ID: 932567006

View in Genome Browser
Species Human (GRCh38)
Location 2:72916836-72916858
Sequence CCGGTCGCGGCACCGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932566997_932567006 -4 Left 932566997 2:72916817-72916839 CCCGCCGTCCTGGTCCAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
932566993_932567006 9 Left 932566993 2:72916804-72916826 CCCAGTGCCGAGGCCCGCCGTCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
932566994_932567006 8 Left 932566994 2:72916805-72916827 CCAGTGCCGAGGCCCGCCGTCCT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
932566996_932567006 2 Left 932566996 2:72916811-72916833 CCGAGGCCCGCCGTCCTGGTCCA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
932567000_932567006 -8 Left 932567000 2:72916821-72916843 CCGTCCTGGTCCAAGCCGGTCGC 0: 1
1: 0
2: 0
3: 2
4: 92
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
932566999_932567006 -5 Left 932566999 2:72916818-72916840 CCGCCGTCCTGGTCCAAGCCGGT 0: 1
1: 0
2: 0
3: 3
4: 112
Right 932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932567006 Original CRISPR CCGGTCGCGGCACCGTGTCT GGG Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
1122892299 14:104738470-104738492 CCGCTCAGGGCACCGCGTCTGGG - Intronic
1125536108 15:40441748-40441770 CCGGCCGCGGCCCCTTGCCTCGG - Intronic
1136484296 16:30561420-30561442 CAGGTCGCGGCATCGCGTCCCGG + Intergenic
1152215462 17:79029232-79029254 ACGGTCGCTGCACCATGGCTTGG + Intronic
1162033113 19:7925795-7925817 CCGGGCGCGGCTCCGTTTCCCGG - Intronic
927521836 2:23703675-23703697 CAGGTCACGGCAGCTTGTCTTGG - Intronic
930189221 2:48440868-48440890 CCGTTCCCGGGAGCGTGTCTGGG + Exonic
931694111 2:64859456-64859478 CTGCTGGCGGCACTGTGTCTTGG + Intergenic
932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG + Intronic
1176722255 21:10402232-10402254 CCGGTAACGGCACAGCGTCTGGG + Intergenic
1180303440 22:11054994-11055016 CCGGTAACGGCACAGCGTCTGGG + Intergenic
953020134 3:39107809-39107831 CCGCTCGCGGCTCCGAGTCCGGG - Exonic
958779679 3:98525306-98525328 CCGGTCGCCGCACGCTGTCCCGG - Intronic
968448539 4:664331-664353 CCCGTCGCGGCAGCTTGTCGAGG + Intronic
968624763 4:1622166-1622188 GCTGTAACGGCACCGTGTCTGGG - Intronic
1022396019 7:29989115-29989137 GCGGCCGCCGCACCGTGTCCCGG - Intronic
1049578071 8:143398676-143398698 CCGGTGGCTGGACCCTGTCTGGG - Intergenic
1058885151 9:109317327-109317349 CCGGCCACAGCACCCTGTCTGGG + Intronic
1060430974 9:123551384-123551406 CAGGTCGTGGCACCGTGTGTAGG - Intronic
1185464137 X:345328-345350 CCAGTCGCTGCCCCGTGTCTGGG - Intronic