ID: 932570580

View in Genome Browser
Species Human (GRCh38)
Location 2:72936391-72936413
Sequence GTCATCCTTTTGGCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932570574_932570580 7 Left 932570574 2:72936361-72936383 CCCAGGTGTGGAAGGAAGGTGGG 0: 1
1: 0
2: 4
3: 43
4: 390
Right 932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 117
932570576_932570580 6 Left 932570576 2:72936362-72936384 CCAGGTGTGGAAGGAAGGTGGGA 0: 1
1: 1
2: 3
3: 42
4: 399
Right 932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932570580 Original CRISPR GTCATCCTTTTGGCCCCAGT GGG Intergenic
901223209 1:7595886-7595908 GTCATCCTTTTGGCTAGATTGGG - Intronic
901718346 1:11175032-11175054 CTTTTCCTTTTGGCCTCAGTAGG - Intronic
901829872 1:11885853-11885875 GTCATCCTTCTGGCCTCCTTTGG + Intergenic
903933996 1:26882185-26882207 GTCAATCTTGTTGCCCCAGTTGG - Intronic
906322553 1:44826284-44826306 GTGATCCTTGTGGCCTCTGTAGG - Exonic
907779096 1:57548709-57548731 GGCATACTTTTTGCCCCAGAGGG + Intronic
907978122 1:59453510-59453532 GTGATCCTTCTGGTCTCAGTTGG + Intronic
908981321 1:69962806-69962828 GTCCTCCAGTAGGCCCCAGTGGG - Intronic
909935796 1:81549202-81549224 GTCATCCATTTGGCTTCAGTAGG - Intronic
910310366 1:85816862-85816884 GTATGCCTTTTGGCCCAAGTAGG + Exonic
912569153 1:110608625-110608647 GTCATCCTTTGGGCCCACGGAGG - Intronic
912974561 1:114316095-114316117 TTGATTCTTTTGGCCCCAGAAGG - Intergenic
913830187 1:123229654-123229676 GACATCCTTGTGGCCCTCGTTGG + Intergenic
916077982 1:161213974-161213996 GTTCTCCTTCTGTCCCCAGTGGG - Intronic
917623320 1:176820221-176820243 GTAAGCCTTTTGGTTCCAGTAGG + Intronic
920116104 1:203623065-203623087 GTCCTCCTTCTTGCCCCAGGGGG + Intergenic
1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG + Intergenic
1066431926 10:35360220-35360242 GTCATCCCTTTGGCCTCATAAGG - Intronic
1068870791 10:61942072-61942094 CACATCCTTTTGTCCCCTGTGGG - Intronic
1069327048 10:67243907-67243929 GACATCATTTTGGCCTCAGGAGG - Intronic
1069617250 10:69813945-69813967 CTCATCCTTGTGGTCCCAGGAGG - Intronic
1069721284 10:70551138-70551160 CTCATCCATGTTGCCCCAGTGGG + Intronic
1069812412 10:71172139-71172161 CTAATCCTTTTGCCCCGAGTTGG + Intergenic
1071506414 10:86234359-86234381 TTCATTCTTTTGGCTCCACTGGG - Intronic
1071749990 10:88464443-88464465 GTGATTTTTCTGGCCCCAGTGGG - Intronic
1072721082 10:97781483-97781505 CTGATCCTTCAGGCCCCAGTAGG + Intergenic
1073209458 10:101787396-101787418 ATCATGCTTTTGGCCACACTTGG + Exonic
1075930620 10:126292274-126292296 ATCATCCTTTTGGCTCCCATTGG + Intronic
1076737437 10:132465111-132465133 GTCAGCCTTTGAGCCCCTGTGGG - Intergenic
1078343277 11:10517635-10517657 GTCATCCTTTTTTCCTCTGTAGG - Intronic
1080297828 11:30750786-30750808 ACCTTCCTTGTGGCCCCAGTGGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1087886655 11:103490582-103490604 GGCAGCCTTTTGGGCTCAGTGGG - Intergenic
1090763557 11:129857347-129857369 ATCATCCTTCTGGTCCCATTCGG - Exonic
1096769143 12:53922482-53922504 ATAATCCTTTTGACTCCAGTGGG + Intergenic
