ID: 932546998

View in Genome Browser
Species Human (GRCh38)
Location 2:72722994-72723016
Sequence AAAATGTGACTATACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932546998 Original CRISPR AAAATGTGACTATACTGGGA AGG (reversed) Intronic
903112565 1:21148933-21148955 GAAATGTGACTATACTGGCCAGG + Intronic
907225372 1:52941438-52941460 AAAATGTAACTATACTTGGCTGG + Intronic
908988276 1:70053029-70053051 AAAATGTTGCTTTGCTGGGACGG - Exonic
909237392 1:73171075-73171097 AAAGAGTAACTATACTGGCAAGG - Intergenic
909372975 1:74908099-74908121 AAAATATGAAGATACTGGGAAGG - Intergenic
909476174 1:76083160-76083182 AAAATGTGTATATTCTGGGTTGG + Intronic
909849642 1:80444404-80444426 CAAATGTGATGATACAGGGAAGG - Intergenic
910554010 1:88509607-88509629 AAAATGTGAGTATTTGGGGATGG - Intergenic
913019440 1:114773130-114773152 GAAATGTGAGTAAACTGGGACGG + Exonic
913188362 1:116391125-116391147 AAAATCTGACCAAAGTGGGAGGG + Intronic
913297226 1:117333988-117334010 CAAAGGTGACTAGACTGGGTTGG - Intergenic
916623346 1:166525989-166526011 GAAATGTAAATATACTGAGATGG + Intergenic
918649205 1:186939542-186939564 AAAATGTTACCATTCTTGGAGGG - Intronic
919162042 1:193842388-193842410 AAAAGGTGAATATAATGGCAGGG + Intergenic
921671625 1:217930995-217931017 AATTTGTGAATATACTAGGAAGG + Intergenic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1065566731 10:27018979-27019001 AAAATGGGACAATACTGGCCAGG + Intronic
1067042175 10:42960830-42960852 AAAGTGTGCCTAAGCTGGGAAGG - Intergenic
1071234145 10:83624829-83624851 AAGATGAGATTATACTGGGGTGG + Intergenic
1072665928 10:97392265-97392287 ACAATGTGAGTATACTTGGCTGG - Intronic
1080172942 11:29327817-29327839 AAAATGTTACTCTTATGGGAGGG + Intergenic
1080929167 11:36789521-36789543 AAAATGTGAATCAACTGAGAAGG - Intergenic
1081582638 11:44362788-44362810 AAAATCTGATTAGACAGGGATGG - Intergenic
1086145028 11:83542183-83542205 AAAATTTGATTGTAATGGGAGGG - Intronic
1086614185 11:88795119-88795141 AACATGAGACTATATTGAGAGGG + Intronic
1086963019 11:92999197-92999219 AAAATGTGAATATAGGGGCAGGG - Intergenic
1087759379 11:102089532-102089554 AAAATGTTAGTATACTTGGCCGG + Intergenic
1088059627 11:105631213-105631235 AAGCTGTGATTATATTGGGAAGG + Intronic
1088310677 11:108457175-108457197 AAAACATGATGATACTGGGAGGG + Intronic
1088606276 11:111536432-111536454 AAAATGCAAATATTCTGGGATGG - Intronic
1090434047 11:126671765-126671787 AAAAGCTGACAATACTGGCAAGG + Intronic
1091772190 12:3159467-3159489 AGAATGTGACTGTATTTGGAGGG + Intronic
1092627582 12:10343826-10343848 AAAATGTGAATAGACTCAGAAGG - Intergenic
1094292343 12:28866079-28866101 AAGATGTGGATATACTGGAAAGG + Intergenic
1095934199 12:47659021-47659043 AAAATCTTCCTATACTGAGATGG - Intergenic
1096457342 12:51798618-51798640 ACAAAGTGACTATAGTGGCAGGG - Intronic
1098855828 12:75652422-75652444 ATAAGGTGAGTACACTGGGAAGG + Intergenic
