ID: 932567834

View in Genome Browser
Species Human (GRCh38)
Location 2:72920681-72920703
Sequence GCGGCGCGGTCCCGGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932567826_932567834 26 Left 932567826 2:72920632-72920654 CCCACACGAACGAAAAGGAACAT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG 0: 1
1: 0
2: 1
3: 31
4: 266
932567827_932567834 25 Left 932567827 2:72920633-72920655 CCACACGAACGAAAAGGAACATG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG 0: 1
1: 0
2: 1
3: 31
4: 266
932567825_932567834 27 Left 932567825 2:72920631-72920653 CCCCACACGAACGAAAAGGAACA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG 0: 1
1: 0
2: 1
3: 31
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932567834 Original CRISPR GCGGCGCGGTCCCGGCGCGC GGG Intronic
900180363 1:1308505-1308527 GTGGCGCGGTGCCACCGCGCAGG + Intronic
902336914 1:15759123-15759145 GAGCCGGGGACCCGGCGCGCAGG + Intronic
902478815 1:16701248-16701270 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
904591635 1:31618290-31618312 GAGCCGCTGTTCCGGCGCGCGGG - Intronic
904847398 1:33430687-33430709 GCTGCGCGTTCCCGGCCCGGGGG + Intronic
905027314 1:34859651-34859673 AGCGCGCGGTCCCGGCGAGCAGG - Intronic
905448982 1:38045364-38045386 CCGGCGGGGGCCCGGCCCGCGGG + Exonic
905912072 1:41662096-41662118 GCGGCGGGGGCGCGGCGCGCGGG + Intronic
905960056 1:42035806-42035828 GCCGCCCCGGCCCGGCGCGCAGG - Intronic
906411790 1:45584516-45584538 GAGGCGGGGCCCTGGCGCGCGGG + Intronic
907513868 1:54981029-54981051 CAGGCGCTGTCCAGGCGCGCAGG - Exonic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
910449013 1:87328589-87328611 GCCGGCCGGGCCCGGCGCGCTGG - Exonic
910773268 1:90851133-90851155 GCTGCGCCGTCCCGGCGGGCCGG + Intergenic
913680747 1:121185845-121185867 GCGGCGGGGTTCAGGCGAGCGGG - Intronic
914032579 1:143973487-143973509 GCGGCGGGGTTCAGGCGAGCGGG - Intergenic
914156867 1:145094480-145094502 GCGGCGGGGTTCAGGCGAGCGGG + Intronic
919830867 1:201539305-201539327 GCGGCGCGGACCCGGAGCCCGGG + Intergenic
919840050 1:201602398-201602420 GTGGCGCGGTCTCGGCTCACTGG + Intergenic
920331510 1:205211558-205211580 GCGGCTCGGTCCCCGGCCGCAGG + Exonic
920468059 1:206204371-206204393 GCGGCGGGGTTCAGGCGAGCGGG - Intronic
920630188 1:207644999-207645021 GGGGCGGGGCCTCGGCGCGCAGG - Intergenic
921947284 1:220894739-220894761 GCGGCGCGGTCCAGACACCCGGG - Intergenic
922134859 1:222814958-222814980 CCGGCCCGCTCCCGGCCCGCTGG - Intergenic
924436791 1:244049202-244049224 GCGGCCCCGTCCCCGCGCCCGGG - Intronic
924624561 1:245688116-245688138 GGGGCGAGGTCCCGGCGCTGCGG - Exonic
924775161 1:247111337-247111359 GCGCCGCAGCCCCAGCGCGCGGG + Exonic
