ID: 932564415

View in Genome Browser
Species Human (GRCh38)
Location 2:72896537-72896559
Sequence GCACCGACTCCGGGCACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932564401_932564415 27 Left 932564401 2:72896487-72896509 CCACTCTTCTCCACACCACTCTC No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data
932564404_932564415 12 Left 932564404 2:72896502-72896524 CCACTCTCCTTGCTGGACCTGAG No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data
932564408_932564415 5 Left 932564408 2:72896509-72896531 CCTTGCTGGACCTGAGGATGGGC No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data
932564403_932564415 17 Left 932564403 2:72896497-72896519 CCACACCACTCTCCTTGCTGGAC No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data
932564400_932564415 28 Left 932564400 2:72896486-72896508 CCCACTCTTCTCCACACCACTCT No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data
932564411_932564415 -5 Left 932564411 2:72896519-72896541 CCTGAGGATGGGCCTTGGGCACC No data
Right 932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932564415 Original CRISPR GCACCGACTCCGGGCACAAA AGG Intergenic