ID: 932567491

View in Genome Browser
Species Human (GRCh38)
Location 2:72918720-72918742
Sequence AAGCCGGGCGGAGGGAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932567491 Original CRISPR AAGCCGGGCGGAGGGAGAGC GGG (reversed) Intronic