 TTTCAAAAAATTGATGAGGAGGG + Intergenic
1157208824 18:45723499-45723521 TTTAAAAAGAAGGGGGAAGGAGG + Intergenic
1157455706 18:47827231-47827253 TTTAACAAGAATGCTAAGGATGG - Exonic
1157539615 18:48490894-48490916 TTTCCAGAGAATGTGGAGGAGGG + Intergenic
1157948425 18:52007055-52007077 TGTAAAAAGAATGCGGCAGAGGG - Intergenic
1158063021 18:53369993-53370015 TTTCAAAAAACTGAAGAGGAGGG - Intronic
1158129446 18:54136523-54136545 TGTGAAAACAATGAGGAAGAAGG + Intergenic
1159037790 18:63294370-63294392 TTTAAAAAGAAAAAGTAGGCTGG + Intronic
1159302640 18:66595772-66595794 TTTCAAAAATTTGAGGAGGATGG + Intronic
1159381063 18:67659841-67659863 GTTAAAAACAACTAGGAGGAGGG + Intergenic
1159397412 18:67879957-67879979 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1159439902 18:68464818-68464840 TTTAAAAAAAATTAGAAGGAAGG + Intergenic
1159486176 18:69060426-69060448 TTCCAAAACACTGAGGAGGAAGG - Intergenic
1159504647 18:69319663-69319685 TTCAAAAAAATAGAGGAGGAGGG - Intergenic
1159517846 18:69481004-69481026 TTTAAATAGAATGTGGGAGAAGG - Intronic
1159606758 18:70482451-70482473 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160170015 18:76545005-76545027 TTTAAGAAGAATAAGTAGAAAGG - Intergenic
1160301181 18:77680582-77680604 TTTAAAAAAAAAGAAGAGAATGG + Intergenic
1160434921 18:78842712-78842734 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1160623803 18:80189257-80189279 TTTAAAAAGAAAGAAGAAAACGG - Intronic
1161003394 19:1922529-1922551 ATTAGAAACAATGAGGAGGCCGG - Intronic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161528959 19:4775419-4775441 TTAAAAAAGAAAGAGGAGGCTGG + Intergenic
1161558714 19:4958655-4958677 TTTAAAAAGATCAAGGTGGAAGG - Intronic
1161816534 19:6502699-6502721 TCTAAATAGAATGAGAAGGGGGG - Intronic
1161904223 19:7143122-7143144 TTTAAAAAAAATGATGGTGATGG - Intronic
1162436903 19:10666239-10666261 TTTAAAAAGAAAAAAGAGGCTGG - Intronic
1162873622 19:13604219-13604241 GTTAGAAAGAAAGAGAAGGAAGG + Intronic
1162877099 19:13628435-13628457 TTTAAAAAGAAAGAGAGGAAAGG + Intergenic
1163055499 19:14714642-14714664 TTTAAAAAAAGTGAGGGGAAAGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163815367 19:19461786-19461808 TTTGGAGAGAGTGAGGAGGAGGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164496687 19:28771226-28771248 TTCAAAAAAATTGAGGAGAAGGG - Intergenic
1164523392 19:28995864-28995886 TTAAAAAAAAATGAAGAGGGGGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164801061 19:31077120-31077142 TATAAAAATAATGAGGTGGGTGG - Intergenic
1165238088 19:34439834-34439856 GAAAAAAAGAATGAGAAGGAAGG + Intronic
1165548234 19:36560574-36560596 TTAAAAAAAAATGAGAAGAAAGG - Intronic
1165647099 19:37450183-37450205 TTTCAGAATATTGAGGAGGAGGG - Intronic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
1165880084 19:39036287-39036309 TTTAAAAAGTTTGAGTAGGTTGG + Intergenic
1165949674 19:39467084-39467106 TTTAAAAAGATTGATGAGGCTGG + Intronic
1166176164 19:41072459-41072481 TCCAAAAAAAATGAGCAGGAAGG - Intergenic
1166176614 19:41077049-41077071 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1166403269 19:42500157-42500179 TTTAAAAAAGAAGAGGAGGGAGG - Intergenic
1166725218 19:45022842-45022864 TTTAAAAAGAAAGAAAAGGCCGG - Intronic
1167153948 19:47726672-47726694 TTAAAAAAGAAGGAAGAAGAGGG - Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1167890562 19:52536316-52536338 TTTAAAAAGAACGGGGTGGGTGG - Intronic
1167946514 19:52992999-52993021 TTTAAAAAGCACGGGGTGGAGGG + Intergenic
1167950618 19:53024251-53024273 TTTAAGAAGAAAGAGCAAGATGG - Intergenic
1168555114 19:57331979-57332001 TTTAAAAAGAATAAAGAGTGAGG - Intergenic
925074303 2:1000722-1000744 ATTTTAAAAAATGAGGAGGAAGG + Intronic
925326532 2:3026371-3026393 TTCAGGAAGAATGTGGAGGAGGG + Intergenic
925798984 2:7578011-7578033 TTTAAAAAGCAAGAGAAGAAAGG - Intergenic
926236445 2:11048605-11048627 TATAAAAATAATGAGAGGGAGGG - Intergenic
927129390 2:20045302-20045324 TTTAAAAAGAATGATTAAGCTGG + Intronic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927565448 2:24108399-24108421 TTACAAAAAATTGAGGAGGAGGG + Intronic
927572331 2:24170592-24170614 TTTAAAGAGGATGAGGAATATGG - Intronic
928019472 2:27691074-27691096 TTCCAAAAGAATGAGAAAGAAGG - Intronic
928041249 2:27879946-27879968 TTCCAAAAAACTGAGGAGGAGGG + Intronic
928250010 2:29667821-29667843 TTCAAAAAAATTGAAGAGGAGGG - Intronic
928276140 2:29901869-29901891 TTTACAAAGAATTAGGGGTAGGG + Intronic
928512461 2:32014184-32014206 ATTAAAAAGAATGAAGTGGCTGG + Intronic
928589067 2:32795041-32795063 TTCCAAAAAATTGAGGAGGAAGG + Intronic
928609608 2:32978743-32978765 TTCCAAAAGATAGAGGAGGAGGG - Intronic
928635208 2:33238690-33238712 TCTAAAAAGGATGGAGAGGATGG - Intronic
928658774 2:33479778-33479800 TTTAAAAGGATTCAGGAGGCAGG - Intronic
928680310 2:33694450-33694472 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928734251 2:34267289-34267311 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928834409 2:35525888-35525910 TTCAAAAAAATAGAGGAGGAGGG - Intergenic
929186061 2:39096242-39096264 TTTAGAGGGAATGATGAGGAAGG - Intronic
929237374 2:39620353-39620375 TTTTAAAAGGAAGAGAAGGAAGG - Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929371616 2:41231242-41231264 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
929522209 2:42664088-42664110 TCTAACAAAAATGAGGTGGAAGG - Intronic
929732465 2:44510636-44510658 TTTAAAAAGAATGTAGGCGATGG - Intronic
929752317 2:44728454-44728476 TTCCAAAAAATTGAGGAGGAGGG - Intronic
929844212 2:45504897-45504919 TTTAATAAAAACGAGGAGTAAGG + Intronic
929888453 2:45899350-45899372 TTTAAAAAGACTTGGAAGGAAGG - Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
930188163 2:48430617-48430639 ATTATAAATACTGAGGAGGAAGG + Intergenic
930211113 2:48638186-48638208 TTTCAAAAAATTGAGGAGGAAGG + Intronic
930436415 2:51349421-51349443 TTGAAAAAGAATGAGGTTGGAGG + Intergenic
930508648 2:52316990-52317012 TTTAGAAAGATTGAGGCTGATGG + Intergenic
930529072 2:52569346-52569368 TTTCACAACATTGAGGAGGAGGG - Intergenic
930592073 2:53340015-53340037 TTTTGAGAGAATGAGGAGGATGG - Intergenic
930900347 2:56499116-56499138 TTCGAAAAGATTGAGGAGGAGGG - Intergenic
930905644 2:56563254-56563276 TTTAAAAATAATAAAGATGATGG - Intergenic
931095122 2:58931019-58931041 GTGAAAGAAAATGAGGAGGAGGG - Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931857915 2:66323247-66323269 TTTAAAAAAAATGAAGAGAGGGG + Intergenic
931978553 2:67669730-67669752 TTAAAAAAGAAGGAGAAGCAGGG + Intergenic
932280586 2:70488621-70488643 TTTCAAAAAAATGAGGGGTAGGG - Intronic
932371730 2:71195256-71195278 TTCTAAAAAATTGAGGAGGAGGG - Intronic
932482823 2:72058078-72058100 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
932711578 2:74069084-74069106 TTAAAAAATAATCAGGAAGAAGG - Intronic
932752856 2:74382774-74382796 TTTAAAAAATATGTGGAGGCCGG + Intronic
932977502 2:76621728-76621750 TTCCAAAACATTGAGGAGGAAGG - Intergenic
933025483 2:77252491-77252513 TCTAAAAAGACTTAGGAGGGTGG - Intronic
933118451 2:78503782-78503804 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
933184581 2:79264698-79264720 GATAAAAAGTATGAGGACGAGGG - Intronic
933209416 2:79549849-79549871 TTTTGAAAGAACTAGGAGGAGGG + Intronic
933337006 2:80971430-80971452 TTTAAAGTAATTGAGGAGGAGGG + Intergenic
933619615 2:84523001-84523023 TCTAAAAAAAATGAGGAAGGGGG - Intronic
933638805 2:84737362-84737384 TTCCAAAAAATTGAGGAGGAGGG - Intronic
933842807 2:86301158-86301180 TTCAAAGAGAATGCGGATGAAGG - Intronic
934185966 2:89675836-89675858 TTCCAAAAAAATGAGGACGAAGG - Intergenic
934513046 2:94963454-94963476 ATAAAAAAGGGTGAGGAGGACGG + Intergenic
934884581 2:98013459-98013481 GGTAAAAAGAATGAGGGGGCTGG - Intergenic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935440647 2:103091541-103091563 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
935834977 2:107040652-107040674 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
936102572 2:109595861-109595883 ATTAGACACAATGAGGAGGAGGG + Intronic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
936390899 2:112072313-112072335 TTCCAAAAAATTGAGGAGGAGGG - Intronic
936402834 2:112178458-112178480 TTCCAAAAAACTGAGGAGGATGG + Intronic
936452424 2:112643785-112643807 TTTAAATAGAAATAGGAGGTAGG - Intergenic
936461872 2:112720358-112720380 TTTAAAAAGAAAGACAAGGCTGG - Intergenic
936706687 2:115083561-115083583 TTTCAAAAGAGAGAGAAGGAAGG - Intronic
936763038 2:115809552-115809574 TTTAAAAAGAATGTGAAAGGAGG - Intronic
936821583 2:116528381-116528403 TTTAAAAAGACTAAGGCTGAGGG + Intergenic
936838277 2:116735616-116735638 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
937194885 2:120144637-120144659 TTCAAAAAGATAGAAGAGGAAGG + Intronic
937196126 2:120158203-120158225 TTTCAAAAAATTGAGGAGGAGGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937865191 2:126745675-126745697 TTTAAAAAAATTGAGGTGGCTGG - Intergenic
938325598 2:130397387-130397409 TTTCAAAACAATGAAAAGGAGGG + Intergenic
938423358 2:131162814-131162836 TTTCAAAACAATGAAAAGGAGGG - Intronic
938488224 2:131738268-131738290 GTTAAAAAGAATGACGAGAAAGG - Intronic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939236447 2:139500340-139500362 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
939273910 2:139974974-139974996 TTCCAAAAGATAGAGGAGGAAGG + Intergenic