1062774651 10:135358-135380 GCGGCGGGGTCCGGGCGGGGGGG + Intronic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065099087 10:22316259-22316281 GGGGCGCGGGACCCGCGCGCGGG + Exonic
1065099865 10:22321788-22321810 GCGGCGCGGCCGGGGCGCGGGGG - Intronic
1065099921 10:22321935-22321957 GCGGGTCGGTCCCGGCGCCGCGG - Intronic
1067694336 10:48524152-48524174 GCCGCGCCGCCCCGGGGCGCAGG - Intronic
1069589006 10:69630450-69630472 GCGCCGCGGGCCGGGCGCGCGGG + Intronic
1070570728 10:77637973-77637995 GCGGCGCAGACCCCGGGCGCGGG - Intronic
1071086741 10:81874989-81875011 GGCGCGGGGACCCGGCGCGCAGG + Intergenic
1071857981 10:89645087-89645109 GCGCCGTGGGGCCGGCGCGCGGG - Exonic
1072679834 10:97498781-97498803 GCGGCGCGGGCACCGCGAGCCGG + Intronic
1073109118 10:101050380-101050402 GCGGCGCGGGGCAGGCGGGCGGG - Intergenic
1073207228 10:101775700-101775722 GAGGCGGGGGCCGGGCGCGCCGG - Intronic
1073392718 10:103192912-103192934 GAGGCGGGGTCCCAGCGAGCCGG + Intronic
1074182968 10:111079040-111079062 GCGGCGCGGGCCGGGGGCGACGG + Exonic
1075940707 10:126388275-126388297 GCGGCGCGGGCGCTGCGCGAGGG - Exonic
1077043682 11:535329-535351 GCGGCGCGGGCCGGGGGCGCGGG - Intronic
1077093541 11:790002-790024 GCGGGGGGCTCCCGGCGGGCGGG - Intronic
1079128674 11:17735422-17735444 GCGGCGCGCTCTCGGCGCGGGGG - Exonic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1083670924 11:64299629-64299651 GCGGCGACCTCTCGGCGCGCGGG - Exonic
1084190198 11:67495212-67495234 GCCGCGCAGTCCTGGAGCGCTGG - Exonic
1084412156 11:69011342-69011364 GCGGCGCGGTCTGGCAGCGCGGG - Intronic
1085640283 11:78188915-78188937 GCGGCGCGGCCCCGGGGCTGCGG - Exonic
1085784291 11:79437697-79437719 GATGCGCGGGCCCGGCTCGCCGG + Intronic
1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG + Intergenic
1089398881 11:118153083-118153105 ACGGCGTGGTCCCGGGGCTCCGG - Intergenic
1089796567 11:120985983-120986005 GCGCCGCAGTCCCGCCGCCCCGG + Exonic
1091493014 12:949346-949368 GCGGTGGGGTCCCGGCGCGTTGG + Intronic
1091740638 12:2958932-2958954 GGGGCGGGCTCCCGGCGCGCAGG - Intergenic
1094125049 12:27014495-27014517 GCTGCGCGTTCCCCGCGCGCCGG - Intergenic
1094199329 12:27780489-27780511 GCTGCGCGGCCTCAGCGCGCCGG + Exonic
1096435853 12:51590955-51590977 GCGGCGCGCTGCAGGCGAGCGGG + Intronic
1097236983 12:57546987-57547009 GGGGCGCGGTCCTGGGGAGCCGG + Intronic
1098255454 12:68611136-68611158 GAGGCGCGGGCCGGGCGCGGCGG + Intronic
1102437756 12:112938617-112938639 GCGGCGCGCTCTGGGCGCCCTGG + Exonic
1102937430 12:116909568-116909590 GTGGCGCGATCTCGGCTCGCTGG - Intergenic
1103595548 12:122022563-122022585 GCATCGCGGCCCCGGCGCGCGGG - Intronic
