ID: 932568541

View in Genome Browser
Species Human (GRCh38)
Location 2:72924541-72924563
Sequence AGGTGAGGGTGCGCGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 368}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932568531_932568541 -1 Left 932568531 2:72924519-72924541 CCTGCGCCCGGAGCCCGGGTGGA 0: 1
1: 0
2: 1
3: 16
4: 201
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568522_932568541 16 Left 932568522 2:72924502-72924524 CCCCGGTCGCGGCCTGCCCTGCG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568533_932568541 -7 Left 932568533 2:72924525-72924547 CCCGGAGCCCGGGTGGAGGTGAG 0: 1
1: 0
2: 1
3: 33
4: 338
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568526_932568541 4 Left 932568526 2:72924514-72924536 CCTGCCCTGCGCCCGGAGCCCGG 0: 1
1: 0
2: 6
3: 67
4: 521
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568524_932568541 14 Left 932568524 2:72924504-72924526 CCGGTCGCGGCCTGCCCTGCGCC 0: 1
1: 0
2: 0
3: 19
4: 242
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568523_932568541 15 Left 932568523 2:72924503-72924525 CCCGGTCGCGGCCTGCCCTGCGC 0: 1
1: 0
2: 2
3: 17
4: 177
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568534_932568541 -8 Left 932568534 2:72924526-72924548 CCGGAGCCCGGGTGGAGGTGAGG 0: 1
1: 0
2: 2
3: 36
4: 299
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568521_932568541 17 Left 932568521 2:72924501-72924523 CCCCCGGTCGCGGCCTGCCCTGC 0: 1
1: 0
2: 1
3: 17
4: 240
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368
932568529_932568541 0 Left 932568529 2:72924518-72924540 CCCTGCGCCCGGAGCCCGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG 0: 1
1: 0
2: 2
3: 41
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932568541 Original CRISPR AGGTGAGGGTGCGCGGGTGC AGG Intronic
900349593 1:2228302-2228324 AGGAGCGGGGGCGCGGGCGCGGG - Intergenic
901477930 1:9503683-9503705 AGGTGTGGGTCCTGGGGTGCAGG - Intergenic
902213859 1:14922881-14922903 AGGTGAGGATGCGGGGGCGGGGG + Intronic
903291227 1:22315472-22315494 AGGGGAGGCTGCGGGGGTGTGGG + Intergenic
903652969 1:24932327-24932349 GGGGGAGGGGGGGCGGGTGCAGG + Intronic
904181345 1:28668852-28668874 AGGGGTGGGCGCGCGGGCGCGGG + Intronic
904690892 1:32292499-32292521 AGGGGAGGGTGCGTCGGAGCGGG + Intronic
904774383 1:32897755-32897777 AGGTGAGCTTGGGAGGGTGCCGG - Intronic
904896114 1:33819692-33819714 AGGTGAGGGTGCCCTGGGGAAGG - Exonic
906197128 1:43936234-43936256 AGGTGAGAGGGCGAGGGGGCGGG + Intronic
906204148 1:43978428-43978450 AGGTGGGGAGGCACGGGTGCTGG + Intergenic
907270958 1:53290836-53290858 TGGTGGGGGTGCGGGGGTGTTGG + Intronic
907489602 1:54800644-54800666 AGAGGAGCGTGCGCGGGGGCTGG - Exonic
912428719 1:109617064-109617086 AGGTGAGGGGGAGAGGGAGCTGG + Exonic
913275133 1:117130214-117130236 AGGTGAGGGTGGGGTGGTGAGGG - Intergenic
914393497 1:147242778-147242800 AGCCGAGGCGGCGCGGGTGCAGG + Exonic
915362866 1:155296099-155296121 AGGTGAGGGCGTTTGGGTGCGGG + Intronic
918511134 1:185316245-185316267 GGGCGGGGGTGTGCGGGTGCTGG - Intronic
919658187 1:200217704-200217726 GTGAGAGGGTGAGCGGGTGCAGG - Intergenic
919892158 1:201983165-201983187 AGGTGAGGGTGCAGGGCGGCTGG - Intronic
920445247 1:206011382-206011404 AGGTGAGAGTGTGGGTGTGCTGG + Intronic
920868209 1:209770713-209770735 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868212 1:209770733-209770755 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868228 1:209770894-209770916 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
920868230 1:209770914-209770936 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
924775937 1:247114531-247114553 AGGAGAGGGTGCGAGTGGGCGGG - Intergenic
1063145118 10:3289367-3289389 AGGTCAGGGTGTCCGTGTGCAGG - Intergenic
1065404773 10:25351422-25351444 AGTTGGGGGTGGGGGGGTGCTGG + Intronic
1065897317 10:30175437-30175459 AGGTGAGGGTGTGGGGGAGTAGG - Intergenic