1097079338 12:56418359-56418381 TTCAACTTTTTGGCCCCTGTAGG - Exonic
1101777859 12:107810007-107810029 GTCATCCATCAGGCCTCAGTTGG + Intergenic
1104659524 12:130600536-130600558 GACATCCTTCTGGCCAGAGTAGG - Intronic
1105986271 13:25570657-25570679 GTCATCCTATTGCTCCCTGTAGG - Intronic
1107994298 13:45845919-45845941 GTCATGCTGCTGGCCCCAGGAGG + Intronic
1112749713 13:102569637-102569659 GGCATCTGTTTGGCCTCAGTTGG - Intergenic
1119941887 14:78649853-78649875 GATATCCTTTTGGCCACGGTAGG - Intronic
1128803640 15:70514266-70514288 TCCATTCTTTTGGCCCCAGAGGG + Intergenic
1131258869 15:90878219-90878241 GTCATCCTCGGGGCCCCAGCTGG - Exonic
1135324275 16:21516319-21516341 GCAGTCCTTTTGGTCCCAGTAGG - Intergenic
1135709015 16:24699368-24699390 GTCATCCTTTTGGTCTCATCTGG - Intergenic
1136335760 16:29609596-29609618 GCAGTCCTTTTGGTCCCAGTAGG - Intergenic
1137845468 16:51683850-51683872 GAAATCCTTTTGGACCCTGTCGG + Intergenic
1142036479 16:87865388-87865410 GCAGTCCTTTTGGTCCCAGTAGG - Intronic
1143944037 17:10573758-10573780 GTCATCCTTTTGGCCACAGGTGG - Intergenic
1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG + Intergenic
1148149249 17:45386540-45386562 TTCATCCTTTATGGCCCAGTGGG - Intergenic
1152193646 17:78903437-78903459 GACATCTTTTTGTCCCCAGCTGG + Intronic
1155233553 18:23796971-23796993 GGCATGCTTCTGGCCCCGGTGGG + Intronic
1155403289 18:25461551-25461573 GCCATCATTTTGGGCCCAGAAGG - Intergenic
1156382398 18:36576072-36576094 TTTGTCCTTGTGGCCCCAGTGGG + Intronic
1158527011 18:58224001-58224023 GTCCTCCCTGTGGCCCCTGTGGG - Intronic
1165087338 19:33360276-33360298 GCCCTCCTTTTTGCCCCACTGGG - Intergenic
1166541810 19:43610755-43610777 ACCATCCTTTAGGACCCAGTGGG + Intronic
925477994 2:4240237-4240259 CTCAGCCCTTTGGCCACAGTTGG - Intergenic
926886166 2:17600975-17600997 GTTATCATTTTGACCCCTGTGGG - Intronic
929465144 2:42137452-42137474 GTCATCCTTTTCACACCAGCAGG - Intergenic
931232492 2:60386707-60386729 GTCAGGCATTTGGCCCCAGAGGG + Intergenic
932401654 2:71484909-71484931 GTCCTCCCATTGGCCCCTGTGGG + Intronic
932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG + Intergenic
939567186 2:143799021-143799043 GTCTTCCTTTTTGGCCCAATGGG - Intergenic
940888441 2:159011866-159011888 GTCAGCCTTCTGGCCCCACATGG - Intronic
945336631 2:208600024-208600046 GAGATCCTTTTAGCCACAGTTGG + Intronic
947786973 2:232831880-232831902 GACATCTCTTTGACCCCAGTTGG + Intronic
948548357 2:238749232-238749254 CTCATCCTTTTGCACACAGTGGG + Intergenic
1170612809 20:17928571-17928593 GTGAGGCCTTTGGCCCCAGTGGG + Intergenic
1173566125 20:44039821-44039843 GTCATTCCTGGGGCCCCAGTTGG + Intronic
1179910489 21:44444830-44444852 CTCATCCTCATGGCCCCAGAAGG - Intergenic
1182248363 22:28979133-28979155 CTCATCCTTCTGGCCCCATCTGG + Intronic
1185374681 22:50476842-50476864 ATCCTCCTTTTTGCCCCAGCTGG + Intergenic
950021412 3:9790397-9790419 TTCATCCTTTTAGGTCCAGTTGG + Intronic
951317389 3:21203944-21203966 GTTATCCTTGAGGCCCCTGTAGG + Intergenic
952846205 3:37689939-37689961 GACATGCCTTTGGCCCCAATAGG - Intronic