939315722 2:140547188-140547210 TACAAAAAAATTGAGGAGGAGGG - Intronic
939484280 2:142790438-142790460 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
939564648 2:143772631-143772653 TCTGAAAACAATGAGAAGGAAGG + Intergenic
939585766 2:144003656-144003678 TTGAGAAAGAATGAGGAGAGGGG + Intronic
939684628 2:145183938-145183960 TTTAAAAGGAATGACAAGGTTGG + Intergenic
939698872 2:145363866-145363888 TTTAAAAATAATGAGTAGGCCGG + Intergenic
940182534 2:150951817-150951839 TTTAAAAAGAAGGCTGAGCATGG + Intergenic
940208501 2:151231669-151231691 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940438705 2:153687177-153687199 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
940447225 2:153790039-153790061 TTTCAAAAAATTGATGAGGAGGG + Intergenic
940456640 2:153909964-153909986 TTCCAAAAAAATGAGGAAGAGGG - Intronic
940466061 2:154028461-154028483 TTTAAGTAGAAAGAAGAGGATGG - Intronic
940501395 2:154498280-154498302 TTTAAAAAGAATGATAAAGTTGG + Intergenic
940530633 2:154872608-154872630 TTTCAAATAAATGTGGAGGAGGG - Intergenic
940535253 2:154932993-154933015 TTACAAAAAATTGAGGAGGAGGG - Intergenic
940576101 2:155505998-155506020 CCAAAAAAAAATGAGGAGGAGGG + Intergenic
940625097 2:156165151-156165173 TTAAAAAAGAATAAGGGAGAGGG + Intergenic
940628856 2:156211998-156212020 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
940708224 2:157130236-157130258 TTTTAAAAAATTGAGGAGGAGGG + Intergenic
940880861 2:158945427-158945449 TTTAAAAAGTCAGAGGAGGCTGG - Intergenic
941048943 2:160709348-160709370 TTCCAAAAAAACGAGGAGGAGGG - Intergenic
941221891 2:162792317-162792339 TCCAAAAAAATTGAGGAGGAGGG - Intronic
941329568 2:164163705-164163727 TTTAAAAAAACAGAAGAGGAGGG - Intergenic
941335484 2:164239270-164239292 TTTAAAAAGGATGATCAGGGAGG + Intergenic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
941392392 2:164930357-164930379 TTCCAAAAAATTGAGGAGGAGGG + Intronic
941910596 2:170760822-170760844 CCTAGAAGGAATGAGGAGGATGG + Intergenic
942135967 2:172925919-172925941 GTAAAAAAGAAAGAGGAGGGAGG + Intronic
942538647 2:176992337-176992359 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942679845 2:178465825-178465847 TTTAAGAAGAATGACCATGATGG - Exonic
942759880 2:179385628-179385650 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
942772727 2:179541839-179541861 TTCACAATGAATGAGGTGGAAGG + Intronic
942813990 2:180030048-180030070 TTTTAAAAAACGGAGGAGGAAGG - Intergenic
942819562 2:180096139-180096161 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
942869145 2:180713903-180713925 TTCCAAAAAAATGAGGAAGAGGG + Intergenic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943389024 2:187239367-187239389 TTTAAAGAGAATGAAGGGGGAGG - Intergenic
943554218 2:189382246-189382268 ATTAAAAATATTGAGGTGGAAGG + Intergenic
943607033 2:189987980-189988002 TTTAAAAACAATTAGGTGGATGG + Intronic
943611660 2:190042052-190042074 TTCCAAAAAACTGAGGAGGAGGG - Intronic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
944040961 2:195354495-195354517 TTTAAAAAGAAAGAAGAAAATGG + Intergenic
944150637 2:196554520-196554542 TAATCAAAGAATGAGGAGGATGG + Intronic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944338482 2:198566182-198566204 TTTGAAAAAATTAAGGAGGAGGG - Intronic
944471617 2:200059253-200059275 TTCCAAAATATTGAGGAGGAAGG + Intergenic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944788837 2:203102842-203102864 TTCCAAAAAATTGAGGAGGAAGG - Intronic
944927229 2:204477722-204477744 TTTAGAAAGAGTAGGGAGGAAGG + Intergenic
945031589 2:205669450-205669472 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945277213 2:208000126-208000148 TGTATAAAGTATGAGGAGAAAGG + Intronic
945363609 2:208923884-208923906 TCTCAAAAAATTGAGGAGGAGGG - Intergenic
945404447 2:209427538-209427560 ATTAAAAAGAATGATGTGAAGGG - Intronic
945521192 2:210829502-210829524 TTCCAAAAGACTGAGAAGGAAGG - Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
945877681 2:215295377-215295399 TTTAAAAGGAATAAGGGAGAAGG + Intergenic
945972796 2:216246510-216246532 ATTAAAAACAATGAGTAGGCCGG - Intergenic
946040628 2:216780464-216780486 TTTAAGGGGAAAGAGGAGGAAGG + Intergenic
946103428 2:217348042-217348064 TTCCAAAAAATTGAGGAGGAAGG - Intronic
946564185 2:220944844-220944866 TACAAAAAGATTGAGGAGAATGG - Intergenic
947266440 2:228287455-228287477 TTCAAAAATTTTGAGGAGGAGGG - Intergenic
947281190 2:228457088-228457110 AAAAAAAAAAATGAGGAGGAGGG - Intergenic
947438246 2:230091836-230091858 TTCAAAAACACTGAGGAGGAGGG + Intergenic
947490184 2:230587221-230587243 TTAAAAAAAAATCAGGAGGCCGG + Intergenic
947772983 2:232685652-232685674 TTTAAAAAGAAGGAAGAGAATGG + Intergenic
948294305 2:236849257-236849279 TTTAAAAACAATGATCAGGCCGG + Intergenic
948532740 2:238622194-238622216 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
948737613 2:240019520-240019542 TTTAAAAAGAACGTGGAGGCCGG + Intronic
948746587 2:240099803-240099825 TTTGAAAAGATTGAGAAAGAAGG + Intergenic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
949074005 2:242043732-242043754 TTTAAAATTAATGATGAGTAAGG - Intergenic
1168839679 20:901610-901632 GTTAAAAACAATGAGGTTGATGG + Intronic
1169631324 20:7635643-7635665 TTTAAAAATGAGGAGGAGAATGG - Intergenic
1170382828 20:15780491-15780513 TTTAAAAACAAGGAAGAAGAGGG + Intronic
1170508409 20:17052796-17052818 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1170862374 20:20119154-20119176 TTCAAAAAAATTGAAGAGGAGGG - Intronic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171725326 20:28613668-28613690 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171789527 20:29508156-29508178 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171858007 20:30366292-30366314 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1172042110 20:32052811-32052833 TTAAAAAAGAAAAAGAAGGAAGG + Intronic
1172105433 20:32514556-32514578 TCTTAAAAAAAGGAGGAGGAGGG - Intronic
1172169683 20:32921510-32921532 TTTAAAGAGAAGGAAGAGGCTGG - Intronic
1172243328 20:33428109-33428131 ATTAAAAAGAATGAGGGGCCGGG + Intronic
1173008756 20:39161563-39161585 TTCAAAAAAACTGAAGAGGAAGG - Intergenic
1173402698 20:42739307-42739329 TTTACAGGGAATGAGAAGGAAGG + Intronic
1173541118 20:43852225-43852247 TTTAAAACCATTGAGGAGGCCGG - Intergenic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1174215181 20:48911138-48911160 TTTAAGACAAATGAGGTGGAAGG - Intergenic
1174251521 20:49223346-49223368 CTTCAAGAGAATGATGAGGAAGG + Exonic
1174312397 20:49668040-49668062 TTTAAAGAGAACTGGGAGGAGGG + Intronic
1174908732 20:54582392-54582414 TTCAAAAAAACTGAAGAGGAAGG - Intronic
1174976649 20:55343293-55343315 TTTAAAAAGCATGTGTATGAAGG - Intergenic
1175425281 20:58861037-58861059 TCTAAAAAGAAGAAGGAGCATGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175868381 20:62193941-62193963 TTTAAAACAAATGCGGAGGCTGG + Intronic
1176047466 20:63100372-63100394 TTTTAACAGAATGGGGAGGGTGG + Intergenic
1176260728 20:64178145-64178167 TTTGAAAATAATGAGGATGGGGG - Intronic
1176688528 21:9876681-9876703 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176881459 21:14199706-14199728 TCCAGAAAAAATGAGGAGGAGGG + Intronic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1177022676 21:15882931-15882953 TTTCAAAAGATTGAAAAGGAGGG - Intergenic
1177392386 21:20493155-20493177 TTTAATAACAATGATGAGAATGG + Intergenic
1177896982 21:26865034-26865056 TTTAAAGAGAATAAGTAGGCTGG - Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1178168082 21:30005610-30005632 TTTGAAATAAAAGAGGAGGAAGG - Intergenic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178344335 21:31811984-31812006 TTTAAAAACTATGAGATGGATGG - Intergenic
1178724796 21:35041976-35041998 GTTTAAAAGAGTGAGGAAGATGG + Intronic
1178795386 21:35739244-35739266 TATAAAAGCAATGAGGGGGAAGG + Intronic
1179265012 21:39795544-39795566 TCTAGTATGAATGAGGAGGAAGG + Intronic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1179514457 21:41897266-41897288 TTCAGAAGGAATGAGGAGGGCGG + Intronic
1180112265 21:45665726-45665748 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1180206159 21:46262260-46262282 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1180457681 22:15525259-15525281 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1180542805 22:16467248-16467270 TCTGAAAAAAATGAGGAGGAAGG + Intergenic
1180572743 22:16743793-16743815 TTTCAAGAAACTGAGGAGGAGGG + Intergenic
1180690092 22:17706733-17706755 TGAAAAGAGAATGAGGAGGGAGG - Intronic
1180728714 22:17965111-17965133 TTTAAATAGAAGGGGAAGGAGGG - Intronic
1180735532 22:18013792-18013814 TTTAAAAAAATAGAGGGGGAGGG - Intronic
1181122262 22:20679041-20679063 TTTGAAAAGAAGGAAAAGGACGG - Intergenic
1182092365 22:27604523-27604545 TTTCAAAAGAATGGGGATAAGGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1183099707 22:35576364-35576386 TTTTATAATAATGAGGAAGAAGG + Intergenic
1184001453 22:41677226-41677248 GTTAATAAGAATGATGAGGCTGG + Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184436600 22:44482389-44482411 TTTAAAAACAATTAAGAGGCTGG - Intergenic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1184619829 22:45668565-45668587 TTTAAATAGATTGATCAGGAAGG + Intergenic
1185243854 22:49762684-49762706 TTTAAAAACAGTGAGGTGGCTGG + Intergenic
1185311866 22:50160546-50160568 TTCAAAAAGAAACAGGAGGCCGG - Intronic
