ID: 932564602

View in Genome Browser
Species Human (GRCh38)
Location 2:72897974-72897996
Sequence CAGAACAGCCACAAAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932564600_932564602 24 Left 932564600 2:72897927-72897949 CCATGTCCAGCGAGAAGGAAATG No data
Right 932564602 2:72897974-72897996 CAGAACAGCCACAAAATGCCAGG No data
932564601_932564602 18 Left 932564601 2:72897933-72897955 CCAGCGAGAAGGAAATGTGTAAA No data
Right 932564602 2:72897974-72897996 CAGAACAGCCACAAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932564602 Original CRISPR CAGAACAGCCACAAAATGCC AGG Intergenic
No off target data available for this crispr