ID: 932559689

View in Genome Browser
Species Human (GRCh38)
Location 2:72856167-72856189
Sequence CACAGTGACCAGCATGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932559686_932559689 -10 Left 932559686 2:72856154-72856176 CCCCAGTGTTCTGCACAGTGACC No data
Right 932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932559689 Original CRISPR CACAGTGACCAGCATGTAGT AGG Intergenic
No off target data available for this crispr