949561545 3:5207326-5207348 TTAAAAAAGAAAGAAAAGGAGGG - Intronic
949601503 3:5603538-5603560 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
949629666 3:5910607-5910629 TTCAAAAAAATTGAGGAAGAAGG - Intergenic
949661767 3:6287228-6287250 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
950942733 3:16910251-16910273 TTTAAAAAAAAACAGGAGCAAGG - Intronic
951296955 3:20949163-20949185 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
951309179 3:21103046-21103068 TTCCAAAATATTGAGGAGGAAGG - Intergenic
951661255 3:25069056-25069078 TTTAAAAACCATGATGAGTATGG - Intergenic
951685563 3:25340145-25340167 TTCAAGAAGAATGAGGAGTTTGG + Intronic
951782036 3:26374400-26374422 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
951828940 3:26901954-26901976 TTTCAAAACATTGAGGAGAAGGG + Intergenic
952277857 3:31894936-31894958 TCTAAAAAGCAAGTGGAGGAGGG - Intronic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
952401576 3:32968316-32968338 TGTCAAAAGAATAAGGAGAATGG + Intergenic
952572063 3:34729714-34729736 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
953035368 3:39206326-39206348 GTAAAGAGGAATGAGGAGGAGGG + Intergenic
953225123 3:41011590-41011612 TTTAAAATTATTGAGGAAGATGG + Intergenic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953672110 3:44971967-44971989 TCTTAAAAGAATGAGGTGGGAGG - Intronic
953741022 3:45539332-45539354 TTAAAAAAGAAAGAGAAGGCTGG + Intronic
954090209 3:48278268-48278290 TTTAAAAAGTTTGAAGAGAAAGG + Intronic
954561848 3:51563337-51563359 TTTAAAAAGGAGGAAGAAGATGG - Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955578372 3:60391376-60391398 TTTAAAAACATTGATGAAGAAGG - Intronic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
955806511 3:62741230-62741252 TTCCAAAAAATTGAGGAGGAGGG + Intronic
955809699 3:62774453-62774475 ATTAAAAAGTATGAGAATGATGG - Intronic
955886428 3:63603886-63603908 TTTCAAAAAATTGAGGAGGAAGG - Intronic
956073416 3:65479070-65479092 TTCAAATGTAATGAGGAGGAAGG - Intronic
956112532 3:65883987-65884009 TTTAAAAAAAATCAGAAAGAAGG + Intronic
956153000 3:66263542-66263564 ATTTAAAAGAATGAGTAGAATGG + Intronic
956185450 3:66558106-66558128 TTTAAAGACAAAGAGGAAGACGG + Intergenic
956478504 3:69649077-69649099 TTTGAAAGGAATGAGTAGGCAGG + Intergenic
956621735 3:71227713-71227735 TTTAAAAACATTGAGCATGATGG - Intronic
957277223 3:78106335-78106357 ATTAAACAGAATAAGGAGCATGG + Intergenic
957449102 3:80352975-80352997 TTTATAAAGACTGAAGAGAAAGG - Intergenic
957638469 3:82817287-82817309 TTTAAAAAGAGAGAGAATGAAGG + Intergenic
957642232 3:82869992-82870014 TTTAAAAACATTGAGAAGGCCGG + Intergenic
957881736 3:86223669-86223691 TCTAAAAAAACTGAAGAGGAGGG + Intergenic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
957977393 3:87464618-87464640 TTCCAAAAGATTAAGGAGGAGGG + Intergenic
958608323 3:96389642-96389664 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
958825883 3:99030422-99030444 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
958960023 3:100500795-100500817 TTTAAAAAAAATGACCAGCAAGG + Intronic
959034657 3:101346937-101346959 GTTTAAAAAAAGGAGGAGGAGGG + Intronic
959246094 3:103870240-103870262 TTTAAAACTAATGAGAAAGAGGG + Intergenic
959330669 3:105000728-105000750 TGCAAAAAAATTGAGGAGGAGGG + Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
959660451 3:108862541-108862563 TTTAAAAACACTGAGGTGGCCGG - Intergenic
959663248 3:108892699-108892721 TCTAAATAAAATCAGGAGGAAGG - Intergenic
959679951 3:109083618-109083640 TTCAAAAAAACTGAAGAGGAAGG + Intronic
959821879 3:110745042-110745064 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
959861383 3:111219257-111219279 TTTAAAAATTAAGAGGAGGCAGG + Intronic
959878072 3:111410062-111410084 TTTCAAAAGAAAGAGAAAGAAGG + Intronic
959881740 3:111451291-111451313 TTTCAAAAACTTGAGGAGGAGGG + Intronic
959977910 3:112482795-112482817 TTTCAAAAAAATGAAGAGAAAGG + Intronic
960012910 3:112852793-112852815 TTCTAAAACATTGAGGAGGAGGG + Intergenic
960490315 3:118309630-118309652 TTAAAAAAGAATGAGAACAATGG + Intergenic
960645186 3:119872532-119872554 TTTGACAGAAATGAGGAGGATGG + Intronic
960685967 3:120293950-120293972 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
960939969 3:122927182-122927204 TTAAAAAAGAAAGAGAGGGAGGG - Intronic
960960346 3:123066622-123066644 GTTAAATAGAATAAGCAGGAGGG + Intergenic
961106918 3:124250172-124250194 CTTAAGGAGAAAGAGGAGGAGGG + Intronic
961146034 3:124593987-124594009 TTTAAGAGTAATGAGGAGGCCGG - Intronic
961417484 3:126770862-126770884 TTTCAAAAAATTGAGGAGGAGGG - Intronic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
962092393 3:132258225-132258247 TTTAAAATGTATGAGAAGAAAGG + Intronic
962323206 3:134407956-134407978 TTTAAAAAAAACAAGGAGGCAGG - Intergenic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962464582 3:135645682-135645704 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
962795184 3:138843882-138843904 TTTAAAAAGAATAAGGCGGCTGG + Intergenic
962822263 3:139061271-139061293 TTTAAAAAGAATGACAAAGTTGG - Intronic
962832156 3:139153171-139153193 TTCCAAAAAATTGAGGAGGAGGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962911238 3:139852391-139852413 TTCAAATAAATTGAGGAGGAGGG - Intergenic
962972286 3:140413505-140413527 TTTCAAAACACTGAAGAGGAGGG + Intronic
963371808 3:144410926-144410948 TTTAATAAGAACGATGAGAAGGG + Intergenic
963420819 3:145058994-145059016 TTTTAAAAGACTGAGGAAGAGGG + Intergenic
963516900 3:146320306-146320328 TTTCAAAAAGTTGAGGAGGAGGG + Intergenic
963532878 3:146493251-146493273 TTGCAAAAAATTGAGGAGGAGGG + Intronic
963559309 3:146841878-146841900 GTTAAAATGAATCAGGAGCAGGG + Intergenic
963621498 3:147612982-147613004 TTTCAATAGAATGAGGACAATGG + Intergenic
963632371 3:147749281-147749303 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
964057665 3:152481152-152481174 TTCCAAAACATTGAGGAGGAGGG - Intergenic
964656379 3:159071442-159071464 TTTAAATTGAATGAATAGGATGG + Intronic
964828806 3:160860232-160860254 TTTAAAAATGATTTGGAGGAAGG - Intronic
964857436 3:161162027-161162049 ATTAAAAAGAATGAAGGGAAGGG + Intronic
965106053 3:164355582-164355604 TTCAAAAACAAAGAGGATGAAGG + Intergenic
965293532 3:166914736-166914758 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
965294004 3:166919486-166919508 TTGCAAAAAATTGAGGAGGAAGG + Intergenic
965325335 3:167295886-167295908 TTCCAAAAGATTGAAGAGGAGGG + Intronic
965476465 3:169161717-169161739 GATAAACAGAATGAGGAGAAAGG + Intronic
965606545 3:170503157-170503179 TTTACAAAGCAAGGGGAGGAGGG - Intronic
965649774 3:170921578-170921600 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
965730740 3:171769771-171769793 TTAAAAAAAATTGAGGGGGAAGG - Intronic
965748195 3:171947496-171947518 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
965956081 3:174371452-174371474 GTTCAAAAAAATGAAGAGGAAGG + Intergenic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966081052 3:176001475-176001497 TTTATATAAAATGAGGAGTATGG + Intergenic
966102559 3:176289678-176289700 TTTAAAAAAAATATTGAGGATGG - Intergenic
966451799 3:180071802-180071824 TTTAAAAACAAAGAGTATGAGGG + Intergenic
966499470 3:180622955-180622977 TTCCAAAATATTGAGGAGGAGGG - Intronic
966644204 3:182225012-182225034 TTCCAAAACACTGAGGAGGAGGG - Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
967006234 3:185385525-185385547 TCCAAAAAAAATGAAGAGGAGGG + Intronic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
967368564 3:188716420-188716442 AAAAAAAACAATGAGGAGGATGG + Intronic
967373108 3:188771250-188771272 TTTAAAAAGAAAAAAGAGGCCGG + Intronic
967575115 3:191080493-191080515 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
968193926 3:196691387-196691409 GATAAAAAGAATAAGGAGGTGGG - Intronic
968349806 3:198044792-198044814 TTTAAAATGAATTAGGGAGATGG + Intergenic
969162931 4:5277385-5277407 TTTAAAAAGAATGAATTGGCTGG - Intronic
969839946 4:9873929-9873951 TTTAAAAAGTCTGCAGAGGAGGG - Intronic
969843133 4:9898316-9898338 TTTAAAAAGGAAGAGCTGGAGGG + Intronic
970209702 4:13696598-13696620 TTTTGAAGGAAGGAGGAGGATGG + Intergenic
970210106 4:13700900-13700922 TTCCAAAAAACTGAGGAGGAAGG - Intergenic
970229310 4:13892222-13892244 TTTGAAGAGTATGTGGAGGAGGG + Intergenic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970668748 4:18371082-18371104 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
970879225 4:20908389-20908411 TTCAAAAAGACTGACGAGGCCGG - Intronic
971402499 4:26289094-26289116 TTAAGAAAGAAAGAGGAGTAGGG + Intronic
971638746 4:29100792-29100814 TTTGAAAAGAAGCAGGAGAAAGG + Intergenic
971729406 4:30358033-30358055 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971938486 4:33185547-33185569 TTTAAAAAAAATTAGGACCAGGG + Intergenic
972121330 4:35708140-35708162 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972872347 4:43314956-43314978 GTAAAAAAGAATTAGGAGGTGGG + Intergenic
972971911 4:44586856-44586878 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
973078875 4:45964731-45964753 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
973105127 4:46326157-46326179 TTACAAAAGAATGGGGAGGGTGG + Intronic
973145799 4:46824273-46824295 TTCCAAAAAACTGAGGAGGAGGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973803289 4:54499422-54499444 ATTAACTAGAAGGAGGAGGAGGG - Intergenic