1106422509 13:29595521-29595543 GGGGCGGGGGCGCGGCGCGCGGG + Exonic
1112091670 13:96090368-96090390 GCGGCCCGCTCCCGCCGCCCCGG - Intergenic
1113378908 13:109786073-109786095 GCGGCCCGGGCCCGGCGCCCAGG + Exonic
1113874283 13:113584863-113584885 GCTGCCCGGTCCGGCCGCGCGGG - Exonic
1114485159 14:23057642-23057664 GCCGCGCGGGCCCGGCTGGCCGG - Intergenic
1114637363 14:24195432-24195454 GCGGCGCGGTAGCGGCGGGTTGG + Intronic
1116835796 14:49768205-49768227 GCGGCGCGGGCCCGGGACTCGGG - Exonic
1117478400 14:56119066-56119088 CCGGCCCGGACGCGGCGCGCGGG - Intronic
1119298727 14:73553450-73553472 GTGGCGCGATCCCGGCTCACTGG - Intronic
1119742839 14:77025780-77025802 GCGGCGCTGCCCCGGCACGGAGG + Exonic
1121226224 14:92323598-92323620 GCAGCGCGCACGCGGCGCGCGGG + Exonic
1121473462 14:94174280-94174302 GCGGGGCGGGCCCGGCGAGGAGG - Intronic
1121691030 14:95877097-95877119 CCGGCCCGGACCCGGAGCGCCGG - Intergenic
1122065989 14:99174871-99174893 GCGGCGCGGTCAACGGGCGCGGG - Exonic
1122208389 14:100159682-100159704 GGGGCGGGGTCCCGGCGGGGCGG + Exonic
1122620868 14:103057182-103057204 GCGGCCCGCTCCCGACGCGCCGG + Exonic
1123721763 15:23066985-23067007 GTGGCGCAGTCTCGGCTCGCCGG + Intergenic
1123734783 15:23175156-23175178 GTGGCGCGGTCTCGGCTCGCCGG - Intergenic
1124285285 15:28396458-28396480 GTGGCGCGGTCTCGGCTCGCCGG - Intergenic
1124297411 15:28515168-28515190 GTGGCGCGGTCTCGGCTCGCCGG + Intergenic
1126102710 15:45129485-45129507 GGGGCGCGGGCGCGGCTCGCAGG + Exonic
1126137161 15:45403095-45403117 CCAGCGCGGTCAGGGCGCGCGGG - Exonic
1127588311 15:60398124-60398146 AGGGCGCGGTCCCTGCGGGCCGG - Intronic
1128115433 15:65102179-65102201 GCGGCGGGGTGCTGGGGCGCGGG + Exonic
1128322564 15:66703496-66703518 GCGGGGAGGCGCCGGCGCGCAGG + Exonic
1128547747 15:68579218-68579240 GGGGCGCGGGCGCGGCGTGCGGG - Exonic
1129406501 15:75322626-75322648 GCGGCGCGGTCCTGGGTGGCGGG + Intergenic
1129780162 15:78264674-78264696 GGGGCGCGGGCCAGGGGCGCGGG + Intronic
1129948217 15:79560535-79560557 GCTGCCCGGTCCGGCCGCGCGGG + Intergenic
1130040923 15:80404602-80404624 CCGGAGCGGACCAGGCGCGCCGG + Intronic
1130411756 15:83653930-83653952 AGGGCGCGGTGCCGGCGCGCAGG + Intergenic
1130508584 15:84570246-84570268 CCGTCGCGGTCCCGGGGAGCAGG + Intergenic
1132544738 16:527967-527989 GCAGCGCGGCCCCGGCCCCCGGG - Exonic
1132971508 16:2691529-2691551 GCTGCGTGGACTCGGCGCGCCGG - Intronic
1133212785 16:4272496-4272518 GCGGCGCGGACCCGGCGTGTGGG + Intronic
1133219955 16:4315753-4315775 GCGGCGCGGCCGCGGGGAGCGGG - Intronic
1133311112 16:4847443-4847465 GCGCCGCGGTCTCCGCGCGCCGG + Intronic
1134615757 16:15650217-15650239 GCGGTGCGGCCCCGGCCCTCCGG - Intronic