1065993265 10:31032511-31032533 AGGTGGGGGCCCGCGGGAGCCGG - Intergenic
1066370420 10:34814855-34814877 AGGTGAGGGGCCGGGGGCGCGGG - Exonic
1066746161 10:38605177-38605199 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1069836434 10:71311344-71311366 AGGAGAGGATGCTCTGGTGCTGG - Intergenic
1070667135 10:78353253-78353275 AGGTGAGGGTGCGGGGTGGGAGG - Intergenic
1073461559 10:103668542-103668564 AGGTCCGTGTGCGCGGGAGCCGG - Intronic
1075519783 10:123136539-123136561 AGCAGAGGGTTTGCGGGTGCTGG - Intronic
1075522849 10:123154497-123154519 AGGCGACGGTGTGCGGGAGCGGG + Intronic
1075546413 10:123358520-123358542 ATGTGGGGGTGTGCGGCTGCAGG + Intergenic
1075702031 10:124476073-124476095 AGGTGAGGAGGCGCAGGTACGGG + Intronic
1076151638 10:128167199-128167221 AGGTGAGGGGGCGAGGGTGAGGG - Intergenic
1076882723 10:133247485-133247507 AGGTGCAGGTGCACTGGTGCAGG + Intergenic
1080473769 11:32571196-32571218 AGTTGATGATGCGGGGGTGCTGG - Intergenic
1082878926 11:58018882-58018904 AGGGGAGGGTGCAAGGGTGATGG + Intergenic
1083274429 11:61588614-61588636 AGGTGAGGGGGCGCAGAGGCCGG + Intergenic
1083285533 11:61656448-61656470 TGGTGAGGGTGCAGGGGTGCGGG + Intergenic
1083285556 11:61656522-61656544 TGGTGAGGGTGCAGGGGCGCGGG + Intergenic
1083285598 11:61656647-61656669 AGGAGAGGGTGCAGGGGTGCAGG + Intergenic
1083651631 11:64207865-64207887 AGGGGAGGGAGCGTGGGGGCAGG - Intronic
1083766673 11:64844717-64844739 AGGTGAGGGCGCGCTGGCGGCGG - Intergenic
1083777384 11:64900863-64900885 AGGTGAGGAGGAGCGGGTGCAGG - Exonic
1084045911 11:66567804-66567826 AGGGGAGGATGCCCCGGTGCAGG - Intronic
1084329552 11:68422734-68422756 AGGTGAGGGTGGGTAGGGGCAGG - Intronic
1085259445 11:75195894-75195916 AGGTGAAGGTGGGCAGGGGCAGG - Intronic
1085274880 11:75291994-75292016 AGGTGAGGGTGGGCAGGGCCAGG - Intronic
1086437909 11:86800229-86800251 GGGTGACGGCGCGCGGGTCCCGG + Exonic
1089316253 11:117593281-117593303 AGGTCAGGGTGGGCGGGAGCAGG - Intronic
1089639648 11:119839315-119839337 AGGTGGGGGTGGGAGGGTGGTGG - Intergenic
1089943264 11:122441229-122441251 AGGTGGGGCAGCGCGGGGGCGGG + Intergenic
1090068727 11:123525758-123525780 AGGTGAGGGTGGGGGGCAGCCGG + Exonic
1090202239 11:124865273-124865295 AGGTAAGGGTGGGAGGGTGGAGG + Intergenic
1090252012 11:125258149-125258171 AGCTGAGGTTGCAGGGGTGCTGG - Intronic
1092021610 12:5207247-5207269 GGGTGAGGGTGGGAGGCTGCAGG + Intergenic
1092286990 12:7134299-7134321 AGGTGAGGGTGGGCAGGCGATGG + Intronic
1094070963 12:26412424-26412446 AGTTGAGGGTGTGCGGGTGTGGG + Intronic
1095739388 12:45590510-45590532 GGGTGAGGGTGAGGGGGTGAAGG - Intergenic
1095949361 12:47773464-47773486 CGGGGCGGGTGCGCGGCTGCGGG + Intronic
1096227439 12:49875419-49875441 AGGAGAGGGTGAGGGGGTGAGGG + Intronic
1096741253 12:53695655-53695677 AGGCGAGGGCGCGCTGGGGCGGG + Intergenic
1096944742 12:55392243-55392265 TGGTGAGGGTGGCTGGGTGCTGG - Intergenic
1097020319 12:56016207-56016229 GGGTGGGGGTGAGGGGGTGCAGG - Intronic
1099413456 12:82359365-82359387 AGGTGAGGGGCTGCAGGTGCAGG + Intronic
1100329466 12:93570797-93570819 GGGTGAGAGCGCTCGGGTGCAGG - Intronic
1102036813 12:109775304-109775326 GGGTGAGGGTACGAGGGTGGGGG + Intergenic
1102955162 12:117054308-117054330 AGGTGAGGGTGTGAGGGGGTGGG - Intronic
1103011505 12:117461747-117461769 AGGTGAGGGTGAGGTGGTACGGG + Exonic
1103260156 12:119580474-119580496 AGGTGGGGGTGGGAGGGTGGGGG + Intergenic
1104413427 12:128578357-128578379 AGGTGAGGGAGGGCTGGTGAAGG - Intronic
1104470377 12:129025203-129025225 AGGTGTGGGTGTGTGGGTGCAGG - Intergenic
1104856763 12:131905784-131905806 AGGTGAGGGTGTACGCATGCTGG + Intronic
1104890936 12:132139840-132139862 AGGTGAGGCTGCGAGGGTCTTGG - Exonic
1104892863 12:132148734-132148756 AGGGGCGGGTGGGCGGGGGCCGG - Intronic
1104941979 12:132399530-132399552 TGGTGGGGGTGCGTGGGGGCGGG - Intergenic
1105014320 12:132776937-132776959 AGGTGACGGTTCACGGGGGCTGG - Exonic