973877664 4:55236431-55236453 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974108538 4:57499538-57499560 TTTAAAAAGACTGGGGAGCGGGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974297191 4:60016059-60016081 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974501890 4:62715636-62715658 TTTCAAAAAATTGAAGAGGACGG - Intergenic
974640821 4:64627908-64627930 CTTGAAAAGATTGAGGGGGAGGG - Intergenic
974846542 4:67357711-67357733 TTTAAAAAGCATGAGGTTGGAGG - Intergenic
974889670 4:67865951-67865973 TTCCAAAATATTGAGGAGGAGGG + Intronic
975001336 4:69226168-69226190 TTTCAACAAATTGAGGAGGAGGG + Intergenic
975004107 4:69266068-69266090 TTTCAACAAATTGAGGAGGAGGG - Intergenic
975012509 4:69375081-69375103 TTTCAACAAATTGAGGAGGAGGG - Intronic
975158616 4:71100059-71100081 TTCCAAAAAATTGAGGAGGATGG + Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975792204 4:77966043-77966065 TTTAAATATAAAGAGGAGGTAGG - Intergenic
975793246 4:77978367-77978389 CTTAAAAAAATTGAAGAGGAAGG + Intergenic
975918322 4:79351710-79351732 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
975931640 4:79531194-79531216 TTTAAAAAGATAGGAGAGGAAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
975992595 4:80273702-80273724 TTTAAAAAGGAAAAGAAGGAAGG - Intronic
976009242 4:80467492-80467514 TTTGAAAAGATTGAGGAGGCGGG - Intronic
976025024 4:80676491-80676513 TTCAAAAAAATTGAAGAGGAGGG - Intronic
976249524 4:83035673-83035695 ATCAAAAAAAAAGAGGAGGAAGG - Intronic
976368781 4:84262656-84262678 TTACAAAAGATTGAGGAGGAGGG + Intergenic
976699159 4:87950440-87950462 TTTAAAAAGGGTCAGGGGGAAGG + Intergenic
976872531 4:89812763-89812785 TATAAAAAGAAAGAGGGAGAAGG + Intronic
977001782 4:91513497-91513519 TTCAAAAAAACTGATGAGGAGGG - Intronic
977005657 4:91566423-91566445 TTCCAAAAAATTGAGGAGGAGGG - Intronic
977028509 4:91852072-91852094 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
977051516 4:92133860-92133882 GAAAAAAAAAATGAGGAGGAGGG + Intergenic
977225850 4:94390892-94390914 TATAAAAAAAATGAGTAGTAGGG + Intergenic
977345140 4:95808081-95808103 TTTAAAAAGAATTAGAAACAAGG + Intergenic
977436441 4:97001688-97001710 TTAAAGAGGAATTAGGAGGATGG + Intergenic
977508419 4:97931776-97931798 TTAAAAAAAATTGAGGAGAAGGG - Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978029959 4:103929124-103929146 TACAAAAAAATTGAGGAGGAGGG + Intergenic
978320370 4:107487021-107487043 TTTAAAAATTTTGAGGAAGAAGG + Intergenic
978354551 4:107857901-107857923 TTTAAAAAGAATGGAAAGCACGG - Intronic
978360240 4:107923883-107923905 ATTAAAAAGGATGAGGCTGATGG + Intergenic
978389116 4:108206075-108206097 TTTAAAAAGAAAGTGGAAGAGGG - Intergenic
978749169 4:112227831-112227853 TTTGAAAAGGATGGGGAAGAAGG + Intergenic
978952594 4:114579109-114579131 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
979178532 4:117695793-117695815 TTCAAAAAAATTGAGGAGAAGGG + Intergenic
979289678 4:118965928-118965950 TTTAAAAAAAATTAGCTGGATGG + Intronic
979471029 4:121096809-121096831 TTTCAAAAGAACGAGGGTGATGG - Intergenic
979629967 4:122889578-122889600 TTTTAAAAAAATGAGTAGTAGGG - Intronic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
979796783 4:124855976-124855998 TTTAAAATGAATGATGAGAGTGG + Intergenic
979857002 4:125646223-125646245 TTTAAAAACAATAAGGGGGCAGG + Intergenic
979874310 4:125868168-125868190 TCCAAAAAAACTGAGGAGGAAGG + Intergenic
980307899 4:131088286-131088308 TTAAATAAGAATGTGGGGGATGG - Intergenic
980319161 4:131245622-131245644 TTTAAAAAGCATGTGGAAGGAGG - Intergenic
980351913 4:131694480-131694502 TCTAAAATAATTGAGGAGGAGGG - Intergenic
980547741 4:134290811-134290833 TGTTAAAAAAATGTGGAGGATGG - Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980573791 4:134659369-134659391 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
980713121 4:136596261-136596283 TTTCAAAAAATTGAGGAAGAAGG - Intergenic
980815219 4:137938540-137938562 TTTCAAAAAAGTGAAGAGGAAGG + Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
980912567 4:139006894-139006916 TCTCAAAAAAAGGAGGAGGATGG - Intergenic
981011100 4:139925922-139925944 TGCAAGAAGAAAGAGGAGGACGG + Intronic
981067058 4:140496956-140496978 TTTATAGAAAATGAAGAGGAGGG + Intronic
981275654 4:142895976-142895998 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
981363902 4:143879002-143879024 TATAAAAATAATGAGAAGAAAGG + Intronic
981384959 4:144119079-144119101 TTTAAAAATAAGGAGAAGAAAGG + Intronic
981413913 4:144465449-144465471 ATTACAAAGAATGAGAAGCAAGG + Intergenic
981756297 4:148144563-148144585 TTTAAAAAGAAGTAGGGGAAAGG + Intronic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
981959459 4:150518615-150518637 TTTAAGGACAATGAGAAGGAAGG - Intronic
982213821 4:153063206-153063228 TTTAAAAAAAAGGTGGAGGGGGG + Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982879275 4:160690588-160690610 TTTCAAAAAATTGAAGAGGAAGG + Intergenic
982939634 4:161533680-161533702 TTCAAAAAAATTGAGGAGGAGGG + Intronic
982955162 4:161755607-161755629 TTTATAAAGTATGTGGAGGAAGG + Intronic
983010993 4:162546952-162546974 TCTTAAAAAATTGAGGAGGAGGG - Intergenic
983300674 4:165921478-165921500 TTAAGAAAGAAAGAGAAGGAAGG - Intronic
983329069 4:166301322-166301344 TTTAAAAGGAATGAGTAGGGGGG + Intergenic
983473842 4:168190767-168190789 TTCCAAAAGACTGAAGAGGAGGG + Intergenic
983575258 4:169254694-169254716 TGTAAAAACAAGGAGCAGGAGGG + Intronic
983876766 4:172886078-172886100 TTTCAAAAAATTGAAGAGGAGGG - Intronic
985435253 4:189924103-189924125 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
985831309 5:2234141-2234163 TTCCAAAAAATTGAGGAGGATGG - Intergenic
986046959 5:4048081-4048103 TTTAAAAAGAAAGAGTTGCATGG + Intergenic
986227663 5:5831373-5831395 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
986276657 5:6281223-6281245 GTTAAATAGAAGGAGGAGAAAGG - Intergenic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
986734347 5:10657038-10657060 TTTAAGAAGTTTGAGGAGGTAGG + Intergenic
986979523 5:13431015-13431037 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987380942 5:17285438-17285460 GTTAATGAGAATGTGGAGGAAGG + Intergenic
987583798 5:19828323-19828345 TTTCAAAAAATTGAGAAGGATGG + Intronic
987862040 5:23501257-23501279 TTCAAAAATATTGAAGAGGAGGG - Intergenic
988048800 5:25996521-25996543 TATACAAATGATGAGGAGGAGGG + Intergenic
988306026 5:29495251-29495273 TTTCAAAAAAGTGAGGAGAAGGG - Intergenic
988348919 5:30075257-30075279 ACAAAAAAAAATGAGGAGGAGGG + Intergenic
988651349 5:33155117-33155139 ATTCAAAAAATTGAGGAGGAGGG + Intergenic
988865315 5:35327956-35327978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
988870895 5:35388371-35388393 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
988961479 5:36375653-36375675 GTTAAAAAGAATTAGGAGGCCGG + Intergenic
988972095 5:36478944-36478966 TTTAGAAAGAAGGAAAAGGAAGG - Intergenic
989079710 5:37605012-37605034 TTTAAAAAAAAAAAGAAGGAGGG - Intronic
989232159 5:39099107-39099129 TTTAAAATGACTGAGTGGGAGGG + Intergenic
989299466 5:39872356-39872378 TTGCAAAAAATTGAGGAGGAAGG - Intergenic
989365889 5:40654648-40654670 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
989555176 5:42786147-42786169 TTCCAAAAAATTGAGGAGGAGGG - Intronic
989757963 5:44979006-44979028 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
989783041 5:45292820-45292842 TTTATAAAGAATGAGTAGATGGG - Intronic
989970379 5:50517266-50517288 TCTGAAAAGAAAGAGGAGGAAGG - Intergenic
990132388 5:52602450-52602472 TTTAAAAACAATGAGAAGAATGG + Intergenic
990167825 5:53014633-53014655 TTCCAAAAAATTGAGGAGGAGGG - Intronic
990215299 5:53524921-53524943 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
990327664 5:54694234-54694256 TTTGAAAACAATCAGGAGGGAGG + Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990697207 5:58433547-58433569 TGTAAACAGAAGGGGGAGGAAGG - Intergenic
990722172 5:58708923-58708945 TTTAAGAAGAAAGACGAGGTAGG - Intronic
990736300 5:58866973-58866995 TTTCAAAATAAAGAGAAGGAAGG + Intergenic
990898033 5:60720160-60720182 TTCAAAAAAATTGAGGAGGAAGG + Intergenic
991027706 5:62048568-62048590 TTTCAAACAATTGAGGAGGAGGG - Intergenic
991041298 5:62178420-62178442 TTAAAAAAGAAGGAGGAGCCAGG + Intergenic
991174491 5:63670870-63670892 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
991238079 5:64422456-64422478 GTTCCAAAAAATGAGGAGGAGGG + Intergenic
991382228 5:66041598-66041620 TTTGACAAGAATGAGAAGCATGG + Intronic
991504666 5:67311911-67311933 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
991631283 5:68658579-68658601 TTTGAAAAGAAGTTGGAGGAGGG - Intergenic
991689269 5:69210829-69210851 TCTAAAAAGAATGTTGAGGCCGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992032533 5:72736809-72736831 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
992453228 5:76892013-76892035 TTCAGAATGAAGGAGGAGGAAGG + Intronic
993018978 5:82567924-82567946 TTCCAAGAAAATGAGGAGGAGGG + Intergenic
993135916 5:83963954-83963976 TCTAAAATGGTTGAGGAGGAAGG + Intronic
993520276 5:88891066-88891088 TTAACAAAGAATGAGGAGCATGG + Intronic
993692090 5:91014410-91014432 TTCAAAAAAATTGAGGAGGAAGG - Intronic
993785859 5:92134679-92134701 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
993797321 5:92283620-92283642 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