1136626391 16:31464690-31464712 GCTGGGCGGGCCCGGTGCGCCGG - Exonic
1137267977 16:46884360-46884382 GCGGCGCGGGCGCCGGGCGCGGG + Exonic
1138595126 16:58025731-58025753 GCGCGGCGGCCGCGGCGCGCGGG + Exonic
1142638264 17:1270923-1270945 GGGGCGCGGGGCTGGCGCGCAGG - Exonic
1142672092 17:1491949-1491971 GCGGCCCTGGCCCGGCCCGCAGG - Intronic
1142847980 17:2691274-2691296 GCGGGGCGGGCCGGGCGCGATGG + Intronic
1143520050 17:7439789-7439811 GGGCCGCGGTCCGGCCGCGCGGG - Exonic
1144519619 17:15945144-15945166 GAGGCGCGGTCCGGGCGCTATGG + Exonic
1146445404 17:32928425-32928447 GCGGCGCGTCCCGGGCGGGCTGG + Intronic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147150350 17:38510498-38510520 CCGGGGCGGTCCCCGCGCCCCGG + Exonic
1147740798 17:42670108-42670130 GCGGAGCGGGCCCGGCGCGGCGG - Exonic
1148225471 17:45895644-45895666 GAGGCGCGGGGCTGGCGCGCAGG + Intronic
1148549703 17:48543283-48543305 GCTGCGCGGGGCCGGCGGGCTGG - Exonic
1150802210 17:68291349-68291371 GCGACGCGGGGCCGGGGCGCGGG - Intronic
1151954436 17:77373419-77373441 GGGGCCCGGGCCCTGCGCGCTGG - Intronic
1152111316 17:78359227-78359249 CCGGGGCGGGCCGGGCGCGCTGG - Intronic
1152475506 17:80515462-80515484 CCCCCGCGGTCCCGGCTCGCGGG - Intergenic
1152711181 17:81871144-81871166 GCGGCAGGGTCTCGGCGGGCGGG - Intronic
1152758650 17:82097536-82097558 GCGGCGAGGACCCAGCGTGCGGG - Intronic
1152790013 17:82273722-82273744 GCGCCGCGGCCCCGCCCCGCCGG - Exonic
1152834315 17:82519682-82519704 GAGGGGCGGGCCCGGCGTGCCGG + Intergenic
1153238766 18:3012873-3012895 GTGGCGCGGTCGCGGCGAGGCGG + Intronic
1157279108 18:46334203-46334225 GTGGCGCGGCTCCGGGGCGCGGG - Exonic
1157529529 18:48409490-48409512 GCGGCGCGGGCGCGGGGCGCGGG - Intronic
1159040299 18:63318453-63318475 GCGGCGAGGTCCTGGCGACCGGG + Exonic
1160719197 19:590077-590099 GGGGCGCGGGCCCGGGGCCCGGG - Exonic
1160812974 19:1020919-1020941 GCGGCCCGGCCCCCGCGCGCGGG - Exonic
1160843972 19:1158624-1158646 GCGGCGAGGCCCGGGCGAGCGGG + Intronic
1160880131 19:1315910-1315932 GGGGAGCGGGCCTGGCGCGCGGG + Intergenic
1160909350 19:1467655-1467677 GCGGAGCAGTCTCGGGGCGCGGG + Exonic
1160911093 19:1474123-1474145 GCGGCTCCGTCCCGGGGCCCCGG - Exonic
1160975269 19:1789847-1789869 ACGGCGGGGTCCCGGCGCCAGGG - Intronic
1161959554 19:7516207-7516229 CCGGCGCGGGCGCGGCGGGCCGG + Exonic
1162391581 19:10393291-10393313 GCGGCTCGGCCCCGGCGGCCTGG - Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162909771 19:13842597-13842619 GCGGGGCGCTCAAGGCGCGCGGG + Intergenic
1163151639 19:15418587-15418609 GCGTCGAGGTCCAGGAGCGCAGG + Intronic
1163427140 19:17245888-17245910 GCAGCGCGAGGCCGGCGCGCGGG - Exonic
1166193743 19:41193357-41193379 GCGGCGTGGGCCCGGGGGGCAGG - Exonic
1166375180 19:42323917-42323939 GCGGCGCGGTGTTGGGGCGCGGG - Intronic
1167709007 19:51098794-51098816 GCCGCGCGGCCCCCGCGCCCCGG - Exonic
1167781428 19:51601494-51601516 GCCGCGCGGCCCCCGCGCCCCGG + Intergenic
1168026382 19:53646765-53646787 GTGGCGTGATCCCGGCCCGCTGG + Intergenic
1202712834 1_KI270714v1_random:27079-27101 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
926012963 2:9423198-9423220 GGGCCGCGCTCCCGGGGCGCGGG - Exonic
926310275 2:11669933-11669955 AAGGCGCGGGCCGGGCGCGCGGG - Exonic
927881496 2:26692826-26692848 GAGGCGCGGGCCGGGGGCGCCGG + Exonic
927956749 2:27212253-27212275 GCGGCCCGGTCCAGTCGCCCTGG - Exonic
929484897 2:42344563-42344585 GCGTCGCAGGCCCGGCGCGGTGG + Intronic
929789797 2:45014079-45014101 GGGGCGCGGGCGCGGCGGGCAGG + Intergenic
932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG + Intronic
932599196 2:73112484-73112506 CCGACGCGGGCCCGGCGCCCTGG - Exonic
937238157 2:120442947-120442969 GTGGCGCGGTCGCGGCGCCAGGG + Intergenic
940293499 2:152099207-152099229 GCGGCGGGGTCCCGGGGAGGGGG + Intergenic
940354007 2:152718663-152718685 GCGCCGCGGTCCCGGCACCCCGG + Exonic
941666268 2:168246876-168246898 GGGCTGCGGTCCCGGCACGCGGG + Intronic
942890299 2:180980392-180980414 GCGGCGGGGACCCGGCGGGCTGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
942947135 2:181683678-181683700 GCGGCGCGGGCCGGGCGTCCCGG + Intergenic
944221865 2:197310954-197310976 GCGGCCCGGTGCGGGCGCGGGGG - Intronic
945290704 2:208124432-208124454 GCTCCGGGGTCCCGGGGCGCAGG + Intronic
946430993 2:219627460-219627482 CCGGCGCGGCCCCCACGCGCGGG - Intronic
947641609 2:231710397-231710419 GCAGGGAGGTCGCGGCGCGCAGG - Intronic
948115883 2:235494167-235494189 GCGCGGGGGCCCCGGCGCGCCGG + Exonic
948140646 2:235670040-235670062 CCGGCGCCCTCCCGGCCCGCGGG + Intronic
948140659 2:235670073-235670095 GCGGCGGGGCCCCAGCGCGCGGG + Intronic
948560455 2:238848160-238848182 GCGGCGCGCGCTCGGCGCCCCGG + Exonic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
1170998607 20:21391509-21391531 GCTGCGAGGTCGCGGCGCCCGGG - Intergenic
1171865482 20:30485392-30485414 GTGGCGCGGCCCCGGCTGGCCGG + Intergenic
1173516182 20:43667040-43667062 GCCGCCCAGTCCTGGCGCGCGGG - Intronic
1173516243 20:43667261-43667283 GCGGCGCGGTCCGGGCCGGGGGG + Exonic
1175108116 20:56628742-56628764 ACAGCGCGGTCCCGGCCCCCGGG - Intergenic
1175866838 20:62183138-62183160 GCCGCGGGGTACCGGGGCGCTGG + Intronic
1176128949 20:63488195-63488217 GGGGCGCCGGACCGGCGCGCGGG + Exonic
1178498873 21:33109753-33109775 GCGACCCGGTCCCTGCGCTCCGG + Intergenic
1181256850 22:21568165-21568187 GCGGGGCGGTTCCGCGGCGCGGG - Intronic
1181299210 22:21867515-21867537 GCGGCGCAGTCCCTGCGGGAGGG - Exonic
1181602592 22:23961196-23961218 GTGGCAGGATCCCGGCGCGCCGG + Intergenic
1181605922 22:23980111-23980133 GTGGCAGGATCCCGGCGCGCCGG - Exonic
1182355612 22:29721101-29721123 GGGCCGCCTTCCCGGCGCGCCGG - Intronic
1182532133 22:30968879-30968901 GCGGCGCGCGGGCGGCGCGCGGG - Intergenic
1183295011 22:37024270-37024292 GCGCTGCGGGCCCCGCGCGCTGG + Exonic
950518155 3:13480510-13480532 GCGGGGCTGGCCTGGCGCGCCGG - Intronic
950610609 3:14124571-14124593 CCGGCGTGGTCGCGGGGCGCCGG + Intronic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
953404790 3:42654837-42654859 GCGCCGCATTCCCGGCCCGCGGG - Intronic
953404822 3:42654959-42654981 GCGGCGCCGTCCGGGCGCAGGGG - Intronic
954437286 3:50503035-50503057 CAGCCGCGGTCCCGGCGCTCTGG - Intronic
954733476 3:52685610-52685632 GCGGGTCGGGCCGGGCGCGCGGG - Intronic
954778891 3:53045392-53045414 GCGCGGCGGGCCCGGCGCGCCGG + Intronic
956813609 3:72888294-72888316 GCGCTGCTGTCCCTGCGCGCTGG + Exonic
959359083 3:105367322-105367344 GCCCCGCGGTGCCCGCGCGCTGG - Exonic
962809130 3:138946730-138946752 GCGGCCCGGCCGCGGCGCGCCGG - Exonic
963870645 3:150410235-150410257 GCGGCCCGGTCGCGGCTCCCGGG - Exonic
966808562 3:183824902-183824924 GCGGTGCGCTCCCGGCACGGGGG + Intronic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
969239360 4:5888749-5888771 ACGGCGCGGTCAGGGCCCGCGGG + Intronic
969288350 4:6222272-6222294 GCCGAGCGGTTCCGGTGCGCTGG + Intergenic
969716673 4:8871338-8871360 GCTGCTCGGGCCGGGCGCGCTGG - Exonic
970456277 4:16226757-16226779 GCTGCGCGGTCCCGCAGAGCGGG + Intronic
971451361 4:26804647-26804669 GCAGCGCAGGCCCGGCGGGCGGG + Intergenic
973531814 4:51843287-51843309 GCCGCCCGGCCCCGGCCCGCTGG - Intronic
974036347 4:56821578-56821600 TCGGAGCGGTCCTGGCGAGCGGG - Exonic
976261362 4:83147940-83147962 GTGGCGCGATCTCGGCGCACTGG - Intergenic
976704622 4:88007795-88007817 CCGGCCCGGGTCCGGCGCGCGGG - Exonic
978189659 4:105896438-105896460 CCGGAGCGGCCCCGGAGCGCGGG - Intronic
980130381 4:128811664-128811686 GCGGGGCGGGCGCGGCGGGCCGG - Intronic
982745686 4:159102954-159102976 GCGGGGCAGCCCCGTCGCGCCGG - Intergenic
984155884 4:176195619-176195641 GCGGCGCGGTCTCGTGGGGCGGG + Exonic
984823544 4:183905442-183905464 GCTGCGTGGACCCGGCGCCCCGG + Exonic
984964568 4:185128693-185128715 GCGTCGGGGTCCCGGCGCCGAGG - Intergenic
986330522 5:6713664-6713686 GCGGCGCGGGGCGGGCGCGGGGG - Intergenic
989229971 5:39074441-39074463 GGGGGGCGGGCGCGGCGCGCGGG - Intergenic
992473137 5:77077330-77077352 GCGCCGCGGCCCAGGCGCGCCGG - Exonic
995342254 5:111073028-111073050 GCGGCGGCGTCCCGGAGCCCAGG - Intronic