1105851582 13:24340400-24340422 AGGAGAAGGTGCGGCGGTGCAGG + Intergenic
1106579796 13:31007613-31007635 AGGTGTGTGTGAGCTGGTGCAGG + Intergenic
1106730669 13:32538575-32538597 AGGTGAGGGTGGGGCGGTGGTGG - Intronic
1112308429 13:98296320-98296342 AGGAGAGTGTGCGCATGTGCTGG - Intronic
1113335239 13:109370752-109370774 AGGAGAGGGTGTGCCGGAGCTGG - Intergenic
1113437692 13:110306652-110306674 GGGTGAGGGTGCCTGGGAGCCGG - Intronic
1113510521 13:110850830-110850852 GGGTGAGGGTGCGGGGCTGGAGG + Intergenic
1113660859 13:112105566-112105588 AGTGGGTGGTGCGCGGGTGCGGG + Intergenic
1118910076 14:70054507-70054529 ATGTGAGGGGGGGCGGGTGGAGG + Intronic
1119644321 14:76337544-76337566 AGGTGTGTGTGGGCGGGGGCTGG + Intronic
1121410661 14:93746308-93746330 GGCTGAGGGTGCTGGGGTGCAGG + Intronic
1123012306 14:105355403-105355425 AGGGGAGTGCGCGCGGCTGCAGG - Intronic
1123062420 14:105600320-105600342 AGGCGAGGGTGCGCTTGTCCCGG + Intergenic
1123087163 14:105722048-105722070 AGGTGAGGGTGCGCTTGTCCCGG + Intergenic
1123437119 15:20262707-20262729 AGGTGATGGTTGGGGGGTGCTGG - Intergenic
1124210803 15:27763753-27763775 AGGTGAGGTTGCCCTGGTACTGG + Intronic
1128547799 15:68579364-68579386 TGGGGAGGGGGCGCCGGTGCCGG + Intronic
1128575334 15:68770428-68770450 AAGTGAGGGTGTGGGGCTGCAGG + Intergenic
1129856798 15:78830642-78830664 AGGTGTGGGTCCGCAGCTGCCGG - Intronic
1130512285 15:84600037-84600059 AAGGGAGGGTGCCCGGGTGTGGG - Intergenic
1131171985 15:90185164-90185186 AGGTGCGGGTGCAAGGGTGGGGG - Intronic
1132239571 15:100247746-100247768 AGGTGAGGGGGAGTGGGTGTGGG - Intronic
1132719733 16:1309772-1309794 AGGTGAGCGCGTGCGGGGGCCGG + Intronic
1132751297 16:1459086-1459108 AGGTGAGGGTGCGGTGGCCCTGG - Exonic
1132879163 16:2153719-2153741 AGGTGAGGGAGGGCTGGGGCTGG + Exonic
1132915528 16:2341489-2341511 AGGGGAGGGTGGGGGGGTTCGGG + Intergenic
1134656075 16:15949509-15949531 AGGTGAGCGGGCGCCGGGGCGGG + Intergenic
1135231936 16:20716643-20716665 AGGTGAGGGTGTGAGGATGTGGG - Intronic
1136270268 16:29144360-29144382 GGGTGTGGGGGCGCGGGTGGAGG - Intergenic
1136279659 16:29200854-29200876 AGCTCACGGTGTGCGGGTGCTGG + Intergenic
1136477986 16:30525287-30525309 CGGTGTGGATGCGCTGGTGCTGG + Exonic
1136478387 16:30526788-30526810 GGGGGAGGGTGGGGGGGTGCTGG - Intronic
1136736899 16:32474464-32474486 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
1137241669 16:46660313-46660335 AGGTGAGTGTCCGGAGGTGCTGG + Exonic
1137686666 16:50391399-50391421 GGGCGAGGGTGCGCGGGGGCGGG + Intergenic
1139346464 16:66306918-66306940 AGGGGAGGGAGCCTGGGTGCGGG + Intergenic
1139935147 16:70565082-70565104 AGGGGAGGATGAGCGGGAGCTGG + Exonic
1140407611 16:74721505-74721527 GGGTGAGGGTTCATGGGTGCAGG - Intronic
1141694848 16:85614395-85614417 AGCTGGGGGTGGGCGGGCGCAGG - Intronic
1141839762 16:86567165-86567187 GGGCGAGGGTGCGCGGGCGGCGG - Intergenic
1142073858 16:88106194-88106216 GGGTGTGGGGGCGCGGGTGGAGG - Intronic
1142278119 16:89133547-89133569 TGGTCAGGGTGCGTGCGTGCCGG - Intronic
1203016170 16_KI270728v1_random:355113-355135 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1203034505 16_KI270728v1_random:628271-628293 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1143030952 17:3966820-3966842 AGCTGAGGGTGCGGTGGAGCGGG - Intergenic
1143521222 17:7445408-7445430 TGGTGAGGGCGCGCGGGGGGTGG + Exonic
1144456411 17:15422576-15422598 AAGTGAGGGTGCCGGGGAGCTGG + Intergenic
1144572368 17:16407815-16407837 AGGTGAGGGTGGGAGGGAGGTGG + Intergenic
1145747274 17:27329512-27329534 AGGTGAGGGGGCGGGTGAGCAGG + Intergenic
1146642260 17:34550308-34550330 AGGTGAGGGTGCCTGGGGCCAGG + Intergenic
1146787285 17:35731615-35731637 AGGAGGGGGTGCGGGGGTGCGGG - Intronic
1146890023 17:36500923-36500945 ATGTGGGCGTGCCCGGGTGCTGG - Exonic
1146936723 17:36816695-36816717 AGGGGAGGGTGTGTGGGTTCTGG - Intergenic
