ID: 932548783

View in Genome Browser
Species Human (GRCh38)
Location 2:72744558-72744580
Sequence TTCACGTTCTCCAAGTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932548783 Original CRISPR TTCACGTTCTCCAAGTGTCA AGG (reversed) Intronic
901295793 1:8160027-8160049 TTCAGCTTCTCCAACTGTCTTGG + Intergenic
903535535 1:24063961-24063983 CTCAATTTCTCCAAGTGACATGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905244567 1:36603580-36603602 TTCACCATATCCAAGGGTCAGGG + Intergenic
905458223 1:38103270-38103292 GTCAATTTCTCCAAGTGTCCTGG + Intergenic
912726924 1:112067061-112067083 TTCAGGTTCCCCAAGATTCAAGG + Intergenic
913640033 1:120803898-120803920 TGCAGGTTCACAAAGTGTCATGG - Intergenic
914278446 1:146146440-146146462 TGCAGGTTCACAAAGTGTCATGG + Intronic
914539493 1:148597388-148597410 TGCAGGTTCACAAAGTGTCATGG + Intronic
914627188 1:149474240-149474262 TGCAGGTTCACAAAGTGTCATGG - Intergenic
917122656 1:171657790-171657812 TCCACGTTAGCCAAGTGTCCAGG - Intergenic
918132120 1:181638666-181638688 CTCACAATCTCCATGTGTCAAGG + Intronic
921713999 1:218400302-218400324 CTCTCGCTCTCCAACTGTCACGG + Intronic
923569385 1:235100519-235100541 TTCACGTTCCCACAGTGTGATGG + Intergenic
1063237394 10:4131350-4131372 TACACTTTCTGTAAGTGTCAAGG + Intergenic
1067673921 10:48352791-48352813 TTCTCCTTTTCCAATTGTCAGGG - Intronic
1068666584 10:59682414-59682436 TACACGTTTTCCAAGTTTCTAGG - Intronic
1069362835 10:67663037-67663059 TTCACTTTTTCGAAGTGTCTTGG + Intronic
1071110848 10:82153801-82153823 TTCACCATCTCTAATTGTCAGGG - Intronic
1074572142 10:114633729-114633751 TTCACGTTCCCCAATTTTCATGG + Intronic
1079414629 11:20222253-20222275 TTTACTCTCTCCATGTGTCATGG + Intergenic
1081634959 11:44714902-44714924 TTCTCATTCTCAAAGTGTCTTGG - Intergenic
1084780692 11:71406414-71406436 TCCTCGTTGTCCAAGTGGCAGGG - Intergenic
1086561302 11:88172767-88172789 TGCACGTGCTCCATGTTTCATGG - Intronic
1088598082 11:111454801-111454823 TTCACTCTTTCCAAGTGTCTGGG + Intronic
1091864694 12:3822104-3822126 TTCACATTCTCCCAGTGTGGTGG + Exonic
1096340035 12:50790137-50790159 TTAATGTTTTCCAAGTGTAATGG + Intronic
1097676890 12:62612689-62612711 TTCCCCTTCTCCAAAAGTCATGG + Intergenic
1098945903 12:76589290-76589312 AACTCTTTCTCCAAGTGTCATGG + Intergenic
1100566190 12:95796449-95796471 TTCAAGTCTTCCAAGTGGCAGGG + Intergenic
1103206202 12:119130871-119130893 TCCACATTCCCCAAGTGTCGTGG - Intronic
1104545345 12:129707678-129707700 TTCATGGTCTCCAAATGTAATGG - Intronic
1108106623 13:47017504-47017526 TACATGTTCTCCAAGTGAAATGG - Intergenic
1110898047 13:80781948-80781970 TTCATGTTTTCCATGTGTCCTGG + Intergenic
1114967713 14:27983808-27983830 TTCACTTTCTCCAAGTCTATAGG - Intergenic
1117292806 14:54349875-54349897 CTCACGTCCTCCAAGGGACAGGG - Intergenic
1118756481 14:68848429-68848451 TTCTAGTTGTCCAAGTGCCAAGG + Intergenic
1120359510 14:83480543-83480565 TTATAGTTCTCCAAGAGTCAGGG + Intergenic
1121616010 14:95314321-95314343 TTCACTTCCACCAAGTGTCCTGG - Intronic
1121757703 14:96416943-96416965 GTCACTTTCTCAAAATGTCAGGG + Intronic
1124138945 15:27060508-27060530 TTGACATTCTCGAAGTCTCAGGG - Intronic
1127112161 15:55686257-55686279 TTCACCTTTTCCATGTGTGAGGG + Intronic
1129497349 15:75997746-75997768 GCCATGTTCTCCAGGTGTCAGGG - Intronic
1130909330 15:88260379-88260401 TTCAATTTCTCTAGGTGTCAGGG - Intergenic
1131314389 15:91320317-91320339 TTCACCTTCTCTGAGTGTAAAGG + Intergenic
1140354713 16:74295921-74295943 TTCCTGATCTCCAAATGTCAAGG - Intergenic
1141180082 16:81746478-81746500 TTCACGTAGTCCAAGAGCCAGGG + Intronic
1141441631 16:84033208-84033230 TTCCCCTTCTCCAAATGTGAAGG + Intronic
1147798910 17:43067798-43067820 TGCACGTTCTACACGTGTCCTGG + Intronic
1151398530 17:73840880-73840902 TTCCGGGTCTCCAAGTGACAAGG + Intergenic
1153249333 18:3105544-3105566 TTCTTATTCTCCAAGTTTCATGG - Intronic
1155968199 18:32055656-32055678 CCCACAATCTCCAAGTGTCAAGG - Intronic
1156147865 18:34207989-34208011 TCCACATTCTGCAGGTGTCAAGG + Intronic
1160491837 18:79344694-79344716 TTCAGGCTCTCAATGTGTCAAGG - Intronic
1161724697 19:5921797-5921819 TTCACGGTAGCCAAGTCTCAAGG + Intronic
1164891866 19:31830567-31830589 TTTTCTTTCTCCAAGTCTCAAGG + Intergenic
1168115474 19:54219726-54219748 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168121278 19:54253875-54253897 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168124786 19:54277407-54277429 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168132819 19:54332033-54332055 CTCAGTTTCTCCAAGTGTAAAGG - Intergenic
1168181502 19:54665301-54665323 CTCAGTTTCTCCAAGTGTAAAGG + Intronic
926464809 2:13175324-13175346 CTCTGGGTCTCCAAGTGTCATGG - Intergenic
928371936 2:30746479-30746501 TGCACCTTCTCCAAGTTGCATGG + Intronic
932506785 2:72241493-72241515 TTCATGTTCTCCAAGATTCCTGG - Intronic
932548783 2:72744558-72744580 TTCACGTTCTCCAAGTGTCAAGG - Intronic
933563998 2:83926913-83926935 TTAAAATTATCCAAGTGTCATGG - Intergenic
933899782 2:86841199-86841221 TTTTCCTTCTCCAACTGTCAAGG + Intronic
935780776 2:106508026-106508048 TTTTCCTTCTCCAACTGTCAAGG - Intergenic
939879601 2:147614815-147614837 TAAACGTTCTGCAAGTGGCATGG + Intergenic
942450185 2:176104410-176104432 TTCACGTTCTCCAGATACCAGGG + Intronic
946478319 2:220030189-220030211 TTCACTTTCTCCAAGTTTCTAGG - Intergenic
949008802 2:241667030-241667052 CTTTCGTTCTGCAAGTGTCAAGG + Intronic
1172875090 20:38159162-38159184 TTCTCCTTCTCCAATTGTCTGGG - Intronic
1177328697 21:19628516-19628538 TTCAAGTTCTGCAAGTCTCTAGG - Intergenic
1179148853 21:38793469-38793491 GTCACCTTCCCCAAGTGTTATGG + Intergenic
1180114581 21:45691954-45691976 CCCACGTTCTCCAGGTGTCTAGG + Intronic
1181880404 22:25974935-25974957 TTGACACTCTCCCAGTGTCAGGG - Intronic
1184338718 22:43873433-43873455 TCCATAATCTCCAAGTGTCATGG + Intergenic
951484731 3:23199389-23199411 CTCAAGTTCTCCATGTATCAAGG - Intergenic
951920031 3:27844226-27844248 CTCATGTTCTCCCAGTATCAAGG + Intergenic
955661389 3:61303138-61303160 CTTATGTTCTCAAAGTGTCAGGG + Intergenic
959143012 3:102508612-102508634 TTCACATTCTTCAAGGGTAAGGG + Intergenic
960591154 3:119367149-119367171 TTCAGGTTCTGAAAGTATCAGGG + Intronic
973207003 4:47572021-47572043 ATCCCGTTCTCCAAGTTTCCTGG - Intronic
974066803 4:57086275-57086297 TCCATAATCTCCAAGTGTCATGG - Intronic
980138007 4:128879376-128879398 TATAGGTTCTCCAAGTGTCATGG - Intronic
980280228 4:130708618-130708640 CCCACATTCTCCATGTGTCAAGG - Intergenic
984626566 4:182013674-182013696 ATCAGCTTCTCCAAGTGACATGG + Intergenic
986297922 5:6455059-6455081 TTCAGATTCTCAAAGTCTCATGG - Intronic
991060477 5:62369499-62369521 TCCATAATCTCCAAGTGTCAAGG - Intronic
991486976 5:67147346-67147368 TTAATGTTCTCTAAATGTCAAGG - Intronic
992078451 5:73213167-73213189 TGCACGTTCTCCACGTTTCCCGG + Intergenic
992425139 5:76649290-76649312 TCCAGGTTCTACAAGTGTCTGGG - Intronic
998016740 5:138738055-138738077 TTCTTTTTCTCCAAGTGTCTTGG + Intronic
1001143791 5:169166801-169166823 TCTACATTCTCCAAGTGACATGG - Intronic
1001505402 5:172275313-172275335 TTCATAATCTCCACGTGTCATGG - Intronic
1001572637 5:172740623-172740645 TTCAAGCACACCAAGTGTCACGG + Intergenic
1002414458 5:179112360-179112382 TTCACGTTCACAAAATGTCAAGG + Exonic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1006865632 6:37207007-37207029 TTCACGGACTGAAAGTGTCAGGG + Intergenic
1017567814 6:155707367-155707389 TTAACATTCTACCAGTGTCAAGG + Intergenic
1021064049 7:16150473-16150495 TTCATATTTTCAAAGTGTCATGG - Intronic
1021491664 7:21225746-21225768 TTTAAGTTCAACAAGTGTCAGGG - Intergenic
1022499671 7:30874563-30874585 GTCACTTTCTCCAAGTTCCAGGG + Intronic
1024666294 7:51550428-51550450 CTCACATTCTCCAAGGGCCATGG - Intergenic
1025985762 7:66450153-66450175 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1026002612 7:66573467-66573489 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1027208988 7:76128702-76128724 CTCACATTCTCCAAGTTTGAAGG - Intergenic
1029183665 7:98722683-98722705 TACACGTTGTCCCAGAGTCAGGG + Intergenic
1030673061 7:112358096-112358118 TTAACTTTCTCCAAGTCCCATGG - Intergenic
1037740091 8:21601921-21601943 GGCACATTCTCCAAGTGCCAGGG + Intergenic
1039479629 8:37862830-37862852 TTCACCTGCTCCAGGGGTCAAGG - Exonic
1040733039 8:50473100-50473122 CCCACGTTCCCCAAGTGTCAAGG + Intronic
1041258734 8:56001843-56001865 ATCACCTTCTCCAAGCCTCAGGG - Intronic
1045786561 8:105928005-105928027 TTCACGTTCACCAATTCTCTGGG - Intergenic
1048616590 8:136081664-136081686 TTCACGTTTTCAAGGTGACATGG + Intergenic
1050280123 9:4041698-4041720 TTCACGTTTTCAGAGAGTCAGGG - Intronic
1050409996 9:5353873-5353895 TTCTCGGTCCACAAGTGTCAAGG - Intergenic
1051522178 9:18001508-18001530 TGCACCTTCTCCATGTGCCATGG - Intergenic
1052449473 9:28610352-28610374 TTCACTTCCTCCAATTATCATGG + Intronic
1056138024 9:83648204-83648226 TAGACTTTCTCCAAGTGTGATGG - Intergenic
1056837654 9:89970215-89970237 TCCACGTTGTCACAGTGTCAGGG - Intergenic
1057525690 9:95797937-95797959 TTCACTTTTTCCTAGTGACAGGG + Intergenic
1058579736 9:106441920-106441942 TCCGCGTTTACCAAGTGTCAGGG - Intergenic
1058721426 9:107768206-107768228 TTCACCTACTGCAATTGTCAGGG - Intergenic
1186881060 X:13866801-13866823 TTCAAGTTCTCCAAGTATCTGGG - Intronic