996862765 5:128084096-128084118 CCGCCGCCGTCCCGGCTCGCGGG - Exonic
998236188 5:140400900-140400922 GCGGCCGGGTCCTGGCGGGCGGG + Intergenic
998797465 5:145835258-145835280 GCGCCGCGGGCCCCGCGCACCGG + Exonic
1000052563 5:157575514-157575536 GGGTCGCGGTCCCAGCGCTCCGG + Intronic
1002092032 5:176811416-176811438 GCGCCGCGGTCCCGGTGGCCGGG + Intronic
1002165619 5:177343194-177343216 GTGGCGCGATCTCGGCTCGCTGG - Intronic
1005039467 6:21588189-21588211 GCTGCGCGTGCACGGCGCGCGGG - Intergenic
1005569732 6:27133197-27133219 GCGGGTCGGGGCCGGCGCGCCGG + Exonic
1005645902 6:27838192-27838214 GCGGGTCGGTGCCGGAGCGCCGG - Exonic
1005648555 6:27865480-27865502 GCGGGTCGGGGCCGGCGCGCCGG + Exonic
1005651960 6:27893002-27893024 GCGGGTCGGGGCCGGCGCGCCGG - Exonic
1005838384 6:29724288-29724310 CCGCCGCGGTCCAGGAGCGCAGG - Exonic
1005859289 6:29888582-29888604 CCGCCGCGGTCCAGGAGCGCAGG - Intergenic
1005864453 6:29927293-29927315 CCGCCGCGGTCCAGGAGCGCAGG - Intergenic
1006027833 6:31158564-31158586 GGGGCGCGGCCTCTGCGCGCGGG - Exonic
1006108372 6:31729858-31729880 GGGGCGTGGTTCCGGGGCGCTGG + Intronic
1006676301 6:35766030-35766052 CCACGGCGGTCCCGGCGCGCTGG + Intergenic
1006814261 6:36839863-36839885 GCGGCGCAGCCCGGGCGCTCGGG - Exonic
1007038847 6:38702912-38702934 GCGGCCCGGTCCCGGCCCAGCGG + Intronic
1007701789 6:43770134-43770156 GGGGCGGGGTCCCGGCGGGGCGG + Intergenic
1013242608 6:108260558-108260580 GCAGAGCGAGCCCGGCGCGCTGG - Intronic
1015149455 6:130020619-130020641 GAGCCGCGGTCCCCGCGCCCTGG - Intronic
1015315126 6:131808284-131808306 GCGGCCAGGCCCCGGCGCCCGGG + Intronic
1016400850 6:143678227-143678249 GCGATGCGCTCCCGCCGCGCGGG + Intronic
1017021298 6:150142709-150142731 GCGGCGCGTTTCCTGCGCTCCGG + Intergenic
1018669730 6:166168273-166168295 GCTGCGGGATCCGGGCGCGCTGG - Intronic
1019457473 7:1138053-1138075 GCCGCCCGGTCGCGCCGCGCCGG + Exonic
1019662566 7:2232827-2232849 GCGGCGGGGTCCCGGGGTCCCGG - Intronic
1020076660 7:5263034-5263056 GGGGCGCAGGCCCGGCGCACAGG - Intergenic
1020270209 7:6590217-6590239 GCGGCGCAGTCCCGGGCCCCGGG + Exonic
1021116739 7:16753611-16753633 GCGGAGCGGTCCCGGGGCGAGGG - Exonic
1024043806 7:45574426-45574448 GCGGCGAGGCGCCGGGGCGCGGG - Intronic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1025078850 7:55964977-55964999 GCGGCGCTGGCCCGGCCTGCAGG + Intronic
1025639036 7:63350032-63350054 GCGGCGTGGCCACGGCGGGCGGG + Intergenic
1025643663 7:63398060-63398082 GCGGCGTGGCCACGGCGGGCGGG - Intergenic
1027232635 7:76281656-76281678 GGGGCGCGGGCCGGGGGCGCCGG - Exonic
1028121421 7:87059717-87059739 GGGGCGCGGGCGCGGCGCGGGGG + Intergenic
1029290656 7:99499990-99500012 GCGGCGCCGTCCCAACGCGACGG - Exonic