993906504 5:93629845-93629867 TTTAACAAGAAAAAGGAGTATGG + Intronic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
993944294 5:94099084-94099106 TTCCAAAAAATTGAGGAGGAAGG + Intronic
994119657 5:96099863-96099885 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994134499 5:96269857-96269879 TTTAAAAAAATTGAGAAGGAGGG + Intergenic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994236906 5:97373497-97373519 TTTCAAAAATTTGAGGAGGAGGG + Intergenic
994262391 5:97675243-97675265 TTTCAAAAAAATGAGGAGAAGGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994409011 5:99382668-99382690 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
994591342 5:101777082-101777104 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
994603619 5:101939677-101939699 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994654330 5:102571217-102571239 TTCAAAAATATTGAAGAGGAGGG + Intergenic
994899327 5:105749806-105749828 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
995041766 5:107596014-107596036 TTTGACAAGAAATAGGAGGAAGG - Intronic
995099546 5:108282129-108282151 TTTCAAAAAATTGAGGAGGATGG + Intronic
995278260 5:110303359-110303381 TTCAAAAATATAGAGGAGGAGGG - Intronic
995325906 5:110889574-110889596 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996046250 5:118876833-118876855 TTCCAAAAGATTGAGGAGGAGGG + Intronic
996071916 5:119140712-119140734 TTCCAAAAAATTGAGGAGGAGGG + Intronic
996426914 5:123322865-123322887 TTCCAAAATATTGAGGAGGAGGG - Intergenic
996615309 5:125434373-125434395 CTTAAAAAAAAAGTGGAGGAGGG + Intergenic
996631092 5:125633598-125633620 TTTAAAAAGAAAAAGAAAGAAGG + Intergenic
996752101 5:126899188-126899210 TCCATGAAGAATGAGGAGGACGG + Intronic
996930907 5:128885669-128885691 TTTAAAATGAAGGAGCAGGCAGG + Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997192489 5:131950641-131950663 TTTAAAATGAATGTGAAGAATGG - Exonic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997281488 5:132650464-132650486 TTTAAAAAAAATGAGGGACAAGG + Intergenic
997909555 5:137856749-137856771 TTTAAAAAAAAAGCGGGGGAGGG + Intergenic
998275578 5:140749956-140749978 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
998589365 5:143461125-143461147 TTAAAAAAAAATTAGGAAGATGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998814797 5:146002455-146002477 TTAAAAAAGAAAGAAAAGGAAGG + Intronic
998831483 5:146164309-146164331 TTTAAAAAGAATGGGTTTGAAGG - Exonic
998831708 5:146166684-146166706 TGTAAAAAGAAAGAGGAAAATGG + Intronic
999434884 5:151555761-151555783 TTTTAAAAGTATCAGGAGGGGGG - Intronic
999652365 5:153779915-153779937 ATTAAAGAGAGAGAGGAGGAAGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000237331 5:159374242-159374264 TAAAAAAAAATTGAGGAGGAAGG - Intergenic
1000466933 5:161590923-161590945 TTCAAAAAAATTGAGGAGGGGGG - Intronic
1001375818 5:171257029-171257051 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1001834351 5:174819244-174819266 TTTAAAAATATTAAGGGGGAGGG + Intergenic
1001840563 5:174873026-174873048 CTTAAAATGCATGAGGGGGAGGG - Intergenic
1002309249 5:178304728-178304750 TGGAAAAACAATGAGGGGGAGGG + Intronic
1003071901 6:2951441-2951463 TTTAAAAAAAATTAGGTGGTGGG + Intronic
1003137194 6:3442797-3442819 TTTAAATAAAGTGGGGAGGAGGG - Intronic
1003143746 6:3492783-3492805 TTTATAATGAAAGAGCAGGATGG + Intergenic
1003639587 6:7865412-7865434 TTTGAAGAGAATGAGAAGGAGGG - Intronic
1004076618 6:12349718-12349740 TTTAAAAAGAATGAAGGGCAAGG - Intergenic
1004201785 6:13555271-13555293 TTTAAAAAGACTGGAGAGGAAGG + Intergenic
1004231519 6:13837949-13837971 TTTAAAGAAAATGATAAGGAAGG - Intergenic
1004599667 6:17136152-17136174 TCCAAAAAAAATGAGGAGGAGGG + Intergenic
1004634372 6:17452934-17452956 TTTTAAAAAAAAGTGGAGGAGGG + Intronic
1004817680 6:19330529-19330551 TTTAAAAAGAATAGGTAGGTAGG - Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005010428 6:21330507-21330529 TTTAAAAACAATGACTAGGCCGG - Intergenic
1005097090 6:22128849-22128871 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1005250476 6:23940521-23940543 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1005435433 6:25805983-25806005 TTCCAAAAGATTGAGGAAGAGGG + Intronic
1005581500 6:27239328-27239350 TTTTAAAAAATTGGGGAGGACGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1005766747 6:29018452-29018474 TTAAAAAAAATTGAAGAGGAGGG - Intergenic
1005880359 6:30053422-30053444 TTAAAAAAAACTGAAGAGGAAGG + Intergenic
1005912743 6:30325867-30325889 TGTGAAAAGGCTGAGGAGGAGGG - Intergenic
1005913862 6:30334835-30334857 CTCAAAAAGAATCAAGAGGATGG - Intronic
1006205840 6:32342000-32342022 TGTGACAGGAATGAGGAGGAGGG - Intronic
1006249389 6:32768121-32768143 TTTAAAAAGAAAGAGTAAGCAGG + Intergenic
1006710851 6:36069280-36069302 TCTAAAAATAATGAACAGGATGG - Intronic
1007004425 6:38347067-38347089 TTTAAAAAGAAAGAACAGGAGGG - Intronic
1007874613 6:45082246-45082268 TTCCAAAAAAATGAGGAAGAGGG + Intronic
1007907798 6:45480733-45480755 TTTTAAAGGAATGAAGAAGAAGG - Intronic
1008119469 6:47595402-47595424 TTTAAAAAGCATGATGGTGAAGG - Intronic
1008173544 6:48237993-48238015 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1008185412 6:48383901-48383923 TTACAAAAGATTGAGAAGGAAGG - Intergenic
1008215854 6:48787563-48787585 ATTAAAAAGAATGAGCAATAGGG + Intergenic
1008332122 6:50258025-50258047 TTTCAAAAAATTAAGGAGGAGGG - Intergenic
1008380983 6:50839802-50839824 TTTAAAAAGAAAGAGGAATCTGG + Intronic
1008702387 6:54116700-54116722 TTCAAAAATATTAAGGAGGAAGG + Intronic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008859489 6:56132411-56132433 ATTATAAAGAATAATGAGGAAGG + Intronic
1009527504 6:64765030-64765052 TTTAAAAAGAAGGAAGGGGCAGG - Intronic
1009531188 6:64818149-64818171 TTTGATAAGACTTAGGAGGATGG - Intronic
1009553567 6:65132168-65132190 GTTCAAAATATTGAGGAGGAGGG + Intronic
1009580153 6:65523509-65523531 GTTATGAAGAATGAGGAGGTGGG + Intronic
1009599394 6:65778905-65778927 ATTAAGCAGAATGAGGAAGATGG - Intergenic
1010019882 6:71146895-71146917 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010023098 6:71184142-71184164 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010050588 6:71499252-71499274 TTTAAAAAGCATGAGATGAAAGG - Intergenic
1010318899 6:74484112-74484134 TTTCAAAAGATAGAGGAAGAGGG - Intergenic
1010363337 6:75020521-75020543 ATTCAAAACATTGAGGAGGAGGG - Intergenic
1010447262 6:75962226-75962248 ACTCAAGAGAATGAGGAGGAAGG - Intronic
1010485584 6:76408787-76408809 ATCAAAAAGAATGAAGCGGAAGG - Intergenic
1010544059 6:77127988-77128010 TCCAAAAAAAATGAAGAGGAAGG + Intergenic
1010638372 6:78288416-78288438 TTTAAAAAAACTGAAGAGGAGGG - Intergenic
1010779763 6:79932242-79932264 TTTATAAAAAATGAGGGGGCCGG + Intronic
1010906583 6:81499016-81499038 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1010966305 6:82213323-82213345 TTTAAAAATAATGAAGGGGCCGG - Intronic
1011017769 6:82777671-82777693 TTTAAAAAGAGAGGGAAGGAGGG + Intergenic
1011032620 6:82940148-82940170 TCTAGAGAGAATGTGGAGGATGG - Intronic
1011123143 6:83977088-83977110 TTTAAAGAGAGTGAGGGGGTGGG - Intergenic
1011232261 6:85175696-85175718 TTTCAAAAAACAGAGGAGGAAGG - Intergenic
1011562876 6:88640666-88640688 TTAAAAAAGAATGAGGATTGAGG + Intronic
1011664380 6:89620767-89620789 TTTAAAAATAAAGACGAGGCCGG + Intronic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1011922983 6:92605493-92605515 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1011928265 6:92675258-92675280 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1012116374 6:95303494-95303516 TTTAAAAAGATTTGGGAGGCCGG - Intergenic
1012136395 6:95562362-95562384 TCTAAAAAGAATTAAAAGGAGGG + Intergenic
1012192616 6:96299325-96299347 TTTCAAAAGAATTAGGATGTGGG - Intergenic
1012337709 6:98081641-98081663 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1012345142 6:98176460-98176482 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1012383733 6:98652666-98652688 TTTAAAAAAAAAAAAGAGGAAGG + Intergenic
1012649113 6:101730872-101730894 TTTAAAAAGAGTGAAGAGAGAGG + Intronic
1012694957 6:102367938-102367960 CTTAAAAACAATCAGAAGGAAGG - Intergenic
1012743885 6:103057795-103057817 TTTCAAAAAATTGAGGAAGATGG - Intergenic
1012765316 6:103359964-103359986 TTCAAAAAAAATCAAGAGGAAGG + Intergenic
1012845671 6:104385022-104385044 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1012845987 6:104389368-104389390 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1013026091 6:106273373-106273395 CTTAAAAAGACCGAGAAGGAGGG + Intronic
1013210565 6:107983197-107983219 TTAAAAAAGAATCAGGAGCGAGG + Intergenic
1013393419 6:109710489-109710511 TCCAAAAAAACTGAGGAGGAGGG - Intronic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013738222 6:113252192-113252214 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1013876878 6:114842322-114842344 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1013968929 6:115991805-115991827 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1014158975 6:118144926-118144948 ATTAAAAATAAAGAGAAGGAAGG - Intronic
1014217008 6:118762099-118762121 TTTAAAAAAAAAAAGGAGGGGGG - Intergenic
1014364826 6:120526074-120526096 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1014397274 6:120940401-120940423 AATAAAGAGAATGAGGAAGAGGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014566831 6:122959529-122959551 TTTCAAAAGACAGAGAAGGAGGG + Intergenic