1147210420 17:38869918-38869940 ACGTGGGGCTGCGCGGGGGCGGG - Exonic
1147587359 17:41660147-41660169 GGTTGAGGGTGTGGGGGTGCAGG - Intergenic
1147896374 17:43754406-43754428 AGGAGAGGGTCCGAGGGTGGTGG - Exonic
1148113494 17:45161280-45161302 AGGCGAGGCTGCGGGGCTGCCGG + Intronic
1148779377 17:50112872-50112894 AGGGGAGGGTGCACAGGCGCTGG - Exonic
1149778657 17:59378664-59378686 TGGTGAGGGGGCCTGGGTGCTGG - Intronic
1150283449 17:63942721-63942743 GGGTGAGCGTGTGAGGGTGCAGG + Intronic
1150649461 17:67000521-67000543 AGGAGAGGGGGCAAGGGTGCAGG + Intronic
1151122521 17:71808584-71808606 AGGTGAGTGTGTGCTGGTGGGGG - Intergenic
1151719531 17:75847466-75847488 AGGTGAGGGCCCTTGGGTGCTGG - Exonic
1152335693 17:79699314-79699336 AGGTGAGAGTGGGCGGGTCCAGG - Intergenic
1152335759 17:79699604-79699626 AGGTAAGAGTGGGCGGGTCCAGG - Intergenic
1152335771 17:79699646-79699668 AGGTGAGAGTGGGCGGGTCCAGG - Intergenic
1152468337 17:80477644-80477666 AGGCGCGAGTGCGCGGGTGCCGG - Intronic
1152771703 17:82173811-82173833 AGGTGAGGTGGCTCCGGTGCAGG + Intronic
1152815194 17:82403811-82403833 AGGTGAGCGTGCCCGTGGGCAGG - Intronic
1152900336 17:82937522-82937544 AGGTGAGGCAGCCCAGGTGCTGG + Intronic
1153525359 18:5989909-5989931 AGGTGAGGGTGAGAGCGTGAGGG + Intronic
1154485887 18:14871086-14871108 GGGTGAGGGTGTGCGGGTGAGGG - Intergenic
1154485911 18:14871162-14871184 GGGTGAGGGTGTGCCGGTGTGGG - Intergenic
1154485914 18:14871176-14871198 AGGTGAGGGTGTGCGGGTGAGGG - Intergenic
1160668590 19:344919-344941 AGGTGCGCGGGCGCGGGCGCGGG + Intergenic
1160722559 19:603966-603988 AGGTGAGGTGGGGCGGGGGCGGG + Exonic
1160723946 19:609295-609317 AGGGAAGGGAGCGTGGGTGCTGG - Intronic
1160726807 19:621003-621025 GGGGGAGGGCGCGGGGGTGCCGG + Intronic
1160754035 19:748454-748476 CGCTCAGGGTGAGCGGGTGCAGG - Intergenic
1160789900 19:918518-918540 CGGTGGGGATGCGCGGGCGCTGG - Intronic
1160968229 19:1755876-1755898 AGGTGGGGGTGTAAGGGTGCAGG + Intronic
1161164629 19:2779640-2779662 AAGTGAGGGTGGGAGGGTGCTGG + Intronic
1161531771 19:4793870-4793892 AGGTGAGGGTGCAGGCGTTCTGG - Exonic
1161568959 19:5019580-5019602 AGGTGTTGGTGTGCGGGTGTTGG + Intronic
1161610570 19:5240178-5240200 AGGTGAGGCAGCGCGGGGACGGG - Exonic
1161994080 19:7701862-7701884 TGGTGAGGGGGCGGGGGTGGGGG - Intronic
1162901000 19:13795555-13795577 AGGGCAGGGGGCGCGGGAGCCGG + Exonic
1162929951 19:13952753-13952775 AGGGGAGGGGGCTCGGATGCAGG + Intronic
1163478768 19:17542293-17542315 AGGTGAGGGTGAGAGGAGGCTGG + Exonic
1163484189 19:17576672-17576694 AGGTGGGGCTGGGGGGGTGCAGG + Intronic
1163685564 19:18710008-18710030 AAGTGTGGGGGGGCGGGTGCTGG - Intronic
1164684268 19:30156781-30156803 AGTTGAGGCTGCTGGGGTGCTGG - Intergenic
1165033103 19:33012521-33012543 AGGTGATGGTTGGGGGGTGCTGG - Intronic
1165213890 19:34255181-34255203 AGGGGAGGGTCCGCGGGGACCGG + Intronic
1166529375 19:43533520-43533542 AGGTGAGGGCGCAGGGGTTCGGG + Exonic
1166690828 19:44820577-44820599 AGGTGAGGATGGGGGTGTGCTGG - Intronic
1166748096 19:45151525-45151547 AGGAGAGGCTGCGGGGGTGGTGG - Exonic
1166768361 19:45265683-45265705 AGTTGTGGGTGTGAGGGTGCTGG + Intronic
1167074299 19:47239663-47239685 AGGAGGGGGGGCGCGGGCGCAGG - Intergenic
1168107489 19:54173542-54173564 AGGTGCGGGTGCGCGGGCCTGGG - Exonic
1168408027 19:56120889-56120911 GGGTGCGCGTGCGCGGGTCCGGG - Intronic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
925971942 2:9112202-9112224 AGATGAGGGTGCGTGTGTGGAGG - Intergenic
926112473 2:10192071-10192093 AGGCCAGGGTGGGCGGGGGCTGG + Intronic
928097531 2:28413626-28413648 AGGACAGGCTGAGCGGGTGCTGG - Exonic
928304363 2:30154428-30154450 TGGTGAGGGTTAGGGGGTGCAGG + Intronic
928516080 2:32046208-32046230 AGGTGGGTGTGGGTGGGTGCTGG - Intergenic
929587240 2:43124268-43124290 TGGTGAGTGTGTGAGGGTGCAGG - Intergenic
929788676 2:45009130-45009152 CGGTGAGGGCGCGCGCGGGCGGG - Exonic
929794371 2:45047649-45047671 AGGAGAGGGTGTGCATGTGCTGG - Intergenic
929994583 2:46817368-46817390 AGGTGAGGGTGAGAGGAAGCTGG + Exonic
932459800 2:71874883-71874905 GGGTGAAGGTGCGAGGGTGCTGG + Intergenic
932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG + Intronic
932779185 2:74549348-74549370 AGGTGAGGGGCCGCGGGCGCCGG - Exonic
933250576 2:80024572-80024594 AGGTGAGCGGGTGCAGGTGCCGG + Intronic
933578727 2:84100753-84100775 AGGTGGGGGTGTGAGGGGGCAGG + Intergenic
934188042 2:89763585-89763607 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
934308562 2:91844369-91844391 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
935303909 2:101718561-101718583 AGGTGGGGGTGGGGGGGTGGGGG + Intronic
937045981 2:118852148-118852170 ATGTGGGGGTGGGTGGGTGCTGG + Intergenic
937859442 2:126696467-126696489 TGTTGAGGGTGAGGGGGTGCTGG + Exonic
937904153 2:127044303-127044325 AGGTGTGGGTGTGAGGGTGAAGG - Intergenic
937993191 2:127675257-127675279 AGGTGACGGTGGGAGGTTGCGGG + Intronic
938073273 2:128319166-128319188 CGGTGAGGGGGCGCGGCGGCTGG + Intergenic
938240835 2:129741322-129741344 AGGCAAGGGTCCGCGGGTCCAGG + Intergenic
938288333 2:130136574-130136596 AGGTGAGGGTGCGTGGGCTCCGG - Intergenic
938427249 2:131202315-131202337 AGGTGAGGGTGAGTGGGCTCCGG + Intronic
938936814 2:136134507-136134529 AGTTGAGGGGGTGGGGGTGCGGG + Intergenic
942646154 2:178112845-178112867 AGGTGCGGGTGCCCGGGTCGGGG + Exonic
946408700 2:219506018-219506040 GGGTGAGGGTGTGCGGCTCCGGG + Exonic
947444882 2:230156129-230156151 AGATGGGGGTGCGGGGGTGGGGG + Intergenic
947549887 2:231038198-231038220 AGGTGAGACTGCGCGGGGCCCGG + Exonic
947722989 2:232380568-232380590 GGCTGGGGGTGGGCGGGTGCTGG - Intronic
947986295 2:234450420-234450442 TGGTGAGGGCACGCAGGTGCCGG + Intergenic
1168841944 20:915273-915295 AGGAGAGGGAGCAAGGGTGCGGG - Intronic
1169109515 20:3022843-3022865 AGGTGAGGGTGGGGGGTTCCAGG + Intronic
1170629942 20:18057514-18057536 AGGTGAGCGCGCGCGGGGGCCGG - Exonic
1171019486 20:21572219-21572241 GAGGGAGGGGGCGCGGGTGCAGG - Intergenic
1171209795 20:23308536-23308558 AGGTGTGTGTGCGCAGTTGCGGG - Intergenic
1172502496 20:35437277-35437299 AGGTGAGGGGGCGGGGTGGCAGG - Exonic
1172875646 20:38162780-38162802 AGATGAAGGTGCGCAGGGGCAGG + Intronic
1172974159 20:38894111-38894133 GGGCGGGGGTGCGGGGGTGCGGG - Intronic
1173605195 20:44326758-44326780 AGGCGCGGGGGCGCGGGGGCGGG + Intergenic
1174053595 20:47784140-47784162 AGGGGAGGCTGCGCTGGAGCAGG - Intronic
1174171225 20:48619362-48619384 AGAGGAGGGTGCGAGGGTGAGGG + Intergenic
1174287215 20:49482201-49482223 AGGTGAAGGCGCCCGGGTGGCGG + Exonic
1174682629 20:52423493-52423515 AGGTGAGTGAGGGTGGGTGCAGG - Intergenic
1175108025 20:56628414-56628436 AGGTGAGGGTGAGGAGGTGCAGG - Intergenic
1176091076 20:63318905-63318927 TGGGAAGGGTGTGCGGGTGCAGG + Intronic
1176795413 21:13368264-13368286 AGGTGGGGGTGTGTGGGTGGGGG + Intergenic
1176795422 21:13368292-13368314 AGGTGGGGGTGTGTGGGTGAGGG + Intergenic
1176795435 21:13368334-13368356 GGGTGAGGGTGTGCGGGTGAGGG + Intergenic
1176795439 21:13368348-13368370 GGGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176795443 21:13368362-13368384 GGGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176795445 21:13368376-13368398 GGGTGAGGGTGTGCGTGTGAGGG + Intergenic
1176795453 21:13368404-13368426 GGGTGAGGGTGTGCGGGTGAGGG + Intergenic
1178073281 21:28992749-28992771 ACCTGAGGGTGAGCGGGGGCTGG - Exonic
1178359036 21:31932844-31932866 GGGTGAGGATGCAGGGGTGCAGG - Intronic
1178660362 21:34502617-34502639 AGGTGAGTGAGTGCAGGTGCTGG - Intergenic
1179674952 21:42974836-42974858 CGGGGAGGGGGCGCGGGTGGGGG + Intronic
1179801974 21:43815359-43815381 CGGTGAGGGGGCGTGGCTGCAGG + Intergenic
1179925943 21:44534051-44534073 AGGTGAGGGGGCGCGGTGGATGG + Intronic
1180219286 21:46347850-46347872 GGGTGTGGGTGCTGGGGTGCCGG + Intronic