1101633633 12:106519263-106519285 AAAATGCCACTATACAGGGATGG - Intronic
1104105545 12:125655481-125655503 AAAATGTTAATATACAGTGAGGG + Exonic
1107123357 13:36819238-36819260 AAAAGGCGCCTATACCGGGAAGG - Exonic
1108781819 13:53845781-53845803 AAAATGTGACAATCCTTGTATGG - Intergenic
1109684913 13:65805773-65805795 AAAATGTTACTTTCCTGTGAAGG + Intergenic
1110358215 13:74593900-74593922 AAAATATGAATCTACTGTGAAGG + Intergenic
1110500392 13:76220930-76220952 AAAATGTAAATATTCTGGAAGGG + Intergenic
1110600089 13:77363175-77363197 ATAATGTGACAATAATGTGAGGG + Intergenic
1112064704 13:95780883-95780905 AAACTGTGGCTATATTGTGAAGG + Intronic
1112068142 13:95816828-95816850 AAAAAGTCACTAAACTGGGCTGG + Intronic
1114902047 14:27073935-27073957 AAAATGCTCCTATACAGGGAGGG + Intergenic
1115819944 14:37203395-37203417 ACTATGTGACTAAACTGAGAAGG - Intronic
1116860199 14:49989081-49989103 AGACTGTTACTATACTGAGAGGG - Intronic
1119289832 14:73486744-73486766 AAAGTGTAAATATACTGGGAAGG - Intronic
1120456718 14:84739969-84739991 AAATTGGAACAATACTGGGAAGG + Intergenic
1121498562 14:94415237-94415259 AAATTGTGTGTAAACTGGGAGGG - Intergenic
1123956059 15:25335851-25335873 AAAATCTGGGTAAACTGGGATGG + Intronic
1125248159 15:37666467-37666489 AAAATCTGACTTTAATGAGAAGG - Intergenic
1125737911 15:41941289-41941311 ATAATCTGAATATACTGGCATGG + Intronic
1126074826 15:44899009-44899031 ATAAACTGACTAGACTGGGATGG - Intergenic
1126083539 15:44988806-44988828 ATAAACTGACTAGACTGGGATGG + Intergenic
1128789069 15:70419374-70419396 AAAATGGGACTATGCGGGGCTGG - Intergenic
1130360646 15:83181769-83181791 AAAATGTGACTATAAGGGCCAGG - Intronic
1131938259 15:97532075-97532097 AAAATGTGATTATATTTTGATGG - Intergenic
1133642828 16:7734383-7734405 AAACTGTGCCTAAACTGGCATGG + Intergenic
1135689498 16:24524735-24524757 AAAATGGGATAATATTGGGATGG + Intergenic
1137225485 16:46502720-46502742 AAAATGGGAATACAATGGGAAGG - Intergenic
1137929198 16:52570637-52570659 AATATGAGACTATCTTGGGATGG - Intergenic
1138735123 16:59241469-59241491 AAAATGCGGCTTTACTGGAATGG + Intergenic
1138940076 16:61779391-61779413 AAAATTTGACAATACTGCAAAGG - Intronic
1139836198 16:69840578-69840600 AAAGTGTAACTGTATTGGGAAGG - Intronic
1140305887 16:73802299-73802321 AAAATGTGACTCCACAGGGAAGG + Intergenic
1140801566 16:78493008-78493030 AAAACGTCACTTTACCGGGATGG - Intronic
1141597533 16:85106528-85106550 AAGATGTGACTACAGAGGGAAGG + Intronic
1143269074 17:5662419-5662441 AAAGTGGGACTATACTGGCCAGG - Intergenic
1144412200 17:15012178-15012200 AAAATGAGACTATACTGCAGAGG + Intergenic
1144622594 17:16827752-16827774 AAAATATGAATATATTGAGAAGG + Intergenic
1144883834 17:18444958-18444980 AAAATATGAATATATTGAGAAGG - Intergenic
1145148398 17:20499419-20499441 AAAATATGAATATATTGAGAAGG + Intergenic
1146868375 17:36358683-36358705 AAAATGTGAATATATTGGCTGGG + Intronic
1147071248 17:37959308-37959330 AAAATGTGAATATATTGGCTGGG + Intergenic