1031051924 7:116953698-116953720 GCGCCGCGGGCCCGGCTCCCAGG - Intronic
1032074539 7:128830272-128830294 GCGGCGCGGCCCCCACCCGCGGG + Intergenic
1033253198 7:139777831-139777853 GCCGCCCGGGCCCGGCGCGGGGG + Intronic
1034426940 7:151018909-151018931 GCGGCGCGAGCCTGGCGCGCTGG - Exonic
1035021394 7:155803093-155803115 CCGCCGCGGTCCGTGCGCGCGGG + Exonic
1035169588 7:157010113-157010135 GCGACGGGCTCTCGGCGCGCAGG + Exonic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037822525 8:22141822-22141844 TCGCCGCGGTTCCAGCGCGCCGG + Exonic
1037886837 8:22599866-22599888 GCGGCGCGGGCTCCGCCCGCGGG - Intronic
1038311304 8:26448472-26448494 GCGGCACCGTCCCTGAGCGCTGG + Intronic
1039608364 8:38901024-38901046 GCGGGGCAGTCTCGGCGCGCAGG + Intergenic
1040599513 8:48870224-48870246 GCCGGGCGGTGGCGGCGCGCGGG - Intergenic
1042877008 8:73449099-73449121 GCTGCGCGGTCCCTGCTCGAAGG - Intronic
1042902791 8:73746231-73746253 GCGGCGGGGCCGGGGCGCGCCGG - Intronic
1044719821 8:95134216-95134238 GCGGGCCGGCCCCGGCGCGAGGG - Intronic
1044999812 8:97869423-97869445 GCGCCGGGGCCCCGGGGCGCTGG - Intronic
1045211660 8:100106003-100106025 GCGACGCGGCGACGGCGCGCGGG + Exonic
1045510714 8:102810436-102810458 GCGGAGCGGCCCGGGCGCGGCGG + Intergenic
1049194578 8:141308291-141308313 GCGGCGTTGTCTCCGCGCGCCGG - Intronic
1049509000 8:143018475-143018497 GCCGCGCGGCCCCGGGGCGGGGG - Intronic
1049643966 8:143727862-143727884 GCCGCGGGGTCCGGGCGCGAAGG + Exonic
1049645485 8:143733933-143733955 GGGGCGCGGGCCGGGGGCGCGGG - Intergenic
1049765657 8:144354176-144354198 GCGGCGCGGGGCCGGCCCTCAGG + Intronic
1051876891 9:21802836-21802858 GAGGCGCGGTCCCCCGGCGCGGG - Intronic
1053198383 9:36136832-36136854 ACGGCGAGGTCCGGGAGCGCGGG - Intronic
1055611811 9:78031700-78031722 GCGGCGAGGAGCGGGCGCGCCGG - Intergenic
1056386200 9:86099310-86099332 GACGCGAGGTCTCGGCGCGCGGG + Intronic
1056643099 9:88387949-88387971 GCGGCCCTGAACCGGCGCGCTGG + Intergenic
1057207822 9:93184142-93184164 CCGGCTCCGACCCGGCGCGCGGG - Intergenic
1057432318 9:95005231-95005253 GCGGCGCGGTCCCTGCGCCCCGG + Intronic
1057596433 9:96418828-96418850 GGGCCGCGGTTCCCGCGCGCAGG + Intergenic
1057772837 9:97983417-97983439 GCGGCGCGGTCCTGGGTGGCGGG - Exonic
1059102476 9:111483820-111483842 GCCGCGCGGGCCTGGCGCACGGG - Intronic
1060952267 9:127612018-127612040 GCCGCGCGCGCCCGGGGCGCAGG - Intergenic
1062472455 9:136712486-136712508 GCGGCGCGGCGGGGGCGCGCGGG - Intergenic
1062653496 9:137590324-137590346 GGGGCGAGGCCGCGGCGCGCCGG + Exonic
1186496351 X:10015244-10015266 TCGGCGCGGCCCGGGCGAGCAGG - Intergenic
1197709338 X:129654644-129654666 CCGCCGCGGCCCCGGCGAGCCGG + Exonic