ID: 932568633

View in Genome Browser
Species Human (GRCh38)
Location 2:72924943-72924965
Sequence CTGCTGTTCCTGGGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932568629_932568633 -4 Left 932568629 2:72924924-72924946 CCGGTCCGCACTGGCTTTGCTGC 0: 1
1: 0
2: 0
3: 10
4: 188
Right 932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG 0: 1
1: 0
2: 2
3: 21
4: 175
932568627_932568633 7 Left 932568627 2:72924913-72924935 CCTGCGGGGAGCCGGTCCGCACT 0: 1
1: 0
2: 1
3: 3
4: 53
Right 932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG 0: 1
1: 0
2: 2
3: 21
4: 175
932568630_932568633 -9 Left 932568630 2:72924929-72924951 CCGCACTGGCTTTGCTGCTGTTC 0: 1
1: 0
2: 8
3: 84
4: 519
Right 932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG 0: 1
1: 0
2: 2
3: 21
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932568633 Original CRISPR CTGCTGTTCCTGGGCAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900954581 1:5878652-5878674 GTCCTGGTCCTGAGCAAAACAGG + Intronic
901038746 1:6351667-6351689 CTGCTGCTCCTGGGAAATGCTGG - Intronic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
902328835 1:15720552-15720574 CTGGTGTTCATGGATAAAACTGG + Intronic
902608357 1:17581987-17582009 CTGATGTTCCTGGACAGACCCGG - Intronic
907295532 1:53449968-53449990 CAGCTTTTCCTGGACAAAACAGG + Intergenic
907486508 1:54781685-54781707 CTGGTGTTCCTGGCCAAGGCGGG - Exonic
908419621 1:63947169-63947191 CTGCTGCTCCTGGGCCAACATGG - Intronic
908659133 1:66419168-66419190 CTCCTGTTCCTGCAAAAAACTGG - Intergenic
910191591 1:84601184-84601206 CTGCCGTACCTGGTCCAAACTGG - Intergenic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
913190125 1:116406408-116406430 CTGCTCTTCATGGGTAAAGCTGG + Intronic
913326494 1:117632769-117632791 CTGCTGTTCCTGGTCAGATCAGG - Intergenic
916575334 1:166061895-166061917 CTGCTGCTCCTGGACCATACTGG + Intronic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918313751 1:183305558-183305580 CTGTTTTTCCTGGGTAAAACAGG + Intronic
918521567 1:185420607-185420629 AGGCTGGTCCTGGGCAAAGCTGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921506708 1:215979858-215979880 CTTCTGTTCCTGGTTAAAAAGGG + Intronic
1063417494 10:5886069-5886091 TTGCATTTCCTGGGCAAAAATGG - Intronic
1063936180 10:11080978-11081000 CTGGTGTTCCTTTGAAAAACAGG + Intronic
1065717190 10:28583163-28583185 CTGCTGTTCCAGGACATATCAGG + Intronic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1067210994 10:44260504-44260526 CTGCTGCTTCTGGGCCAAATAGG - Intergenic
1067575963 10:47408884-47408906 CTTCTGTTCCTGGGAACAAAAGG + Intergenic
1067786958 10:49257292-49257314 CTACTGTTTTTAGGCAAAACTGG + Intergenic
1070601118 10:77867040-77867062 GTGCTCTTCCTGGGCATCACAGG - Intronic
1070658808 10:78290204-78290226 CTGCTCTTCCTGGGAATAAGAGG - Intergenic
1075729543 10:124628077-124628099 CTGCTGTTCCTGGGCCAGCAGGG + Intronic
1078251903 11:9623290-9623312 CTGCTGGCTCTGGGCAAAATGGG - Intergenic
1081639782 11:44744920-44744942 CTGCTGAGCCTGGGTAAAACAGG - Intronic
1082008304 11:47433422-47433444 CTGCTGCTCCTGAGCACATCAGG + Intergenic
1082698766 11:56402172-56402194 CTGCTGGCCCTGGGCAATAAGGG - Intergenic
1083654027 11:64220422-64220444 CTGCTGCTCCTGGGCGAGAGGGG - Exonic
1095444961 12:42273955-42273977 CTGCTGGTCCTGGGCAGCAAGGG - Intronic