1180535648 22:16391448-16391470 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1181107886 22:20585455-20585477 AGGTGAGAGTGTGCGGGCTCTGG - Intronic
1181639173 22:24187842-24187864 AGGTGAGGGCGGGCAGGTGGGGG + Exonic
1182047210 22:27284758-27284780 AGGAGACAGTGCGCTGGTGCAGG - Intergenic
1182495168 22:30701722-30701744 AGTTGAGGGTGCAAGTGTGCAGG + Intronic
1183363375 22:37394486-37394508 AGGTGAGGCTGCCCGGGAGGAGG - Intronic
1183777989 22:39980356-39980378 AGGTGAGCGTGTGGGGGTGGCGG + Intergenic
1183936181 22:41263770-41263792 ACGTGAGGGTGAGCAGGGGCAGG - Intronic
1184060777 22:42079732-42079754 GGGTGCGGGTGCCCGGGTGAGGG + Exonic
1184108413 22:42381768-42381790 AGGTGAGGGAAGGAGGGTGCTGG - Exonic
1184332230 22:43834261-43834283 CGGTGTGGGTGCGGGAGTGCCGG - Intronic
1184523195 22:45007714-45007736 AGGGGCGGGTGTGCGAGTGCGGG + Intronic
1184757793 22:46526655-46526677 AGGGGAGGGCCCACGGGTGCAGG - Intronic
1185289066 22:50014959-50014981 CGGAGCGGGTGCGGGGGTGCTGG + Intergenic
1185349405 22:50326791-50326813 AGGTGAGCGGGCGCGAGCGCGGG - Exonic
949535896 3:4995852-4995874 TGGTGAGGGTGCGTGAGGGCAGG + Intergenic
950060182 3:10064564-10064586 AGCTAAGGGTGCAGGGGTGCTGG - Intronic
950301549 3:11883787-11883809 AGCTAAGGGTGCAGGGGTGCTGG - Intergenic
951737911 3:25887918-25887940 AGGGTAGGGTGGGCGGGTGCTGG + Intergenic
952528832 3:34242406-34242428 AGCTGAGGGTGGGCAGGGGCTGG + Intergenic
953456312 3:43045036-43045058 AGGTGAGGGTGTGAGGATGTGGG + Intronic
957210160 3:77248599-77248621 AGGTGAGCGAGCGCAGGAGCTGG - Intronic
962270849 3:133977031-133977053 AGGTGAGGCTGCCCGGGTGGTGG - Intronic
967055756 3:185826623-185826645 AGGCGTTGGGGCGCGGGTGCGGG + Intergenic
968556396 4:1248362-1248384 AGGGGACGGGGCGCGGGTGCCGG - Intronic
968563232 4:1295917-1295939 AGGTGTGGGTGAGGGGGTGCAGG - Intronic
968593834 4:1472525-1472547 AGGTCAGGGTGAGGGGTTGCGGG - Intergenic
969305942 4:6326398-6326420 AGCCGAGCGTGCTCGGGTGCGGG - Intronic
969700869 4:8766828-8766850 AGGTGAGGGTGGGCAGGTCGGGG - Intergenic
972670938 4:41213969-41213991 AAGTGAGGGTGGGCGCCTGCGGG - Intronic
973293114 4:48489896-48489918 CGGTGAGGGAGCGGGGGTGGGGG + Intergenic
977306428 4:95328912-95328934 AGGTGAGGGGGTGCAGGAGCTGG - Intronic
980053754 4:128061400-128061422 AGGTGAGGGCTCGCGGCTCCCGG + Exonic
980156858 4:129117956-129117978 AGGGGAGGATGTGAGGGTGCAGG - Intergenic
982198087 4:152936128-152936150 AGGTGAAGGTGAGCGCGTGGCGG + Intergenic
982786572 4:159543763-159543785 AGGTGAGGGGGTGCAGGAGCTGG + Intergenic
984300515 4:177911765-177911787 AGGTGAGTGTGTGCAGGAGCCGG + Intronic
984501688 4:180566017-180566039 GGGTGAGGGTGAGTGGGTGAGGG + Intergenic
984501725 4:180566204-180566226 AGGTGAGGGTGTGAGTGTGGGGG + Intergenic
984567004 4:181343132-181343154 TGGTGGGGGTGGGGGGGTGCGGG - Intergenic
984784406 4:183554322-183554344 AGGTGAGGGTGTGTGGATGGGGG + Intergenic
984954653 4:185033415-185033437 AGGTGAGGCTGCTGGGGTGGTGG - Intergenic
985696618 5:1344659-1344681 AGGTGAGCGTCCGCGGGGCCGGG - Exonic
985749460 5:1666081-1666103 AGGTGAGGATGCGGAGGTCCAGG + Intergenic
987258401 5:16179889-16179911 GGGTGACGGGGCGCGGGCGCGGG + Intronic
989500351 5:42159194-42159216 AAGTGATGGTGCCCGGGTTCTGG - Intergenic
991443892 5:66679701-66679723 CGGTGAGGGTGTGGGGTTGCAGG + Intronic
991454589 5:66788793-66788815 TGGTGAGTGTCCGCGGGCGCCGG + Exonic
993205301 5:84871185-84871207 AGGTCAGGGTGGGGTGGTGCTGG + Intergenic
995533706 5:113115166-113115188 AGGTGAGTGTGTGCAGGGGCCGG - Intronic
997206975 5:132055912-132055934 AGGCGAGGGTGCACAGGTGGAGG + Intergenic
997272934 5:132557006-132557028 AGCTGTGAGTGCGCGGTTGCGGG + Exonic
998092599 5:139380027-139380049 AGGTGAGGTTGCGCAGGTACTGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
999324221 5:150633125-150633147 AGGTGTGGGTGCATGGGTGGGGG + Intronic
1001430937 5:171661660-171661682 AGGGGAGGCTGCGCAGGTGTTGG - Intergenic
1001500972 5:172233806-172233828 AGGTGGGGGTGGGAGGGTGGAGG + Intronic
1001979726 5:176030620-176030642 AAGTGAGGGTGTGAGGGTGGGGG + Intronic
1002237439 5:177812501-177812523 GGGTGAGGGTGTGCGGGTGAGGG - Intergenic
1002237596 5:177812897-177812919 GGGTGAGGGTGTGTGGGTGGGGG - Intergenic
1002237691 5:177813143-177813165 AAGTGAGGGTGTGAGGGTGGGGG - Intergenic
1002275972 5:178104647-178104669 AGGTGAGGGTGTGTGGGTGGGGG + Intergenic
1002275988 5:178104687-178104709 GGGTGGGGGTGTGCGGGTGAGGG + Intergenic
1002433694 5:179218930-179218952 CTGTGAGGGTGTGCAGGTGCTGG - Intronic
1002724643 5:181286497-181286519 AGGTGAGGGTGTGCGGGTGGGGG - Intergenic
1005303855 6:24495349-24495371 AGGTGAGAGAGCCCGGATGCAGG + Exonic
1005984805 6:30864828-30864850 AGGTCAGGGTGGGAGGGGGCTGG - Intergenic
1006442025 6:34058953-34058975 AGGTAAGGCTGGGCGGGTGCAGG - Exonic
1007760088 6:44128202-44128224 AGGGCAGGGTTCGCAGGTGCTGG + Intronic
1011011770 6:82711351-82711373 AGGAGAGGATGCGAGGGTGGAGG - Intergenic
1013576053 6:111483838-111483860 GGGTGGGGGCGCGCGGGCGCGGG + Intergenic
1016467334 6:144338727-144338749 TGGTGAGGGTGGGCGGGAGATGG + Intronic
1018364081 6:163100281-163100303 CGGTGAGCGTGCACGGGTGGGGG - Intronic
1018823550 6:167392884-167392906 AGGTGAGGGGGCCCAGGTGAGGG - Intergenic
1018823575 6:167392965-167392987 AGGTAAGGGGGCGCAGGTGAGGG - Intergenic
1018823595 6:167393034-167393056 AGGTGAGGAGGCGCAGGTGAGGG - Intergenic
1018823605 6:167393075-167393097 AGGTGAGGGGGCACAGGTGAGGG - Intergenic
1018823630 6:167393172-167393194 AGGTGAGGGGGCGCAGGTGAGGG - Intergenic
1018823635 6:167393186-167393208 AGGTGAGGGGGCGCAGGTGAGGG - Intergenic
1018823640 6:167393200-167393222 AGGTGAGGGGGTGCAGGTGAGGG - Intergenic
1018823645 6:167393214-167393236 AGGTGAGGAGGCGCAGGTGAGGG - Intergenic
1018823655 6:167393255-167393277 AGGTGAGGAGGCGCAGGTGAGGG - Intergenic
1018823665 6:167393296-167393318 AGGTGAGGGGGCACAGGTGAGGG - Intergenic
1018823670 6:167393310-167393332 AGGTGAGGGGGCACAGGTGAGGG - Intergenic
1018823675 6:167393324-167393346 AGGTGAGGAGGCGCAGGTGAGGG - Intergenic
1018845328 6:167551782-167551804 AGGGGAGCGTGCCCGGGGGCTGG - Intergenic
1019105434 6:169663726-169663748 AGGTGAGGATGTGAGGGTGCTGG + Intronic
1019514277 7:1432932-1432954 AGGTGAGGCGGAGCGGGTGATGG - Intronic
1019625654 7:2014481-2014503 AGGTGAGGGGCCGCGGGCGTGGG - Exonic
1021299761 7:18958028-18958050 AGCTGAGGGTATGCAGGTGCTGG + Intronic
1024136320 7:46412588-46412610 AGGTGAGTGGGCGCAGGAGCCGG + Intergenic
1026935703 7:74254212-74254234 ACGTGAGGGTGGGCGAGTGGCGG - Intronic
1028985688 7:97006606-97006628 AGCTGAGGGTCCGCGGCGGCGGG - Intronic
1029037898 7:97541260-97541282 AGGTGTGGGTGGGTGGGTGCAGG + Intergenic
1029380455 7:100211078-100211100 AGGTGAGGGTGGGCGTGGGCGGG - Exonic
1029465146 7:100720688-100720710 ATGTGTGCGTGCGCGGGTGGGGG - Intergenic
1029495517 7:100894092-100894114 TGGTGACGGTGCGTGGGGGCCGG - Exonic
1031097957 7:117443515-117443537 AGGGGAGGGTGTGAGGGTGGTGG + Intergenic
1031187503 7:118501371-118501393 AGGTGAGGGTGAGAAGGTGAAGG + Intergenic
1032018001 7:128392136-128392158 GGGTGGGGGTGTGCTGGTGCAGG - Intergenic
1032092581 7:128918522-128918544 AGGTGGGGGTGCTGGGGTGTGGG - Intergenic
1034200858 7:149282148-149282170 CGGTGTGGATGCGCTGGTGCCGG - Exonic
1035056697 7:156040654-156040676 AGGGGAGGGTGAGGGAGTGCAGG - Intergenic
1035059188 7:156056595-156056617 GGGTGAGGATGCCGGGGTGCAGG + Intergenic
1035169904 7:157011306-157011328 AGGTGTGTGTGCGGGGGTGTGGG + Intergenic
1036212180 8:6851408-6851430 ATGTGCGGGTGCGCATGTGCCGG - Intergenic
1037788601 8:21918111-21918133 AGGTTGGGGTGCGGGGGTGGGGG + Intergenic
1037984129 8:23276198-23276220 AGGGGAGGGTGCGGAGGCGCAGG - Intronic
1040055787 8:43056190-43056212 GGGTGGGAGTGTGCGGGTGCTGG - Exonic
1041689881 8:60678634-60678656 AGGTGGCGGCGCGCGGGCGCGGG + Intergenic
1042516324 8:69663001-69663023 AGGTGAGGCAGGGCGGGAGCAGG - Intergenic
1044850821 8:96425506-96425528 AGGTGAGTGTGCATGGATGCTGG + Intergenic
1047113849 8:121818854-121818876 AGGTGAGTGGGCGCAGGCGCTGG - Intergenic
1049245410 8:141559810-141559832 AGGTGAGGGAGTGAGGGTGTGGG - Intergenic
1049292924 8:141813576-141813598 GGGTCAGGGTGTGAGGGTGCTGG - Intergenic
1049420913 8:142516225-142516247 AGGTGTGTGTGTGCGTGTGCGGG + Intronic
1049550003 8:143252792-143252814 GGGTGAGGGAGCGAGGGGGCGGG + Intronic
1049551466 8:143261849-143261871 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049551500 8:143261973-143261995 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049552623 8:143267483-143267505 AGGTGAGTGGGCGCGGGCGGCGG + Exonic
1049683867 8:143931513-143931535 AGGTGAGGGAGGGGGTGTGCAGG - Exonic
1049796776 8:144500611-144500633 AGGTGAGTGCGGGCGGGAGCAGG + Exonic
1050388733 9:5114533-5114555 AGGTGAGGGTGCGCTTGTCCTGG - Intronic
1051809256 9:21031507-21031529 AGGGGAGGGGGCGCGGGTGGAGG - Intronic
1052494923 9:29213454-29213476 AGGGGAGGCAGCGCCGGTGCGGG + Intergenic
1052852327 9:33385680-33385702 AGGTGAAGATGCGGGGGGGCAGG + Exonic
1052921590 9:33974939-33974961 AGGGGGGGGTGCGGGGGGGCGGG + Intronic
1052996097 9:34552289-34552311 AGGTGGGGGTGCCAGGGAGCTGG + Exonic
1053271603 9:36753490-36753512 AGGGGAGGCTGTGCGTGTGCAGG + Intergenic
1053680430 9:40482231-40482253 AGGTGAAGATGCGGGGGGGCAGG + Intergenic
1053886776 9:42649859-42649881 GGGTGAGGGTGTGGGGGTGAGGG - Intergenic
1053886782 9:42649873-42649895 GGGTGGGGGTGGGCGGGTGAGGG - Intergenic
1053886788 9:42649887-42649909 GGGTGAGGGTGTGTGGGTGGGGG - Intergenic
1053886804 9:42649927-42649949 GGGTGAGGGTGTGTGGGTGTGGG - Intergenic
1053886816 9:42649961-42649983 AGGTGAGGGTGTGCAGGTGTGGG - Intergenic
1053886826 9:42649997-42650019 GGGTGAGGGTGTGCGGGTAAGGG - Intergenic
1054225795 9:62457309-62457331 GGGTGAGGGTGTGGGGGTGAGGG - Intergenic
1054225801 9:62457323-62457345 GGGTGGGGGTGGGCGGGTGAGGG - Intergenic
1054225807 9:62457337-62457359 GGGTGAGGGTGTGTGGGTGGGGG - Intergenic
1054225823 9:62457377-62457399 GGGTGAGGGTGTGTGGGTGTGGG - Intergenic
1054225835 9:62457411-62457433 AGGTGAGGGTGTGCAGGTGTGGG - Intergenic
1054225845 9:62457447-62457469 GGGTGAGGGTGTGCGGGTAAGGG - Intergenic
1054283282 9:63142704-63142726 AGGTGAAGATGCGGGGGGGCAGG - Intergenic
1054504191 9:65894093-65894115 AGGTGAAGATGCGGGGGGGCAGG - Exonic
1056414472 9:86362878-86362900 GGGTGGGGGGGCGGGGGTGCGGG + Intergenic
1059305405 9:113349773-113349795 AGCTGCGGGTGAGCGGGTGTGGG + Exonic
1059483722 9:114611563-114611585 CGGTGAGTGTGCGCGGGCCCGGG + Exonic
1061048557 9:128180700-128180722 AGGTGAGGGAGGGAGGCTGCTGG - Exonic
1061163388 9:128909069-128909091 AGGTGAGGCGGTGCAGGTGCTGG - Exonic
1061282843 9:129607354-129607376 GGGTGAGGGTGGGCAGGTGGTGG + Intergenic
1061367816 9:130181706-130181728 AGGTGAGCGTGAGCGGGCCCGGG + Intronic
1061666369 9:132162836-132162858 AGGTGAGGGGGCGCAGGCACTGG + Intronic
1062540614 9:137040201-137040223 AGGTGAGGGTGCAGGGCGGCGGG + Intronic
1186788316 X:12973757-12973779 AGGTGGGGGTGAGCAGGGGCAGG - Intergenic
1187392304 X:18894183-18894205 AGGTGGGGGTGCCAGGGAGCTGG - Exonic
1187826279 X:23335225-23335247 AGGTGAGAGGGGACGGGTGCGGG + Exonic
1188268400 X:28107457-28107479 GGGTGAGGGTGAGGGGATGCTGG + Intergenic
1189101422 X:38194094-38194116 AGGTGAGGGTGAGGGGATGTAGG - Intronic
1189365436 X:40384380-40384402 AGGTGAGGGAGCGTTTGTGCCGG + Intergenic
1190481382 X:50880486-50880508 AGGTGAGGGTGTGTGTGTGTGGG + Intergenic
1190686015 X:52873760-52873782 AGGTGAAGGTGTGTGGGGGCAGG + Intergenic
1191085772 X:56565307-56565329 AGGTGTGGGGGTGGGGGTGCTGG + Exonic
1196606620 X:117664529-117664551 AGGTGGGGGTGGGAGGGTGGTGG - Intergenic
1196645796 X:118116623-118116645 AGCAGAGGGTGCGAAGGTGCGGG - Intronic
1196938432 X:120752440-120752462 AGGTGAGGGGGTGTGTGTGCTGG + Intergenic
1199428889 X:147736200-147736222 AGGTGTGTGTGGGCGGGTGGGGG - Intergenic