954181788 3:48887164-48887186 GTCATCCTTTTAGCTCATGTAGG - Intronic
954359823 3:50115409-50115431 GTCCTCCTTTTGTCTCCAGAGGG + Exonic
954375355 3:50191624-50191646 GGCACCCTTCTGGCCCCAGGAGG - Exonic
956652785 3:71520849-71520871 GTCATCCTTTTGTTCTCAGATGG - Intronic
958778039 3:98509264-98509286 GTCATTCTTTAGGTCTCAGTAGG - Intronic
962065106 3:131971549-131971571 GCCTTCCTTTTTGCCCCAGAGGG + Intronic
966172418 3:177096998-177097020 GTCAACCTTTTTTCCCCAATAGG + Intronic
969569783 4:8001628-8001650 GTCATCACTGTGGCCCCAGCTGG + Intronic
973751087 4:54021769-54021791 GACAGCCTTCTGGCCCCTGTGGG - Intronic
974318623 4:60314757-60314779 GTCATCCTTTTTGTTCCATTAGG - Intergenic
974324843 4:60400111-60400133 GGTGTTCTTTTGGCCCCAGTGGG - Intergenic
981638726 4:146911350-146911372 GTCTTCCTTCAGTCCCCAGTGGG - Intronic
982970727 4:161982059-161982081 GTTATGCTTCTGGCTCCAGTGGG + Intronic
987932745 5:24423449-24423471 GTCATCCTTTTCCCCCCATATGG + Intergenic
989944073 5:50195712-50195734 GTGATCCTTTTGGCCTAAGGTGG - Intergenic
993625715 5:90222472-90222494 GTCATCCTTTTAGCATCACTAGG + Intergenic
994148062 5:96416760-96416782 TTCAGGCTTCTGGCCCCAGTTGG - Intronic
998331147 5:141328288-141328310 GTCAGCCTTTATGCCCCAGCTGG - Intergenic
1000765824 5:165287084-165287106 GTCAGTCTTTGGGCCCCAGGTGG - Intergenic
1005271285 6:24166131-24166153 GTCATCCTTTTGCCTCAAGGTGG - Intergenic
1006408434 6:33858173-33858195 CCCATCCTTTTGGCTCCAGCTGG - Intergenic
1006981766 6:38153378-38153400 ATCATCCTCTTGGCCCCTGGAGG - Exonic
1011441257 6:87390033-87390055 GTCAGGCTCTTGGCACCAGTAGG + Intronic
1014381288 6:120745567-120745589 GTCAGGCTTATGGCCACAGTAGG - Intergenic
1022532206 7:31074055-31074077 GCCATCCTCTGGGCACCAGTAGG + Intronic
1024164788 7:46720266-46720288 GATATCCTTATGGCCCCAGAAGG + Intronic
1026316219 7:69229958-69229980 GGAATCCTTTGGGCCCCAGCTGG - Intergenic
1029094719 7:98075980-98076002 CTCATCCTTATGGTCCCAGATGG - Intergenic
1037456303 8:19067777-19067799 GTCACCCAGTTGGCTCCAGTGGG - Intronic
1039987520 8:42460100-42460122 CCCATCCTTTTGGCCACACTGGG - Intronic
1042870374 8:73392584-73392606 GTCATCATTTTGTCCTAAGTCGG + Intergenic
1043464707 8:80493159-80493181 GTCTTGCTTGTCGCCCCAGTTGG - Intronic
1046095892 8:109559852-109559874 GTTATCCTCTTGACCGCAGTAGG - Intronic
1047042946 8:121018758-121018780 GTCATCCTTTTTGGGCCAGTGGG + Intergenic
1047157829 8:122341377-122341399 GTCAACTTTTTGGCATCAGTGGG - Intergenic
1050251791 9:3752636-3752658 GTTCTCCTTTTTGGCCCAGTAGG + Intergenic
1051665948 9:19467036-19467058 CTCATCCTTGTGTCCCAAGTTGG - Intergenic
1053114795 9:35490809-35490831 GTGATCCTGTTGCCCACAGTTGG + Intronic
1055415893 9:76082703-76082725 ATCATCTTTTTTGCCCCAATTGG + Intronic
1056846249 9:90040471-90040493 GTCCTCCTTTAGGGCCCAGGAGG - Intergenic
1062407147 9:136402292-136402314 GTCACTCTTGTGGCCCCAGTGGG - Exonic
1062555957 9:137113565-137113587 GTCCTCCTTGTGGCACCTGTGGG - Intronic
1186949760 X:14610999-14611021 GTTATCCTTTTGCCACCATTAGG + Intronic
1189753476 X:44247128-44247150 GCCACCAATTTGGCCCCAGTAGG + Intronic