ID: 932557617

View in Genome Browser
Species Human (GRCh38)
Location 2:72839287-72839309
Sequence AGCTGCGTTCTGCACCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932557617_932557618 27 Left 932557617 2:72839287-72839309 CCATTGTGGTGCAGAACGCAGCT No data
Right 932557618 2:72839337-72839359 TTATTTTATTTTATTTTAGAAGG 0: 33
1: 187
2: 590
3: 5682
4: 111751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932557617 Original CRISPR AGCTGCGTTCTGCACCACAA TGG (reversed) Intergenic
No off target data available for this crispr