1096193784 12:49635964-49635986 CTGATGGTCCTGAGCAAAGCTGG - Exonic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1103542139 12:121673352-121673374 TTGCTGTTCCTGGAAAATACTGG + Intergenic
1104021592 12:124995585-124995607 GAGCTCTTCCTGGGCTAAACCGG + Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1107402780 13:40085725-40085747 CTCTTGGTCCTGGGCAAACCAGG + Intergenic
1109274705 13:60290705-60290727 CTGCTGAACCTGGGCCCAACAGG - Intergenic
1111402584 13:87760540-87760562 CTGCTTTTTCTGTGGAAAACAGG + Intergenic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1119191295 14:72683879-72683901 GTGCTGTAGCTGGGCAAACCTGG + Intronic
1119385748 14:74257359-74257381 CTGCAGTTCCCGCGCAAAACTGG - Intronic
1119936252 14:78594757-78594779 CTCCTGTTCCAGGAGAAAACTGG + Intronic
1124130491 15:26980883-26980905 CTGCTGTTCCCCTACAAAACAGG - Intronic
1124170756 15:27370578-27370600 CTGAGATTCCAGGGCAAAACAGG - Intronic
1124350878 15:28954772-28954794 CTGCTAGTCCTGGGCACACCTGG + Intronic
1124662393 15:31560872-31560894 CTGCTGTTCCGGGTGAAAGCTGG - Intronic
1125170261 15:36759010-36759032 CTGCTTTTACTGGGCATAAGAGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1127558769 15:60114942-60114964 CTCTTGTTCCTGGGCACATCTGG - Intergenic
1128554740 15:68623685-68623707 CTGCTGCTCCTGGGAGCAACAGG - Intronic
1129859159 15:78846981-78847003 CTGCTGGTCCTGGGCAATGAGGG + Intronic
1132464301 16:70722-70744 CTGCAGCTCCTGGGCAGACCTGG - Intronic
1134817914 16:17221436-17221458 CTGTTCTTCCTTGGCAAAAGTGG - Intronic
1135354760 16:21759950-21759972 CTGCTGTTTCAAGGGAAAACTGG - Intronic
1135453244 16:22576089-22576111 CTGCTGTTTCAAGGGAAAACTGG - Intergenic
1135753251 16:25073926-25073948 CTGCTCTTCCTAGACAAATCAGG - Intergenic
1136557976 16:31019870-31019892 CTTTTGTTCCTGAGCACAACAGG + Intergenic
1137393896 16:48103651-48103673 CTGCTGTTCCTGGGGTGAGCTGG - Intronic
1137395285 16:48112745-48112767 CTGCTTCTCCTGGGCTAAATGGG - Intronic
1138282510 16:55782880-55782902 CTGGCGTTCCTGAGCTAAACAGG + Intergenic
1138286431 16:55813739-55813761 CTGGCGTTCCTGAGCTAAACAGG - Intronic
1141484520 16:84330018-84330040 GGGCGGTTCCTGGGAAAAACTGG + Intergenic
1141667957 16:85475597-85475619 CTGCAGTGCCTGGGCAATTCTGG + Intergenic
1144287772 17:13795076-13795098 CTGCTGTTGTTGGACAAAACTGG - Intergenic
1144703554 17:17353400-17353422 CAGGTGTTCCTGGGTAAAGCAGG + Intergenic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1145821987 17:27845523-27845545 CCACTATTCCTGGGCAAACCTGG + Intronic
1149461827 17:56834695-56834717 CTGCCTTTCCGGGGCCAAACCGG - Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1154165967 18:12014727-12014749 CAGCAGTGCCTGGGCAAAATCGG - Intronic
1155974333 18:32111898-32111920 CTGCAGATGCTGTGCAAAACAGG + Exonic
1157433882 18:47652577-47652599 CTCCTAGTCCTGGGCAAACCAGG - Intergenic
1158676625 18:59525870-59525892 CATCTGCTCCTGGACAAAACTGG - Intronic
1159035174 18:63270299-63270321 CTGTTCATCCTGGGAAAAACTGG + Intronic
1168275705 19:55277201-55277223 CTGCTGTTCCTGAACACACCAGG + Intronic
925416519 2:3673548-3673570 CAGATTTTCCTGAGCAAAACAGG - Intronic
926332073 2:11833877-11833899 CATTTGTTCCTGGTCAAAACAGG - Intergenic
927717078 2:25359909-25359931 CTGATTTTCCTGAGCAGAACTGG + Intergenic
929032231 2:37659923-37659945 CTGCTGTTCCTGGCCTGAGCGGG + Intronic
