ID: 932567870

View in Genome Browser
Species Human (GRCh38)
Location 2:72920850-72920872
Sequence CCCGGAAAGTTCCTGATCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932567870_932567882 24 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567882 2:72920897-72920919 CTGTAGAGACCCAGCCCCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 181
932567870_932567879 1 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567879 2:72920874-72920896 CTAGGAGCAACGCCTGGAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 155
932567870_932567877 -1 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567877 2:72920872-72920894 GTCTAGGAGCAACGCCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 83
932567870_932567876 -2 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567876 2:72920871-72920893 GGTCTAGGAGCAACGCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 87
932567870_932567881 23 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567881 2:72920896-72920918 GCTGTAGAGACCCAGCCCCCCGG 0: 1
1: 0
2: 0
3: 15
4: 184
932567870_932567875 -5 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567875 2:72920868-72920890 CCGGGTCTAGGAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
932567870_932567878 0 Left 932567870 2:72920850-72920872 CCCGAGATCAGGAACTTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 932567878 2:72920873-72920895 TCTAGGAGCAACGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932567870 Original CRISPR CCCGGAAAGTTCCTGATCTC GGG (reversed) Intronic
903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG + Intergenic
904171185 1:28592947-28592969 CCAGGGATGTTCCTGGTCTCTGG - Intronic
904360422 1:29967660-29967682 CCAGGCAAGTTCCTGCTGTCTGG - Intergenic
904389121 1:30169429-30169451 CCAGGAAAGGTCCTTATCTAGGG + Intergenic
906778998 1:48555770-48555792 CCCTGAGAGTGCCTGAGCTCAGG - Intronic
915448906 1:155990918-155990940 CCCGGAAAGCCCCTGACCTTTGG + Intronic
921325014 1:213980704-213980726 CGTGGAAGGTTCCTGCTCTCTGG - Intergenic
924734696 1:246745532-246745554 TCCAGAAAGTTCATGATCTCTGG - Intronic
1063080101 10:2759858-2759880 CCCAGAAAGTCCCTGTCCTCAGG + Intergenic
1067178724 10:43969316-43969338 CCTGGAGCCTTCCTGATCTCTGG + Intergenic
1070318771 10:75338675-75338697 TCCAGAAAGTTCCAGATCTCAGG - Intergenic
1071010781 10:80937976-80937998 CCCGGAAAGTTCTGGAGCTAGGG - Intergenic
1071450083 10:85785766-85785788 CACATAAAGTTCCTGATTTCAGG - Intronic
1073532359 10:104244201-104244223 CCCAGAAAGTTGCTTCTCTCTGG + Intronic
1074049622 10:109869739-109869761 CCAGGAAAGTCCCTGATATCTGG + Intronic
1075723639 10:124600885-124600907 AACGGAATGTCCCTGATCTCAGG + Intronic
1076046684 10:127299931-127299953 CCTGCAAAGTTCCTTATCTCAGG + Intronic
1076167614 10:128294888-128294910 CCCGGGATGTTTCTGTTCTCTGG - Intergenic
1076384264 10:130045583-130045605 CCGGGAACGTTTCTGTTCTCTGG + Intergenic
1077610104 11:3638829-3638851 CCTGGAGAGTTCCAGCTCTCAGG - Intronic
1086491123 11:87358730-87358752 CCAGGAAAGTCCCTGACCTGTGG + Intergenic