1015488283 6:133796699-133796721 TTTCAAAAAATTGAGGAGAAGGG - Intergenic
1015793919 6:136991745-136991767 TTTAAAGAGAAGGCAGAGGAAGG - Intergenic
1015831078 6:137369601-137369623 TCAAAAAGGAATGGGGAGGATGG + Intergenic
1016087513 6:139932582-139932604 TTAAAAAAAAATGAGGAAGGTGG - Intergenic
1016142499 6:140629627-140629649 CTTAAAAACAATTAGGAGGCCGG - Intergenic
1016793626 6:148094026-148094048 TTCAAAAAAATTGAGGAGAATGG + Intergenic
1017297646 6:152817474-152817496 TTTGAGAAGACTGAGGGGGAAGG + Intergenic
1017305330 6:152911722-152911744 TTCAAAAAAATTGAGAAGGAGGG - Intergenic
1017601598 6:156089142-156089164 TTCCAAAATATTGAGGAGGAGGG + Intergenic
1017674800 6:156801493-156801515 TTCAAAAACAATGATGAGGCCGG - Intronic
1017966679 6:159272867-159272889 TTTAAAAATAATCAGAATGAGGG - Intergenic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1018306713 6:162464895-162464917 TTTATTAAGAAGGAGGAGGGGGG - Intronic
1018316998 6:162566740-162566762 TTCCAAAAGACAGAGGAGGAGGG + Intronic
1018454998 6:163943940-163943962 TTTAAAAAGACAGAGGAAGGGGG - Intergenic
1018947234 6:168356403-168356425 TTTAAAAAGAAGCAGAAAGAAGG - Intergenic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020339092 7:7089732-7089754 TTAAAAACGAATGAGGGGGCTGG - Intergenic
1020425909 7:8065935-8065957 TTCAAAAAAATTGAGGGGGAGGG - Intronic
1020463735 7:8452780-8452802 ATTAAAAAGAATGGGGGGTAGGG + Intronic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1020702644 7:11502243-11502265 TTCCAAAAGGATTAGGAGGAGGG + Intronic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021098590 7:16562256-16562278 TTTAGAAAGAGTTTGGAGGAGGG - Intronic
1021426902 7:20510543-20510565 TCTAAAAATAATGTGGAGGCAGG - Intergenic
1021449261 7:20767318-20767340 TTTAAAAAGACATAGGAGGTGGG + Intronic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021661491 7:22923858-22923880 TTTAAAAAGAAATAGAAGGCTGG + Intergenic
1021676641 7:23086786-23086808 TTTAAAAATAACAAGGAGGTGGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022381344 7:29862826-29862848 GATAAAAAAAATAAGGAGGAAGG - Intronic
1022545388 7:31183121-31183143 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023645505 7:42309189-42309211 TTTCAAAAAACTGAGAAGGAAGG + Intergenic
1024092586 7:45957154-45957176 TTTAAAAAGTAGTAAGAGGAAGG - Intergenic
1024165750 7:46728151-46728173 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1024445765 7:49476652-49476674 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1024465376 7:49706625-49706647 TGTAACAGGAATGTGGAGGATGG - Intergenic
1024721934 7:52147168-52147190 GTTAAAATTAATGAGGAGCAAGG + Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024884836 7:54128837-54128859 TGTAAAAGGAAGGAGGAAGAGGG - Intergenic
1025024540 7:55505604-55505626 TTTAGAAAGAGAGAGGGGGAAGG + Intronic
1025062796 7:55825668-55825690 TTTAAAAAGAAGGATGGGGCCGG + Intronic
1025248628 7:57336886-57336908 TTAAAAAAAAATGAGAAAGATGG - Intergenic
1025297123 7:57783998-57784020 TTTAAAATGAATGAAAAGGAGGG - Intergenic
1025736153 7:64148736-64148758 TTTAAAAAAAAGGAGGCGGCGGG + Intronic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026234245 7:68512168-68512190 TTTAAAAAGACTGGCGAGGACGG + Intergenic
1026422684 7:70257029-70257051 TTAAAAAACAATGAAGAGCAAGG - Intronic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026989956 7:74579315-74579337 TTTGAAAAGGAAGAGGAAGAAGG + Intronic
1027299927 7:76821463-76821485 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
1027357043 7:77367736-77367758 TTTCAAAAAATTGAGGAGGATGG - Intronic
1027368687 7:77485205-77485227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1027508109 7:79044033-79044055 TTTCAAAAAATTGAGGAGGTGGG + Intronic
1027627155 7:80560476-80560498 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1027683205 7:81246517-81246539 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1027910867 7:84248747-84248769 TTTAAAAAGAGAGAGAGGGAGGG - Intronic
1028058378 7:86277628-86277650 TATAAAAAGACTGAGTATGATGG + Intergenic
1028176644 7:87668020-87668042 TTCCAAAAAAATGAGGAAGAGGG - Intronic
1028234904 7:88348587-88348609 TTTAACTAGAAGGAGGAAGAAGG + Intergenic
1028328584 7:89559607-89559629 TGAAAAAAGAAAGAGAAGGAAGG + Intergenic
1028334490 7:89635159-89635181 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1028337581 7:89676477-89676499 TTCAGAAAAATTGAGGAGGAAGG + Intergenic
1028346972 7:89795148-89795170 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1028629439 7:92918585-92918607 AATAAAAAGAATCAGGTGGAAGG - Intergenic
1028780751 7:94733459-94733481 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1028949409 7:96618061-96618083 TTTTTAAAAAATGAGGAGGGGGG - Intronic
1028983317 7:96990846-96990868 TTTAAAAAGAAAGAGAGGGAGGG + Intergenic
1029413006 7:100427314-100427336 TTTAACAAGAAAGAAGAGGCGGG + Intronic
1029838761 7:103340333-103340355 TTTAAAATGGATGAGGTGGTGGG + Intronic
1029939271 7:104462774-104462796 GACAAAAAAAATGAGGAGGAGGG - Intronic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030373269 7:108725097-108725119 TCTACAAAGAATGAGGATGTGGG - Intergenic
1030462676 7:109860114-109860136 TTTAAAAAAAATGATGATGATGG - Intergenic
1030649438 7:112101602-112101624 TTTAAAAATACCGAGGGGGAGGG - Intronic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1031250464 7:119373520-119373542 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1031257386 7:119471337-119471359 TTCCAAAAGAATGAGGAGTATGG + Intergenic
1031346964 7:120679711-120679733 TTTAAAAAGAATGTGGAACTTGG - Intronic
1031429730 7:121652426-121652448 TTGCAAAAAATTGAGGAGGAGGG - Intergenic
1031536486 7:122940023-122940045 TTTCATAAAATTGAGGAGGAGGG - Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1031738150 7:125393630-125393652 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1031906062 7:127460783-127460805 TTCAAAAAAACAGAGGAGGAAGG + Intergenic
1031914282 7:127547598-127547620 TTTAAACAGAATGAAGAAAAGGG - Intergenic
1031967916 7:128041291-128041313 TTTAAAAAATAAGAGGTGGAGGG + Intronic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032134964 7:129267967-129267989 TTTAAGAAAAAAGAGGATGAGGG + Intronic
1032157574 7:129481614-129481636 ATTAAAAAGAATGAGCAGCCGGG + Intronic
1032207170 7:129877304-129877326 TTTAAAAAGAATGTTGAGATTGG + Intronic
1032249622 7:130243734-130243756 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032730827 7:134641149-134641171 TGTGAATAGGATGAGGAGGATGG + Intergenic
1032775307 7:135106748-135106770 TTTCAAAAAGCTGAGGAGGAGGG - Intronic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1032999596 7:137489233-137489255 TATAAAAAGAGGGAGGAAGATGG + Intronic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1033496313 7:141900146-141900168 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1033532267 7:142276564-142276586 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1033612688 7:142980779-142980801 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1034112659 7:148553261-148553283 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1034195933 7:149247278-149247300 TTTAAAAAAATTGTGGAGGTGGG + Intronic
1034354257 7:150439317-150439339 TTCAAAAAGAGTGATGTGGAGGG + Intergenic
1034384147 7:150724426-150724448 TGTAAAGAGAATTATGAGGAGGG - Intronic
1034887800 7:154811503-154811525 TTTAAAACAAATGAGTAGGTAGG + Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035325913 7:158065918-158065940 TTTAAAAGGGAAGAGGTGGATGG + Intronic
1035651073 8:1265504-1265526 TTAAAAAAGAATGGGGAGAAAGG + Intergenic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036034272 8:5002334-5002356 GCTAAAAAGAATGGAGAGGAAGG - Intergenic
1036198434 8:6744696-6744718 TTTAGAGCGAGTGAGGAGGAGGG - Intronic
1036508553 8:9379295-9379317 TTTAAAAGAAATGAGGAAGGTGG - Intergenic
1036977502 8:13430497-13430519 TTTCAAAAGAATGAAAATGAGGG - Intronic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037431965 8:18823060-18823082 TTTATAAAGAAGGAGGAAAAGGG + Intronic
1037554425 8:20008421-20008443 TTTAACAAGTATGAGCAGGGTGG + Intergenic
1037790730 8:21938879-21938901 TTTAATGAGAATGAGGAGCCTGG + Intronic
1037851518 8:22333906-22333928 TTTCCAGAGAATAAGGAGGAAGG + Intronic
1037927411 8:22854849-22854871 TTTGAAAAGAGGGAGGGGGAGGG - Intronic
1038092092 8:24266215-24266237 TTTAAAAAGTAAGAGAAAGAAGG + Intergenic
1038526856 8:28281937-28281959 TTTAAAAAGGCTGAGTAAGAGGG + Intergenic
1038682772 8:29684584-29684606 TTTAAAAAGAGTTGGGAGGTAGG + Intergenic
1038822320 8:30964145-30964167 TTTAAAAAGAATTTTCAGGAAGG + Intergenic
1038872533 8:31510966-31510988 TTTCTAAAAATTGAGGAGGAGGG - Intergenic
1038889222 8:31700139-31700161 TTTAAGAAAAATGTGCAGGATGG + Intronic
1038898296 8:31812580-31812602 TAAAAAAGGAAGGAGGAGGAAGG - Intronic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039790755 8:40873795-40873817 GTTAAAAATAGTGAGGAGGACGG - Intronic
1040540623 8:48351032-48351054 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1040986625 8:53301318-53301340 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041159895 8:55029129-55029151 TTTAAAAAGTAGGAGTAGTATGG - Intergenic
