ID: 932570580

View in Genome Browser
Species Human (GRCh38)
Location 2:72936391-72936413
Sequence GTCATCCTTTTGGCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932570576_932570580 6 Left 932570576 2:72936362-72936384 CCAGGTGTGGAAGGAAGGTGGGA No data
Right 932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG No data
932570574_932570580 7 Left 932570574 2:72936361-72936383 CCCAGGTGTGGAAGGAAGGTGGG No data
Right 932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932570580 Original CRISPR GTCATCCTTTTGGCCCCAGT GGG Intergenic