1147082774 17:38038833-38038855 AAAATGTGAATATATTGGCTGGG + Intronic
1147098718 17:38162804-38162826 AAAATGTGAATATATTGGCTGGG + Intergenic
1147576931 17:41607678-41607700 AAAATATGAATATATTGAGAAGG + Intergenic
1150668565 17:67169488-67169510 ATAATGTGATTATACAGGAATGG - Intronic
1152784134 17:82239286-82239308 ACAACGTGACTTTAATGGGAGGG + Exonic
1155376909 18:25168819-25168841 TAAGTGTGAGTAAACTGGGAAGG + Intronic
1156004833 18:32427956-32427978 AAAATATGACTATATATGGAGGG + Intronic
1156200080 18:34820929-34820951 AAATTGTCTCTATACTGGGAGGG - Intronic
1156378456 18:36535057-36535079 AAAATGTGTATTTCCTGGGATGG - Intronic
1158363652 18:56706129-56706151 AATATGGGACTGTACTGAGAGGG + Intronic
1158840559 18:61381969-61381991 AAGTTGTGACCATACTGGGGGGG - Intronic
1159466865 18:68794974-68794996 AAAATCTGACTATATATGGAGGG - Intronic
1160161653 18:76477466-76477488 AAAATGTGACAAAACTGAGTTGG + Intronic
1165136126 19:33670613-33670635 AAAATGTGACGCTCCTGGAAAGG - Intronic
1166626143 19:44357705-44357727 AAAATGTTATTATTATGGGAAGG + Intronic
1166789336 19:45389090-45389112 AAAATGTTACTATCCTAAGACGG + Intronic
1167082113 19:47283426-47283448 AAAATGTGAATATTCAGGGCTGG - Intergenic
926359769 2:12075496-12075518 AAAATGTGATTATTCTGAGGTGG - Intergenic
927603814 2:24468064-24468086 CAAATTTGACTAAAATGGGAAGG - Intergenic
927870823 2:26622422-26622444 ATCATGTAACTATATTGGGAGGG + Intronic
928040872 2:27875819-27875841 AAAATGTGTCTGTACAGGCAAGG - Intronic
930013126 2:46952953-46952975 AGAATGAGACAATACTGGCATGG - Intronic
931268228 2:60679413-60679435 AAAATGTGTGTAGACTGGGAAGG - Intergenic
931941759 2:67259778-67259800 AAAGGGTGAGTATACGGGGAGGG - Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
932704829 2:74015393-74015415 TAATAGTGATTATACTGGGATGG - Intronic
935657671 2:105438722-105438744 AAAGGGTGGCTAAACTGGGAAGG + Intergenic
936745729 2:115574216-115574238 GAGATATGACTATACTGAGAGGG - Intronic
937055712 2:118934596-118934618 AAATTGTGAATATATTTGGAAGG + Intergenic
937457487 2:122055058-122055080 AAAATGAAACTATCCTGGGCTGG - Intergenic
939003748 2:136764079-136764101 AAGATGTGAATATATTGGTAAGG - Intergenic
939712811 2:145543949-145543971 AAAATGTTAATTCACTGGGAAGG - Intergenic
939883910 2:147660365-147660387 AAAATGTGACTAAAGTGAGATGG - Intergenic
941897207 2:170641176-170641198 AAATGGTGAATAAACTGGGAGGG + Intronic
942575989 2:177363961-177363983 GAAATGTGGCTATGCAGGGATGG - Intronic
943490867 2:188555023-188555045 TATATGTGCCTATACTGGTAAGG + Intronic
944341835 2:198610554-198610576 AAAATGTGGGTATACAGAGAAGG - Intergenic
944961397 2:204878471-204878493 AAATTGTGACTGTATTTGGAAGG - Intronic
946907993 2:224434210-224434232 ATAATGTAACTATATTGGGAGGG + Intergenic
947993438 2:234505817-234505839 AAAATGTGAAAAGACTGGGCTGG - Intergenic
948415199 2:237798083-237798105 AAAATTTGAATATTCTGGGCTGG - Intronic