1041372407 8:57176022-57176044 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1041470840 8:58207147-58207169 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041616345 8:59911477-59911499 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041887923 8:62833781-62833803 TTCAAAAAAATTGAGGGGGAGGG + Intronic
1042199210 8:66264039-66264061 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1042305624 8:67328839-67328861 TTTGAAAAGAAGGAGAAAGAAGG + Intronic
1042381770 8:68123871-68123893 TTTCAAAGAATTGAGGAGGAGGG + Intronic
1042658547 8:71128661-71128683 TTTAGCAAGAAAGAGGGGGAAGG - Intergenic
1042848835 8:73195028-73195050 GTTGGAAAGAATGTGGAGGAAGG - Intergenic
1042900350 8:73719842-73719864 TTTAAAAATATTGAAGTGGAAGG - Intronic
1043112097 8:76198548-76198570 TTTATAAATAATAAGGAGAATGG - Intergenic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043360241 8:79463658-79463680 ATTAAAAACAATGAGGCAGATGG + Intergenic
1043396908 8:79846676-79846698 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1043446808 8:80327136-80327158 TCTAAATAGAATGAGGAGTCAGG + Intergenic
1043497535 8:80818971-80818993 TTTAAAAAAAATGATGATGAGGG - Intronic
1043640891 8:82449013-82449035 TCCAAAGAAAATGAGGAGGAAGG - Intergenic
1043702373 8:83305154-83305176 TTTAAAAAGAACCAGAAGGTTGG - Intergenic
1044181906 8:89206459-89206481 TTGAAAAAGAACGAGGATAAAGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044258006 8:90088608-90088630 CTTAAAAAAAATGAGGTGGGGGG - Intronic
1044272165 8:90258936-90258958 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1044339819 8:91033939-91033961 TTTAAAAACAAGGAGGAGGCTGG - Intronic
1044498391 8:92919674-92919696 TTTCAAAACATTGAAGAGGAGGG - Intronic
1044506293 8:93023952-93023974 TTTAAAAAGTATAAGGTGAATGG + Intergenic
1044793821 8:95875719-95875741 ATTTCAAAAAATGAGGAGGAGGG + Intergenic
1044978846 8:97694572-97694594 TTTCAATATAATGGGGAGGAAGG - Intronic
1045161794 8:99555883-99555905 TATATAAAGAATGAAGAGCAAGG + Intronic
1045249253 8:100469427-100469449 TTTAAAAAAAAAGAAGAAGAAGG - Intergenic
1045673084 8:104578493-104578515 TTCAAAAAAATTGAAGAGGAAGG + Intronic
1045909762 8:107393506-107393528 TTTAAAAAAAATTAGGGGGATGG + Intronic
1045961748 8:107976791-107976813 TTTAAAAGAAAGGAAGAGGAGGG - Intronic
1046021692 8:108672865-108672887 ATCATAAAGAATGAGCAGGATGG + Intronic
1046045641 8:108961022-108961044 TTGACAAAGAAAGGGGAGGATGG + Intergenic
1046243000 8:111523346-111523368 TTTTAAAAAATTGAAGAGGAAGG - Intergenic
1046490065 8:114939981-114940003 TTTAAAAAAAAGGAGAAGAAAGG + Intergenic
1046522240 8:115339897-115339919 TGAAAAAAGAATGAGGAGCCGGG - Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046656073 8:116896392-116896414 TTCAAAAAAACTGAAGAGGAAGG + Intergenic
1046895472 8:119467115-119467137 ATTCCAAAAAATGAGGAGGAGGG + Intergenic
1047213927 8:122862065-122862087 TTTGACAAAACTGAGGAGGAGGG + Intronic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047722737 8:127656764-127656786 TTTAAAAAGAAAGATGCGGCCGG + Intergenic
1047836756 8:128702108-128702130 AGTAAAAAGAATGTGGAGGAAGG - Intergenic
1047924905 8:129673358-129673380 TTTTAAAAGTGTGAAGAGGAAGG - Intergenic
1048101596 8:131358135-131358157 TTTCAAAAAATTGAGGGGGAAGG - Intergenic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048474553 8:134731711-134731733 TTTAAAAAGAAATAGGGGCAGGG + Intergenic
1048709648 8:137195156-137195178 AGAAAAAAGAAAGAGGAGGAGGG + Intergenic
1049823370 8:144650357-144650379 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050003850 9:1107205-1107227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1050164765 9:2753430-2753452 TTTCAAAAAATTGAGGAGGAAGG + Intronic
1050303248 9:4280740-4280762 TCTGAGAAGAGTGAGGAGGAAGG - Intronic
1050334491 9:4577369-4577391 GTTTAAACGAATGAGGAGGCAGG + Intronic
1050377304 9:4985829-4985851 TTAAAAAGGAATAAGGAGGCGGG - Intronic
1050398436 9:5225314-5225336 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1050510279 9:6387327-6387349 TTTTAAAAAATAGAGGAGGAGGG + Intergenic
1050565729 9:6880783-6880805 TTTAAAAAAAAGGAGGAAGGAGG - Intronic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050826245 9:9950426-9950448 TTTAAGAAGAAAGTGGAGGCCGG + Intronic
1050861969 9:10446136-10446158 TTGAAATAGAAAGAGGAGAAAGG + Intronic
1050878455 9:10670803-10670825 ATCAAAAAAATTGAGGAGGAGGG - Intergenic
1050899288 9:10925088-10925110 TGTAAACATAATGAGGATGAGGG + Intergenic
1050971964 9:11889088-11889110 TTTGTAAAGAATGATGATGATGG + Intergenic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1052078873 9:24178857-24178879 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1052095287 9:24376423-24376445 CGTCAAAATAATGAGGAGGAAGG - Intergenic
1052417919 9:28201811-28201833 TTTAAATAGGGGGAGGAGGAAGG - Intronic
1052524984 9:29605376-29605398 TTATAAAAAAATGAGGAGGTGGG - Intergenic
1052543634 9:29844294-29844316 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1052836525 9:33254293-33254315 TTTAAAAACAATGATGGGGTGGG + Exonic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053427651 9:38021357-38021379 ATAAAAAAGAATGATGAGGCTGG + Intronic
1053531138 9:38882621-38882643 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1053533971 9:38907548-38907570 TTTAAAAAGAATGAAGTGTTGGG - Intergenic
1053580592 9:39400027-39400049 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1053591999 9:39524319-39524341 GTTAAAGAAAATGAGGAGGCCGG + Intergenic
1053724262 9:40981567-40981589 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1053780805 9:41605217-41605239 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1053845087 9:42228074-42228096 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1054102179 9:60958832-60958854 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1054168748 9:61815374-61815396 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1054203360 9:62107053-62107075 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1054206196 9:62131967-62131989 TTTAAAAAGAATGAAGTGTTGGG - Intergenic
1054341707 9:63870434-63870456 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1054574305 9:66840970-66840992 GTTAAAGAAAATGAGGAGGCCGG - Intergenic
1054584180 9:66948031-66948053 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1054632162 9:67456379-67456401 TTTAAAAAGAATGAAGTGTTGGG + Intergenic
1054635002 9:67481311-67481333 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1054668783 9:67765437-67765459 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1054757541 9:68974168-68974190 CTTAGCAAGAATGAAGAGGAAGG - Intronic
1054774510 9:69113791-69113813 TTAAAAAAGATAGAGGAGGCTGG - Intergenic
1054800739 9:69345902-69345924 TTTAATAAGAATAAGAAGGTAGG - Intronic
1055048666 9:71957725-71957747 TTTATGAGGAATGGGGAGGAAGG - Intronic
1055131623 9:72781918-72781940 TTTCAAAAACTTGAGGAGGAGGG + Intronic
1055225304 9:73988346-73988368 TTCCCAAAAAATGAGGAGGAAGG + Intergenic
1055229760 9:74048558-74048580 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1055279867 9:74661939-74661961 TTTAAAAAGAATTCCGAGGCCGG - Intronic
1055311509 9:74986762-74986784 ATTAAGAAGAATGAGCAGTAGGG - Intronic
1055336004 9:75234285-75234307 TTAGAAACGAATGAGGAGGAAGG + Intergenic
1055562956 9:77539542-77539564 TTCCAAAAGATTGAAGAGGAGGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055811346 9:80151889-80151911 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1055833851 9:80415974-80415996 CCTGAAAAAAATGAGGAGGAGGG - Intergenic
1055903164 9:81264191-81264213 TTTAAAAATAACGAGGTGGGTGG + Intergenic
1055979266 9:81985974-81985996 TTAGAAAAGAATGTGTAGGAAGG + Intergenic
1056082252 9:83107694-83107716 TTTAAATACAAAGAGGAGAATGG - Intergenic
1056090303 9:83198822-83198844 TATAAATAGAATGGGGGGGAGGG + Intergenic
1056127585 9:83551510-83551532 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056715883 9:89027797-89027819 ATAAAAGAGAGTGAGGAGGAGGG + Intronic
1056866928 9:90235744-90235766 TTACAAAACATTGAGGAGGAAGG - Intergenic
1056925510 9:90830879-90830901 TTTCATAAGAAAGAGGAGGCCGG - Intronic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057055477 9:91957253-91957275 TTTAAAAATAATGTGTAGGCTGG + Intergenic
1057403064 9:94741569-94741591 TTTAAAAAAAAGAAGGGGGAAGG - Intronic
1057492456 9:95531940-95531962 ATTAAAAAGAATAAGGGAGATGG + Intergenic
1057587889 9:96345924-96345946 TTTCAAAAGAATGGGAAGAAAGG - Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058101553 9:100922936-100922958 TTTGAAAAAATTGAGGAGGAGGG + Intergenic
1058162823 9:101588174-101588196 TTTAACAAGAATCATGAAGAGGG + Intronic
1058302623 9:103395151-103395173 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1058394816 9:104539252-104539274 TTTAAGAAGAGAGAGAAGGAGGG + Intergenic
1058403190 9:104640867-104640889 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1058621625 9:106889227-106889249 TTTAAAAGGGGTGGGGAGGAAGG - Intronic
1058633721 9:107016480-107016502 TTTAGAAACAAGGAGGAGGGAGG + Intergenic
1058904769 9:109473868-109473890 TTTTAAAAAACTCAGGAGGATGG - Intronic
1058968495 9:110058719-110058741 TCTAAAGAGAATGGGAAGGAAGG - Intronic
1059378918 9:113908343-113908365 TTTAAAAAAATGGAGGAGGGAGG + Intronic
1059807592 9:117820082-117820104 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1059916469 9:119108219-119108241 TTTAATAAGAATGGTGAGGTGGG - Intergenic
1059990917 9:119864931-119864953 GTTCAAAAAATTGAGGAGGAGGG + Intergenic
1060106544 9:120876659-120876681 TTTAAAAAGGATGTTCAGGAGGG + Intronic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1060273404 9:122164181-122164203 TTTAAAATGGAAGAGAAGGAGGG + Intronic
1060352372 9:122869987-122870009 TTCAGAGAGAATGTGGAGGAAGG - Intronic
1061053222 9:128208035-128208057 AAAAAAAAGAATGGGGAGGAAGG - Intronic
1061410889 9:130420894-130420916 TTAAAAAAAAATAAGGAGGCTGG - Intronic
1061631979 9:131877976-131877998 ATTAAAAAGAATGAACAGGCCGG + Intronic
1061765751 9:132880144-132880166 CTTAAAATAAATGAGGAGAAAGG - Intronic
1203450538 Un_GL000219v1:110452-110474 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1185880875 X:3739858-3739880 ATTAAAAAGAAAGAAGAGGCTGG + Intergenic
1186125470 X:6409214-6409236 AATAAAAACAATGAAGAGGATGG - Intergenic
1186295476 X:8143958-8143980 TTTAAAAAGTATCAGTAGAAAGG + Intergenic
1187023831 X:15411794-15411816 ATTAAAAAGAATTTGGTGGAAGG - Intronic
1187024644 X:15421749-15421771 TTCAAAGAGACTGAAGAGGAGGG + Intronic
1187049864 X:15685187-15685209 TTTGGAAAGAATGAGGAGAATGG + Intergenic
1187357814 X:18594363-18594385 TTTAAATAAAATGAGGGGAAGGG - Intronic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187624651 X:21097038-21097060 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1187680533 X:21762797-21762819 TTTAAAAAGACTGATGTGCAAGG + Intergenic
1187696310 X:21924583-21924605 TTTAAAAATGATGATGATGAGGG - Intergenic
1187886749 X:23895873-23895895 TTTAAAAAAAAAAAAGAGGAAGG + Intronic
1188102126 X:26101718-26101740 TTTTAAAAGGAAGAGGAGAATGG - Intergenic
1188222455 X:27557995-27558017 TTTAAGATGAAAGTGGAGGAGGG - Intergenic
1188283214 X:28296540-28296562 TTCTAAAACAATGAGGAGAAAGG + Intergenic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188531391 X:31145122-31145144 CTTAAAATGAATGAGGATTAAGG - Intronic
1188710664 X:33393350-33393372 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
1188711584 X:33406860-33406882 TTCCAAATGATTGAGGAGGAAGG - Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188843186 X:35040871-35040893 TCTAAAAAAAATGAGGAAAAGGG + Intergenic
1188879144 X:35470762-35470784 TTTAAAAAGAATCAGTTTGAGGG + Intergenic
1188900773 X:35730639-35730661 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1189112208 X:38303093-38303115 GTTGAAAAGAAGGAGGAAGAAGG - Intronic
1189653431 X:43214689-43214711 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1189712876 X:43832851-43832873 TTTATAAAGAATAATCAGGAAGG + Intronic
1189866806 X:45338888-45338910 TTCCAAAAGACTGAGAAGGAGGG + Intergenic
1189951999 X:46241874-46241896 TTTTAAAAGATTGAAGAGGAGGG + Intergenic
1190027963 X:46943745-46943767 TCCAAAAAAATTGAGGAGGAGGG - Intronic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190706814 X:53035688-53035710 AATAAAAAGAAGGAAGAGGAGGG + Intergenic
1191041207 X:56081987-56082009 TTTCAAAACATTGAAGAGGAGGG - Intergenic
1191175163 X:57491617-57491639 TTCCAAAAAATTGAGGAGGATGG - Intergenic
1191221770 X:57997216-57997238 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191811431 X:65193196-65193218 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1191929621 X:66356382-66356404 TTCAAAAAAATTGAGGTGGAGGG + Intergenic
1192116755 X:68418972-68418994 TTTAAAAAAAAAGAAGTGGAGGG - Intronic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192691405 X:73368727-73368749 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1192700869 X:73470513-73470535 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1192756672 X:74053437-74053459 TTTCAAAAAATTGAGGAGAAGGG + Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193074982 X:77346004-77346026 GGTAAAAAGGATGGGGAGGACGG - Intergenic
1193167435 X:78297422-78297444 TTTCAAAAAATAGAGGAGGAGGG - Intronic
1193353190 X:80485334-80485356 TTTGAAAAGAATGAGAAGGTAGG - Intergenic
1193359786 X:80567906-80567928 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1193391398 X:80932960-80932982 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1193427694 X:81359428-81359450 TTCAAAAACAATGATGGGGATGG - Intergenic
1193455575 X:81727683-81727705 TCCCAAAAAAATGAGGAGGAGGG + Intergenic
1193493481 X:82180648-82180670 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1193607541 X:83587056-83587078 TCCAAAAAAAATGAGGAGAAGGG + Intergenic
1193789906 X:85804944-85804966 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1193863550 X:86700956-86700978 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1194040490 X:88936239-88936261 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1194069765 X:89307264-89307286 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1194072678 X:89347044-89347066 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1194137452 X:90163976-90163998 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1194456843 X:94115249-94115271 TATAAAAAGAATAAGGCGGCTGG - Intergenic
1194511990 X:94808178-94808200 TTTCAAAAAATTGAGGACGAGGG - Intergenic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1194553235 X:95326947-95326969 TTTAAAAAAATTGAGGAGAAGGG - Intergenic
1194574878 X:95600279-95600301 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1194781106 X:98026814-98026836 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1194962668 X:100253673-100253695 TTACAAAAAATTGAGGAGGAGGG + Intergenic
1194982664 X:100456239-100456261 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1195024198 X:100859471-100859493 TGCAAAAAAATTGAGGAGGAGGG - Intronic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1195473146 X:105256181-105256203 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1195592382 X:106644802-106644824 TTCAAAAAAATGGAGGAGGAAGG - Intronic
1196010751 X:110885383-110885405 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1196076399 X:111581737-111581759 TTTCAAAAGATTGAAGAGAAGGG - Intergenic
1196152333 X:112388947-112388969 TTTCAAAAAATTGAGGAGAAAGG - Intergenic
1196218698 X:113086598-113086620 TCCAAAAAGATTGAGGAGGAGGG - Intergenic
1196240413 X:113337488-113337510 TTACAAAATATTGAGGAGGAGGG - Intergenic
1196434394 X:115661749-115661771 TTATAAAAGAAAGAGAAGGACGG + Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1196584383 X:117412634-117412656 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1196980016 X:121202478-121202500 TTTCAAAAGACTTAGAAGGAGGG - Intergenic
1196990554 X:121324296-121324318 TTTCAAAAGACTTAGAAGGAGGG + Intergenic
1196998548 X:121411926-121411948 TTACAAAATAATGAAGAGGAGGG - Intergenic
1197031763 X:121824656-121824678 TCTCAAAAGAATGAGAAGGAGGG + Intergenic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197158808 X:123300261-123300283 TTCTAAAAAATTGAGGAGGAGGG - Intronic
1197259068 X:124297238-124297260 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197324602 X:125076779-125076801 GTTAACAAAAATGAGGAAGATGG - Intergenic
1197374647 X:125667169-125667191 ATTCCAAAAAATGAGGAGGATGG + Intergenic
1197378079 X:125706489-125706511 TTAAAAGAGAATTAGGAGCATGG - Intergenic
1197508577 X:127341365-127341387 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1197518054 X:127461234-127461256 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1197930155 X:131686411-131686433 TTTAAAGAGATTGCGGAGGGGGG + Intergenic
1198224783 X:134635250-134635272 TTTAATTAGAATAAGGATGAAGG + Intronic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198285425 X:135185614-135185636 ATTAAACAGATGGAGGAGGAGGG + Intergenic
1198287846 X:135210129-135210151 ATTAAACAGATGGAGGAGGAGGG - Intergenic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1198825887 X:140697417-140697439 TTTAGAAAAGTTGAGGAGGAAGG - Intergenic
1198974773 X:142324014-142324036 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1199196983 X:145042838-145042860 TTTATCAAGATTCAGGAGGAAGG + Intergenic
1199228405 X:145407052-145407074 TTAAAAAAAAAAGAGGAGGCCGG + Intergenic
1199507782 X:148585541-148585563 TTTAAGAAGACTGAGTAGGCCGG + Intronic
1199561228 X:149164821-149164843 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1199865037 X:151838824-151838846 TTTCAAAAGATTGAGAAAGAGGG + Intergenic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200336586 X:155357313-155357335 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
1200349884 X:155483914-155483936 TTTCAAAAAATTGAGAAGGAGGG - Intergenic
1200483182 Y:3733907-3733929 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1200723912 Y:6641400-6641422 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1200726918 Y:6682787-6682809 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1200728070 Y:6698562-6698584 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1201193130 Y:11466188-11466210 GTTAGTAAGAATGAGGAAGAGGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201369167 Y:13242248-13242270 TTTCAAAACACTGAGTAGGAAGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201934943 Y:19400077-19400099 TTTCAAATAATTGAGGAGGAGGG + Intergenic
1202071053 Y:20991914-20991936 TTTCAAAAGAATAAGAAGAATGG + Intergenic
1202142163 Y:21736311-21736333 TTTGAAAAGAAGGAAGAAGAGGG - Intergenic
1202144702 Y:21767491-21767513 TTTGAAAAGAAGGAAGAAGAGGG + Intergenic