1088864352 11:113832995-113833017 TCCGAAAAGCTCCTGAACTCAGG + Intronic
1089145559 11:116327406-116327428 CTGGGCAAGTTCCTGATCACTGG - Intergenic
1090677101 11:129008566-129008588 CCTGGAAAGTTCCATGTCTCAGG - Intronic
1092704912 12:11271764-11271786 CCCTAAAAGTCCCTTATCTCAGG + Intergenic
1096594513 12:52686062-52686084 CTGGGAAAGTTCCTGGTCTGAGG - Intergenic
1096791549 12:54048052-54048074 CCCGGAAAGACTCTGATCTATGG + Intronic
1100412429 12:94334087-94334109 TCTGGAAGGTTGCTGATCTCAGG - Intronic
1106022828 13:25931102-25931124 CTCAGAAAGTTTCTGATCTGGGG - Intronic
1110492693 13:76127322-76127344 CCCCTAATCTTCCTGATCTCTGG - Intergenic
1111742911 13:92226950-92226972 CCCAGAAAGTCCCTGAACTGGGG + Intronic
1112919367 13:104592297-104592319 CATGGAGAGTTACTGATCTCAGG + Intergenic
1117029424 14:51652597-51652619 CCCGGAAAGTGCCTAGTCTGCGG + Intronic
1117097310 14:52312154-52312176 GCAGGAAATTTCATGATCTCAGG - Intergenic
1126134647 15:45378477-45378499 CGCGGAATGTTCCTGGCCTCTGG + Exonic
1127736012 15:61840026-61840048 CCCAGAGAGTTTCTGAGCTCTGG - Intergenic
1128464989 15:67902990-67903012 CCTGGAAGGGTCCTGACCTCAGG - Intergenic
1132214690 15:100053979-100054001 CCCGGAGAGTTCCAGATTGCAGG - Exonic
1135224989 16:20648008-20648030 GCTGCAAAGTTCCTGAGCTCTGG - Intronic
1137685391 16:50383218-50383240 CCAGGACAGTTCCTGACCTCAGG + Intergenic
1138201547 16:55092054-55092076 CCTGGAAAGTCCCTACTCTCTGG - Intergenic
1149158252 17:53660323-53660345 TCCGGAAAGGTCCTGAACACAGG + Intergenic
1150272136 17:63873440-63873462 CTCTGAATGTTCCTGGTCTCTGG - Intronic
1150275684 17:63896337-63896359 CTCTGAATGTTCCTGGTCTCTGG - Intronic
1152552550 17:81036923-81036945 CCACGAAAGTTCCTGCTTTCTGG - Intronic
1154236532 18:12611176-12611198 CCCTCAAATTTCCTGCTCTCTGG + Intronic
1161774840 19:6254782-6254804 CCCGCGTGGTTCCTGATCTCAGG - Intronic
1162515060 19:11142750-11142772 TCCGGGAGGTGCCTGATCTCCGG - Intronic
1164967132 19:32495092-32495114 TACCGAAATTTCCTGATCTCTGG - Intergenic
1165409066 19:35647632-35647654 CCCGTAAAGTGCCTGATGGCTGG + Intergenic
1167473349 19:49687238-49687260 CCCGGAAGCCCCCTGATCTCAGG - Intronic
927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG + Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
935102867 2:100013546-100013568 CCAGGATAGCTCCTGTTCTCTGG - Intronic
935366822 2:102302206-102302228 CCTGGAGAGTTTCTGAACTCTGG - Intergenic
935710119 2:105890932-105890954 CCCAGAAACTTCCTGCTCTGAGG - Intronic
938683727 2:133716896-133716918 CCCTTGAAGTTCCTCATCTCTGG + Intergenic
940743595 2:157541621-157541643 CCCTGAAGGTTCCTGATGTGGGG + Intronic
947427443 2:229996527-229996549 CCCTCAAAGATTCTGATCTCAGG + Intronic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
1170939279 20:20835124-20835146 CACTGAAAGTCCCTCATCTCAGG + Intergenic
1173844594 20:46179895-46179917 CTCATAAAGTTCCTGCTCTCTGG + Intronic
1175937293 20:62519652-62519674 TCAGGAAAGTCCCTGACCTCTGG - Intergenic
1179065997 21:38025362-38025384 CCCAGAAGGTCCCAGATCTCTGG + Intronic
1180721755 22:17914571-17914593 GCAGGCAAGTTCCTGCTCTCGGG - Intronic
1181675313 22:24447533-24447555 ACCTGGAAGTCCCTGATCTCTGG + Intergenic
1184664926 22:45983269-45983291 CCCTGGAAGTTCCACATCTCAGG + Intergenic
1184686256 22:46097765-46097787 CCAGGAAAGTTCTTAACCTCAGG + Intronic
1185055712 22:48577332-48577354 CCTGGAAACTTCCTGGTTTCAGG + Intronic
956723074 3:72135391-72135413 CACTGAAAGTTCCAGATCCCAGG - Intergenic
957287817 3:78239534-78239556 CCCGGAAATTTCATTATCACAGG - Intergenic
957730154 3:84124779-84124801 CCCAGGAAGCTCCTGACCTCAGG + Intergenic
961079943 3:124017794-124017816 CCCGGAATGGTCATGGTCTCTGG + Intergenic
961303187 3:125935329-125935351 CCCGGAATGGTCATGGTCTCTGG - Intronic
966559879 3:181308388-181308410 CCCTGAAAGTTTCTTCTCTCTGG - Intergenic
967885303 3:194329653-194329675 CCTGCAACTTTCCTGATCTCTGG + Intergenic
971056516 4:22919393-22919415 CCTGCAAAGTACATGATCTCAGG + Intergenic
974529428 4:63088792-63088814 CCCCCAAAAATCCTGATCTCAGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
985677496 5:1239611-1239633 CCCGAGCACTTCCTGATCTCAGG + Intronic
987159013 5:15120683-15120705 CATGGACAGTCCCTGATCTCTGG - Intergenic
990948058 5:61270469-61270491 CCAAGAAAGTACCTTATCTCAGG - Intergenic
994727156 5:103450306-103450328 CCAGGAAAGTTGATGATGTCTGG - Intergenic
998577188 5:143328806-143328828 CCCAATAAGTTCCTCATCTCTGG + Intronic
1001719893 5:173848229-173848251 TCCAGAAACTTCCTCATCTCAGG - Intergenic
1006255134 6:32826616-32826638 TCCTGAAAGTTTCTTATCTCAGG - Intronic
1006268225 6:32943315-32943337 CCCTCAAAGTCCCTGATCTCAGG + Intronic
1006269129 6:32950502-32950524 CCCAGAAAACTCCTGACCTCTGG + Exonic
1008341438 6:50369061-50369083 ACCAGAAAGTTTCTGAGCTCAGG - Intergenic
1011744945 6:90400317-90400339 CCAGGAAAGATGCTCATCTCCGG - Intergenic
1013474462 6:110494712-110494734 CCCAGCAGCTTCCTGATCTCTGG - Intergenic
1023014762 7:35955980-35956002 CCAGGAAAGATGCTCATCTCCGG + Intergenic
1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG + Intronic
1024066241 7:45739040-45739062 CCAGGAAAGATGCTCATCTCCGG - Intergenic
1024447106 7:49493718-49493740 CCCACAAAGTTCCTGACCCCTGG + Intergenic
1029972907 7:104806809-104806831 GAGGGAAAGTGCCTGATCTCAGG - Intronic
1033976121 7:147102303-147102325 TCAAGAAAGTTCCAGATCTCTGG + Intronic
1037697022 8:21232378-21232400 CCCTGAAGATTCCTGAACTCTGG + Intergenic
1047026302 8:120828202-120828224 CCCAGGAAGTACCTGATCTCAGG - Intergenic
1047360894 8:124168346-124168368 CCTGGAGAGTTCCTGACTTCAGG - Intergenic
1047705492 8:127495202-127495224 CACGGAAAGTTCCTCATGCCAGG + Intergenic
1049615501 8:143574107-143574129 ACCAGCAAGTTCCTGATCTCAGG - Intergenic
1059549277 9:115212299-115212321 CTCAGCAAGTTCCTGATTTCTGG - Intronic
1060764536 9:126283817-126283839 CCCGGAAAGCCCCTGCTCTCTGG - Intergenic
1061903761 9:133686085-133686107 CCGGGAATGTTCCTGAGCACTGG + Intronic
1062065959 9:134526341-134526363 CCCTGAAGGCTCCTGTTCTCCGG - Intergenic
1189137432 X:38563090-38563112 CCCGGACATTTCCTTATCGCTGG + Intronic