1169203577 20:3728066-3728088 AAAATGAGAATAGACTGGGTTGG + Intergenic
1171876169 20:30579205-30579227 AAAATGTTATTATTATGGGAAGG - Intergenic
1175518634 20:59585333-59585355 AAAATGTGACTGCACTGGGAGGG + Intronic
1180761630 22:18214266-18214288 AAAATGCTAGTATACTGGGTGGG - Intergenic
1180774037 22:18410344-18410366 AAAATGCTAGTATACTGGGTGGG + Intergenic
1181117491 22:20641918-20641940 AAAATGTGTATATTCAGGGATGG + Intergenic
1181193141 22:21157295-21157317 AAAATGCTAGTATACTGGGTGGG + Intergenic
1181216305 22:21335306-21335328 AAAATGCTAGTATACTGGGTGGG - Intergenic
1181696427 22:24595001-24595023 CAAATGTGAGAATACTGGGCAGG + Intronic
1182913853 22:34010026-34010048 AAAATGTGCATATACTGGCCGGG - Intergenic
949193162 3:1274043-1274065 AAATTGTGACTATATTGTAATGG - Intronic
949231531 3:1756501-1756523 AAAATGGGATTACACTGGAACGG + Intergenic
950288365 3:11763084-11763106 AATCTGTGTCTACACTGGGAGGG - Intergenic
951405665 3:22294176-22294198 AAAGTGCCACTATACTGGGTAGG + Intronic
953262411 3:41352661-41352683 AAAAAGTGACTGTCCTGGGAGGG - Intronic
953472764 3:43180966-43180988 AAAATGAGACAATACAGGCAAGG + Intergenic
953969387 3:47335234-47335256 AAAATGTGAATAGCCTGGTATGG - Intronic
960666133 3:120110777-120110799 AAAATGTCATTATCCTGGCAGGG - Intergenic
961265222 3:125636218-125636240 AAAATGTGATGGAACTGGGAAGG + Intergenic
963067742 3:141277364-141277386 AAAGTATGACTATACTGTGTTGG + Intronic
963492059 3:146014847-146014869 AAAATGTGACTGTCTTGGAATGG - Intergenic
963867229 3:150375654-150375676 AAAATGTGACCTAACTGTGATGG - Intergenic
964468412 3:157024267-157024289 TTAATGTGACTAAAGTGGGAAGG - Intronic
964807048 3:160621767-160621789 GAAGAGTGACTATACAGGGATGG - Intergenic
965353759 3:167648248-167648270 AAAATCTTACTATACTTGAAAGG + Intronic
967994791 3:195158346-195158368 AGAATGGGAATATGCTGGGAGGG + Intronic
968113852 3:196073755-196073777 AAACTGAAACTATACTGGTAGGG - Intronic
968428297 4:537480-537502 AAAAGGTGAACATACTGGGCAGG - Intronic
970187702 4:13479078-13479100 AAAATGTGAAAAGATTGGGAAGG - Intronic
970233167 4:13932008-13932030 AAAATGAGACCATACTGGGTAGG + Intergenic
970363968 4:15339874-15339896 GAAATGTGAGTATTATGGGAAGG + Intronic
971645253 4:29191185-29191207 AGAATGTGACTATATTTGGAGGG - Intergenic
971782119 4:31049771-31049793 ACCATGTGACTATGCTGGAATGG - Intronic
972816236 4:42649483-42649505 ACAATGTGATTATATTTGGATGG + Intronic
975422016 4:74176414-74176436 AAAATGTGATAATGCTGGGATGG - Intronic
975819003 4:78250680-78250702 CAAGTGTGATTATACTGGGGAGG + Intronic
977085875 4:92598389-92598411 AAAATAGTACTATAATGGGAGGG - Intronic
977257282 4:94755137-94755159 GAAATGTGACTACTCTAGGAAGG + Intergenic
977468395 4:97411173-97411195 AAAATGTTAGTATAGTGGGAAGG + Intronic
977965380 4:103140770-103140792 AATATGTGAATATAATGGTAGGG + Intronic
978053330 4:104231304-104231326 AAATTGTGACAAAATTGGGATGG + Intergenic
978555788 4:109979206-109979228 AAAATGTGGCTAAAAAGGGAAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979566915 4:122164682-122164704 AAAATTTGATTATATTGGTATGG + Intronic
981015761 4:139972433-139972455 AAAATGTGACTATAAAGTCATGG - Intronic
981396164 4:144252437-144252459 AATATGTCCATATACTGGGAAGG + Intergenic
981403438 4:144340258-144340280 CAAATGTGACTATATTAAGATGG + Intergenic
982039059 4:151376875-151376897 TAAATGTGTCTTTACAGGGAAGG - Intergenic
982104875 4:152003102-152003124 AAAAGGTTGCTCTACTGGGAAGG - Intergenic
982164980 4:152605984-152606006 AAACTGTGACTATACAGAAAAGG - Intergenic
983157402 4:164367122-164367144 GAAATATGACTATACTTGTATGG - Intronic
983447488 4:167872632-167872654 ACCATATGACAATACTGGGAAGG - Intergenic
983674969 4:170281512-170281534 AAAATCTGACAATCCTAGGAGGG - Intergenic
985172499 4:187167073-187167095 AAATTGAGACTATACAGGCATGG - Intergenic
986135754 5:4975900-4975922 AATGTGTGTCAATACTGGGAGGG - Intergenic
987242545 5:16015572-16015594 AAAATGTGAATGTGCTGGGGTGG - Intergenic
988107334 5:26769005-26769027 AAAATGTGAAAATACTAGGCTGG + Intergenic
990291850 5:54360059-54360081 AACTTGGAACTATACTGGGAAGG + Intergenic
992981221 5:82175303-82175325 AAAATGTGGCTATATAGGGAAGG - Intronic
993421585 5:87708387-87708409 TAAATGTGACTATTTTGGCAAGG + Intergenic
993563904 5:89448258-89448280 AAAATGTGTCTTTACTGAAAAGG + Intergenic
995991204 5:118241825-118241847 AAAATGTGACCAGACTGTGAAGG - Intergenic
997442859 5:133921087-133921109 AAAATGTGACTTTAGAGTGAAGG + Intergenic
997490819 5:134274383-134274405 AAGAAGTCACCATACTGGGAAGG - Intergenic
998851711 5:146357246-146357268 AAGATTTGACTATATTGGAATGG - Intergenic
999603251 5:153290116-153290138 AAAATGGCACTATACTGGGAGGG + Intergenic
1000290877 5:159870086-159870108 AAAATGTGACAATGCTATGAAGG + Intergenic
1001073186 5:168604636-168604658 GAAGTGTGACAACACTGGGAGGG + Intergenic
1001182019 5:169529325-169529347 AGTATGTGACTATTCTTGGAAGG - Intergenic
1003761165 6:9180480-9180502 AACATATGGATATACTGGGAAGG + Intergenic
1004202783 6:13565106-13565128 AAAATGTGACTTAATTGTGATGG - Intergenic
1004945164 6:20604216-20604238 AAAAGGTGGCTATATTGGCAGGG + Intronic
1006045981 6:31298771-31298793 AAACTGGAACTATACAGGGAAGG + Intronic
1006937725 6:37729996-37730018 AAAATGTGGCCATACTGGATTGG - Intergenic
1008060804 6:46994704-46994726 ACAATGTAACTATATTGAGAAGG - Intergenic
1008459133 6:51747532-51747554 AAAATTTGAATATAATGAGATGG - Intronic
1008643000 6:53483922-53483944 AAAATGATACTTTGCTGGGAGGG + Intergenic
1013439777 6:110151902-110151924 AATATGTGCATATAATGGGATGG - Intronic
1013676566 6:112470431-112470453 AAAATTTCTGTATACTGGGAGGG - Intergenic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1018222497 6:161595010-161595032 AAAATGTGACTGTATTGGGTGGG + Intronic
1018743200 6:166745543-166745565 AGAATGGGACTGTATTGGGAGGG - Intronic
1019999640 7:4748345-4748367 ATGATGTAACTTTACTGGGATGG - Intronic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1021242145 7:18216356-18216378 AAAATTTGAAAATATTGGGATGG - Intronic
1021317915 7:19173103-19173125 GAAATCTGACTATGCTGGGAGGG + Intergenic
1024342446 7:48281215-48281237 AAAATATGATTATGCAGGGAGGG + Intronic
1024572262 7:50733052-50733074 AGAATGTGACTGTATTTGGAAGG + Intronic
1024854758 7:53765139-53765161 AAAATGTACCTCTCCTGGGAAGG - Intergenic
1028111041 7:86941735-86941757 AAAATTAGACTACAATGGGAAGG + Intronic
1028359554 7:89951429-89951451 AAAATGTGACTGTATTTTGAAGG - Intergenic
1028902996 7:96122017-96122039 AGAATGTGACCAGACTGAGATGG - Intronic
1031733056 7:125321535-125321557 AAAATGTTACTAGACAGGCATGG - Intergenic
1032964541 7:137080680-137080702 AAAATGTGATTACCCAGGGAGGG - Intergenic
1036619876 8:10417632-10417654 AAAATGTGAAATGACTGGGATGG - Intronic
1038514810 8:28178365-28178387 AAAAAGTTAGGATACTGGGAAGG - Intronic
1041317348 8:56578369-56578391 AGGATGTGACTATAGTGGAATGG - Intergenic
1041563357 8:59246490-59246512 AAAGGGTGAGCATACTGGGATGG + Intergenic
1042306681 8:67340762-67340784 GGAATGTGACTATCCAGGGAAGG - Intronic
1043528231 8:81119884-81119906 AAGATGTTGCTGTACTGGGAGGG + Intergenic
1045782383 8:105882303-105882325 AAATTGTGACTATCGTGGAAGGG - Intergenic
1045915282 8:107462596-107462618 AAAATGTGACTAGATTTGGAAGG + Intronic
1047303880 8:123637694-123637716 AAGATGAGACCATGCTGGGAAGG + Intergenic
1056179994 9:84073666-84073688 AAAATGTCATTTTACTGGGCCGG + Intergenic
1056746479 9:89308326-89308348 AAAATGTGAATAAACTGTTAAGG - Intergenic
1056806942 9:89736344-89736366 AAAAGGAGATTATTCTGGGAGGG - Intergenic
1058264147 9:102876292-102876314 AAAATGTCACTTTCCTGGCAAGG + Intergenic
1058437664 9:104977967-104977989 AAAATGGAACTGTAATGGGATGG - Intergenic
1059728860 9:117036450-117036472 AAGATATGACTATCCTTGGAGGG - Intronic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1186613707 X:11164419-11164441 ATTATGTGGATATACTGGGAGGG + Intronic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1190901221 X:54675072-54675094 AAGATTTGGCCATACTGGGATGG - Intergenic
1192425730 X:71074370-71074392 AAAATGTGATTATGGTGGGAGGG + Intergenic
1192619005 X:72658111-72658133 AAGATGTGACTATAACGGAATGG - Intronic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1195883808 X:109619693-109619715 AAAATGTGAATATCCATGGAAGG + Intergenic
1196636916 X:118012657-118012679 AAAATGTGGCCATCCTGGGCGGG + Intronic
1197670169 X:129268271-129268293 AAAGTGTATCCATACTGGGAAGG - Intergenic
1197962915 X:132024409-132024431 AAAATGAAAATATAATGGGAGGG - Intergenic
1198661701 X:138975884-138975906 GCAATGTGAATATACTGGGAAGG + Intronic
1198831932 X:140759995-140760017 AAAATGAGACTATACTAGGCTGG + Intergenic
1198994202 X:142555195-142555217 AAAATGTGATTATTTTGGTAGGG + Intergenic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic