ID: 932570472

View in Genome Browser
Species Human (GRCh38)
Location 2:72935821-72935843
Sequence GAAACCTAGCTGCAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932570472_932570475 -1 Left 932570472 2:72935821-72935843 CCTCCATGTTGCAGCTAGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 932570475 2:72935843-72935865 CTCTTCCTTGCACCCAAACAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
932570472_932570474 -2 Left 932570472 2:72935821-72935843 CCTCCATGTTGCAGCTAGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 932570474 2:72935842-72935864 TCTCTTCCTTGCACCCAAACAGG 0: 1
1: 0
2: 0
3: 19
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932570472 Original CRISPR GAAACCTAGCTGCAACATGG AGG (reversed) Intronic
908980949 1:69958307-69958329 GGATCCTAGCTCCAAAATGGAGG + Intronic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
910698771 1:90049765-90049787 GAAAATTAGCTGTAGCATGGTGG - Intergenic
923498049 1:234541923-234541945 GAGGCCCACCTGCAACATGGAGG - Intergenic
924051047 1:240079882-240079904 GATACCTATCAGAAACATGGTGG + Intronic
1067348503 10:45455525-45455547 TAAACCCAGGTGCAAAATGGGGG + Exonic
1070175937 10:73969341-73969363 AAAACTTTGTTGCAACATGGAGG + Intergenic
1075075169 10:119345746-119345768 GAAACCCAGCAGCAGCATGGTGG + Intronic
1075423594 10:122324818-122324840 GAAGCCAAGAAGCAACATGGCGG - Intronic
1081878920 11:46431099-46431121 GAAACCTTTCTGTAGCATGGGGG + Intronic
1088611902 11:111585448-111585470 GTTAGCTAGCTACAACATGGTGG + Intergenic
1088853140 11:113721816-113721838 GAAACCTGGTAGCCACATGGGGG - Intergenic
1089394013 11:118123197-118123219 GAAACCTAACTTCAAAATGAAGG + Intergenic
1090855635 11:130607599-130607621 GAAACCGAACTGTCACATGGAGG + Intergenic
1096473458 12:51893856-51893878 GAAATCTAGCTCCATCCTGGAGG - Intergenic
1096973213 12:55683865-55683887 GAAAACTTGCTGCCACATGAAGG - Exonic
1097925169 12:65119253-65119275 TGAACCTATCTGCAAAATGGGGG + Intronic
1100548500 12:95625157-95625179 GAAACACAGATGCAAAATGGAGG + Intergenic
1101016839 12:100510559-100510581 GAAAAATATCTGCAACATAGAGG - Intronic
1107375597 13:39800953-39800975 GAAATCTACCTTCAACATGGTGG + Intergenic
1108633265 13:52307796-52307818 GAATCCTATTTGCAACATGGAGG - Intergenic
1108633739 13:52312174-52312196 GAATCCTATTTGCAGCATGGAGG - Intergenic
1108634154 13:52315877-52315899 GAATCCTATTTGCAACATGAAGG - Intergenic
1108653425 13:52504766-52504788 GAATCCTATTTGCGACATGGAGG + Intergenic
1108689720 13:52849814-52849836 GAAACCTGGCAGGAACGTGGGGG + Intergenic
1111914109 13:94343105-94343127 GACACCTCGTTGCTACATGGGGG - Intronic
1112649946 13:101385100-101385122 TAGACCTGGCTGCATCATGGAGG - Intronic
1112664100 13:101549498-101549520 GAAAAATGGCTGCAACATGATGG + Intronic
1117128354 14:52657006-52657028 GAAAACTAGCTAAAACAGGGAGG + Intronic
1119932402 14:78560725-78560747 GACACTTAGCTGGAACCTGGGGG + Intronic
1121824034 14:96995897-96995919 GAAAACTAGCTGCAACAGGAAGG - Intergenic
1122159950 14:99775691-99775713 AAAACGTAGCTTCCACATGGCGG - Intronic
1124869665 15:33528115-33528137 GAACCCTGACTGCAAAATGGTGG - Intronic
1127071643 15:55292633-55292655 AAAACCTAGTTGCAACCAGGAGG + Intronic
1127510459 15:59635657-59635679 GAAACAAAGCTGCAATATGCAGG - Intronic
1128183392 15:65624320-65624342 AAAACCTAGCTCCGAAATGGGGG + Exonic
1131112825 15:89776252-89776274 GACACCTCTCTGCAACCTGGCGG + Intronic
1131243951 15:90773781-90773803 GAAAACAGGCTACAACATGGAGG - Intronic
1138191935 16:55020783-55020805 GGGACCCAGCTGCAGCATGGAGG - Intergenic
1138856367 16:60698174-60698196 CAAACCTAGATCCAGCATGGAGG + Intergenic
1144481289 17:15631530-15631552 GAAACCTAGATGAGAGATGGCGG + Intronic
1144917018 17:18732201-18732223 GAAACCTAGATGAGAGATGGCGG - Intronic
1147245355 17:39116687-39116709 GAAACCCAGCTTCAACACGGAGG + Intronic
1149890759 17:60388525-60388547 CAAACTTAGATGCAACAAGGAGG + Intronic
1152214212 17:79023193-79023215 AAAATCCAGCTGCAACATCGAGG + Intronic
1158953598 18:62520249-62520271 GCAACCCAGCTGCAAAAAGGAGG + Intergenic
1159050778 18:63419292-63419314 TAATCCCAGCTGCTACATGGGGG + Intronic
1163071743 19:14848400-14848422 CAATCCTAGCTGCAACAGAGTGG - Intergenic
1163310651 19:16512519-16512541 AAAACCTAGCAGAAAAATGGAGG + Intronic
925327989 2:3037564-3037586 GAAACCTCGCTCTGACATGGGGG + Intergenic
929985470 2:46727529-46727551 GAAAGCTGGCTGCAACTTGAAGG - Intronic
932570472 2:72935821-72935843 GAAACCTAGCTGCAACATGGAGG - Intronic
941296762 2:163748653-163748675 AAAGCCAAGCTGAAACATGGTGG + Intergenic
941680968 2:168399006-168399028 AAAACGGAGCTACAACATGGTGG - Intergenic
942900647 2:181113392-181113414 CAAAAGTAGCTGCAAGATGGTGG + Intergenic
948015945 2:234690657-234690679 GACAGCAAGCTGCAGCATGGTGG - Intergenic
1170318047 20:15063866-15063888 TAAATCTAGCTGCAACAAGTTGG + Intronic
1176735114 21:10539188-10539210 AAATCCTATTTGCAACATGGAGG + Intronic
1176735645 21:10543815-10543837 GAATCCTATTTGCAACATGGAGG + Intronic
1178280698 21:31280249-31280271 GAAACGTAGTTGAATCATGGAGG + Intronic
1178567142 21:33698051-33698073 AAAACCTAGCTACAACATAAAGG - Intronic
1179513782 21:41892502-41892524 GAACCCAGGCAGCAACATGGAGG + Intronic
1182277190 22:29197441-29197463 GATACAAAGCTACAACATGGAGG - Intergenic
1182497676 22:30721347-30721369 GAAGACTAGCTGCCCCATGGAGG + Intronic
1183343940 22:37296543-37296565 GAAGCCCAGCTGCCACCTGGTGG - Intronic
1183533561 22:38379925-38379947 GAATCCTATTTGCAACATGGAGG - Intronic
1184958543 22:47910800-47910822 TAAACCAAATTGCAACATGGTGG + Intergenic
959086649 3:101857312-101857334 GCAAGCTGGCAGCAACATGGAGG - Exonic
961132370 3:124481122-124481144 TATACCTAACAGCAACATGGGGG - Intronic
964563914 3:158028655-158028677 GTAGACTAGCTGCAAGATGGGGG - Intergenic
964585885 3:158301343-158301365 GAATGCTGGCTGTAACATGGAGG - Intronic
965337087 3:167439462-167439484 GAAAACTACCTGGAACATAGTGG + Intergenic
971389827 4:26175485-26175507 GAAACCTCCCTGCAACTTGCGGG - Intronic
972998344 4:44912335-44912357 GAAAACTAACTTCAAGATGGAGG - Intergenic
974821883 4:67077356-67077378 GAAACCTAGCTGCTCAATGAAGG - Intergenic
981422673 4:144569530-144569552 GAACACTACCTGGAACATGGAGG + Intergenic
984148113 4:176090124-176090146 ATACCCTAACTGCAACATGGGGG - Intronic
986068513 5:4259461-4259483 GAGCCCAAGCTGCAGCATGGTGG + Intergenic
988280476 5:29139549-29139571 CAAACATAGCTGCACCAGGGAGG - Intergenic
991560479 5:67946208-67946230 GAAACTTATTTGCAACTTGGTGG + Intergenic
995701053 5:114936059-114936081 AAGACCTAGCTGCAATAAGGTGG - Intergenic
1002308988 5:178302946-178302968 GAAAACTAGCAGCCACTTGGAGG - Intronic
1003720338 6:8694269-8694291 GAAACCTCATTGCAAAATGGAGG + Intergenic
1006131286 6:31870864-31870886 GAAACCCAGCTGGGAGATGGAGG + Exonic
1012074522 6:94668182-94668204 GAAAGGTAGCTGAATCATGGGGG + Intergenic
1012882902 6:104813055-104813077 GGAGCCTAGTTGGAACATGGAGG - Intronic
1016214324 6:141578595-141578617 GAAACCTAACTTCAAAGTGGTGG + Intergenic
1018719344 6:166561119-166561141 GAAACACACCTCCAACATGGAGG - Intronic
1026348454 7:69495127-69495149 CAAACCGAGCTGAGACATGGAGG + Intergenic
1030106412 7:105990971-105990993 CAAACCTAGCTGCAAAGGGGCGG + Intronic
1033684999 7:143630871-143630893 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033688172 7:143710090-143710112 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033699614 7:143826750-143826772 TAACCCAAGCTGCAACAAGGGGG + Intergenic
1034693643 7:153034833-153034855 GAAACCTTTCAGCAGCATGGTGG + Intergenic
1034970578 7:155416899-155416921 GAAGACTAGCTGAAACAGGGAGG + Intergenic
1035114299 7:156509872-156509894 GCAACCTAGCTTCACTATGGTGG + Intergenic
1038318071 8:26504132-26504154 AAAACTTAGCTGGAACGTGGTGG + Intronic
1043128749 8:76434029-76434051 GAAACCTAGAAACAACAAGGTGG + Intergenic
1043392212 8:79802828-79802850 GAAATCTATTTGCAACATGGAGG + Intergenic
1047174430 8:122527084-122527106 GAAACCTAACAAGAACATGGAGG - Intergenic
1048796168 8:138152094-138152116 GACACCAAGCAGCAAGATGGAGG - Exonic
1050822737 9:9901351-9901373 AAAACCTAGAGGCAACATGTGGG + Intronic
1052546083 9:29881487-29881509 AAATACTAACTGCAACATGGTGG - Intergenic
1054873045 9:70066935-70066957 GGAACCCACCTGCAACAAGGAGG - Intronic
1057842079 9:98494570-98494592 GACACCCAGCTGAAAAATGGTGG - Intronic
1059592209 9:115673927-115673949 GAGTCCTAGCTCCACCATGGTGG + Intergenic
1189995797 X:46636299-46636321 GAAACCCTGCTCCAACATGATGG - Intronic
1194071700 X:89331786-89331808 GAAATCAAACTGCAAAATGGAGG - Intergenic
1194574302 X:95592990-95593012 GAAACCTATGTACAAAATGGTGG - Intergenic
1197148661 X:123195714-123195736 GTAACCTAGCTGCTAAAAGGAGG - Intronic
1200725946 Y:6667515-6667537 GAAATCAAACTGCAAAATGGAGG - Intergenic
1200825358 Y:7632889-7632911 CAAACCCAGCTGAAACATGCGGG - Intergenic
1201865376 Y:18647579-18647601 GTAACCTAGTTCCAACATTGTGG + Intergenic
1202202541 Y:22368470-22368492 CAAACCCAGCTGAAACATGTGGG + Intronic
1202234699 Y:22698198-22698220 CAAACCCAGCTGAAACATGCAGG + Intergenic
1202308460 Y:23497970-23497992 CAAACCCAGCTGAAACATGCAGG - Intergenic
1202562341 Y:26172616-26172638 CAAACCCAGCTGAAACATGCAGG + Intergenic
1202593541 Y:26512457-26512479 GAATCCTATTTGCAACACGGAGG + Intergenic
1202593889 Y:26516138-26516160 GAATCCTATTTGCAACATGGAGG + Intergenic