ID: 932555743

View in Genome Browser
Species Human (GRCh38)
Location 2:72824002-72824024
Sequence TGGTCCTGATCATAAGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932555737_932555743 18 Left 932555737 2:72823961-72823983 CCCTTAAGAGCTGAAGAAAATGG 0: 1
1: 0
2: 3
3: 28
4: 368
Right 932555743 2:72824002-72824024 TGGTCCTGATCATAAGGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 116
932555739_932555743 17 Left 932555739 2:72823962-72823984 CCTTAAGAGCTGAAGAAAATGGG 0: 1
1: 0
2: 1
3: 22
4: 258
Right 932555743 2:72824002-72824024 TGGTCCTGATCATAAGGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 116
932555736_932555743 25 Left 932555736 2:72823954-72823976 CCATTGACCCTTAAGAGCTGAAG 0: 1
1: 0
2: 1
3: 6
4: 112
Right 932555743 2:72824002-72824024 TGGTCCTGATCATAAGGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932555743 Original CRISPR TGGTCCTGATCATAAGGCAA TGG Intronic