929462998 2:42118318-42118340 CTCCTGCTTCTGAGCAAAACTGG + Intergenic
932358037 2:71082718-71082740 TTCCTGTTTCTGGGCAAAACTGG - Intergenic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
938953417 2:136278033-136278055 CTTCTGTTCCTGGGCAATAAGGG + Intergenic
939776482 2:146393439-146393461 TTGTTCTTCCTGGGAAAAACAGG + Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
945188706 2:207165570-207165592 CTGCTGCTGCCGGGCAAAACGGG + Exonic
946599557 2:221344473-221344495 ATGACTTTCCTGGGCAAAACAGG - Intergenic
948718637 2:239882332-239882354 GGCCTGTTCCTGGGCCAAACAGG - Intergenic
1170495640 20:16921896-16921918 CTGCCTTTCCTGGGAAAAACTGG + Intergenic
1171214447 20:23342098-23342120 CTGCTGATGCTGGGCAAACCAGG + Intergenic
1171451012 20:25236478-25236500 CTGCTCTTCCTGCCTAAAACGGG - Intergenic
1173883931 20:46440141-46440163 CTCCTGCTCCTGGGAGAAACTGG - Intergenic
1175093736 20:56525167-56525189 CTCATGGTCCTGGGCAAAGCTGG + Intronic
1175094929 20:56533700-56533722 CTCATGGTCCTGGGCAAAGCTGG + Intronic
1175393067 20:58639376-58639398 CTTCTGTTCCAAGGCAGAACAGG + Intergenic
1175906410 20:62381704-62381726 CAGCTGTTTCTGGGCCAAGCAGG - Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1177393607 21:20507061-20507083 CTCCTGTTCCTTGGCAATAGGGG + Intergenic
1179097040 21:38325248-38325270 CTGCTGTTGCTGTCCAAATCCGG - Intergenic
1179928529 21:44551702-44551724 CGGCTGGTCCTGGGCAGGACCGG + Intronic
1180107700 21:45630654-45630676 GTGCAGTTCCTGGGCCAGACGGG + Intergenic
1181015624 22:20066838-20066860 CTGCTCTTCCTGGGCAGGCCGGG - Intergenic
1181493978 22:23277672-23277694 CTGCTGAGCCTGGGCAAGTCTGG + Intronic
1185049320 22:48545614-48545636 CTGCTATTCCTGGGCAGACAGGG + Intronic
1185107175 22:48880037-48880059 CTGGAGTTCAAGGGCAAAACTGG - Intergenic
949797071 3:7863023-7863045 ATGCTGTACCGGGGCAGAACAGG + Intergenic
950612158 3:14133608-14133630 CTGCTGCGCCTGGGCTAATCTGG + Intronic
950929245 3:16772513-16772535 CACCTGTACCTGGACAAAACGGG - Intergenic
951547438 3:23841951-23841973 CTGCTGTTAGAGGGCAAAATGGG + Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
960134744 3:114093931-114093953 CTGCTGTACCAAGGCTAAACTGG + Intergenic
961623252 3:128241001-128241023 CGGGTGTTCCAGGACAAAACGGG - Intronic
965014754 3:163142643-163142665 ATGCTGTTTCTGGGAAAAAAAGG - Intergenic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965653113 3:170953902-170953924 CTGCTGCTGCCGAGCAAAACCGG + Intergenic
966248891 3:177839627-177839649 GTGCTGTGCCTGGGTATAACAGG + Intergenic
966443217 3:179970453-179970475 CTCCTGCTCCTGGGTAAAACAGG - Intronic
966985399 3:185175513-185175535 CTCCTGTTCCTGGGCAGGGCTGG - Intergenic
967139398 3:186541544-186541566 CAGCTCTTCATTGGCAAAACAGG + Intronic
967845272 3:194037980-194038002 CTTCTGTTCCTGGGCTCAAGTGG + Intergenic
968430282 4:554402-554424 CTGCTGTTGACGGGGAAAACAGG - Intergenic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG + Intergenic
977320595 4:95510868-95510890 CTTCTTTTACTGGGCAGAACAGG + Intronic
978939947 4:114424085-114424107 ATCCTGTTCCTAGGGAAAACTGG + Intergenic
983188646 4:164730146-164730168 CTGCTGTTCCAGCTCCAAACTGG - Intergenic
983444526 4:167833091-167833113 CTGATGCTTCTGGGCAAAAGTGG - Intergenic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
991057140 5:62333770-62333792 ATGCAGATGCTGGGCAAAACAGG - Intronic
991598270 5:68326657-68326679 CAGGTGTTCCCTGGCAAAACAGG + Intergenic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
993074477 5:83211300-83211322 CTGCTGTACCTGAGCTAAAGAGG + Intronic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
997204137 5:132031732-132031754 CTGTTGCTCCTGGGCCAAGCTGG - Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
999314793 5:150576482-150576504 CTTGTGTTCCTGGGGAAACCAGG - Intergenic
999728656 5:154458598-154458620 TTGGTGCTTCTGGGCAAAACTGG + Exonic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1006239259 6:32663449-32663471 TTGCTGCTTCTGGTCAAAACTGG + Intronic
1007232618 6:40358901-40358923 CTACTGATCCTGGGCTAAAAAGG + Intergenic
1007334115 6:41139136-41139158 CTGTGATTCCTGGGCAAACCTGG - Intergenic
1012369600 6:98487186-98487208 CTGCTATTCCTGAGCAGAATGGG - Intergenic
1012968759 6:105704309-105704331 CTGCTTCTCCTGGGAAAAGCTGG + Intergenic
1019300481 7:300667-300689 CTGCTGGTCCTGGGGACAAGTGG - Intergenic
1019587864 7:1814731-1814753 CTTCTGTTCCTGGGCGCAAGGGG - Intergenic
1020543593 7:9493730-9493752 CTGCTGGTCATGGGCAGAACAGG - Intergenic
1021171074 7:17398587-17398609 TTGCTTTTCCTGGGTAAAACAGG + Intergenic
1025858293 7:65303574-65303596 ATGTTGTTCCTGGACCAAACTGG - Intergenic
1027698401 7:81437978-81438000 TTGCTGTTTCTGGACAGAACAGG + Intergenic
1028984847 7:97001776-97001798 CTGCTGTTCCTGGTCTGGACCGG - Intergenic
1031652752 7:124311270-124311292 CTGCTGATCCAGGCCAACACAGG + Intergenic
1035495613 7:159323034-159323056 GTGCTATTCCTGGACCAAACTGG - Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041257893 8:55995186-55995208 CTGCTGTTTCTGGGCAGCAGAGG + Intronic
1041320162 8:56604331-56604353 CTGCTGATCCTGGTGCAAACAGG - Intergenic
1042038675 8:64567015-64567037 GTGATGTTCCTGGGAAAAATAGG - Intergenic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1050684099 9:8147629-8147651 CTGCTATACCTGGACAGAACAGG + Intergenic
1051859045 9:21603463-21603485 GTACTGTTCCTGGGCAAAAAAGG - Intergenic
1052171969 9:25410480-25410502 CTGTTTTTCCTGGGCATAAAGGG - Intergenic
1057502551 9:95607233-95607255 CTGCTGTTCCAAGCCAAACCCGG + Intergenic
1058582894 9:106478389-106478411 CAGCTTTTTCTGGGCAAAAGGGG + Intergenic
1060254703 9:122017014-122017036 CTGCTCTTCATTTGCAAAACCGG - Intronic
1061836986 9:133336052-133336074 CTGCTGTTCCGGGGCCGAATGGG + Exonic
1185970977 X:4663263-4663285 CTGCTGTTGCTAGGCAAAGTGGG - Intergenic
1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG + Intergenic
1188971307 X:36618891-36618913 CTGCTGCTTCTTTGCAAAACTGG - Intergenic
1189268166 X:39731926-39731948 CAGCTGTTTCTTGGCAGAACTGG - Intergenic
1189973981 X:46444551-46444573 GTGGTGATCCTGGGCAAAGCTGG + Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1193135171 X:77962670-77962692 CTGCTGCTCCTGCTCAAAACGGG - Intronic
1193645504 X:84064249-84064271 GTGGTGTTCCTAGGCCAAACTGG - Exonic
1193944820 X:87722595-87722617 CTGGTGGACCTGGACAAAACAGG - Intergenic
1197868115 X:131039712-131039734 CTTCTGTTCCTGGCCAACTCAGG - Intergenic
1199165975 X:144675804-144675826 TTGGGGTTTCTGGGCAAAACTGG - Intergenic
1199253614 X:145693536-145693558 TTTCTGTTCCTTGGTAAAACAGG + Intergenic
1199320729 X:146435480-146435502 CTGCTGATCCTAGGAAAAAATGG + Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic