ID: 932572473

View in Genome Browser
Species Human (GRCh38)
Location 2:72945309-72945331
Sequence CAGAAGAAAGAGATCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932572473_932572478 -2 Left 932572473 2:72945309-72945331 CCAGACCAGATCTCTTTCTTCTG 0: 1
1: 0
2: 3
3: 32
4: 371
Right 932572478 2:72945330-72945352 TGATGGTGTGTCCACGTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
932572473_932572480 14 Left 932572473 2:72945309-72945331 CCAGACCAGATCTCTTTCTTCTG 0: 1
1: 0
2: 3
3: 32
4: 371
Right 932572480 2:72945346-72945368 TGGGTGGACATCCTACACACTGG 0: 1
1: 0
2: 0
3: 10
4: 75
932572473_932572477 -5 Left 932572473 2:72945309-72945331 CCAGACCAGATCTCTTTCTTCTG 0: 1
1: 0
2: 3
3: 32
4: 371
Right 932572477 2:72945327-72945349 TTCTGATGGTGTGTCCACGTGGG 0: 1
1: 0
2: 2
3: 9
4: 102
932572473_932572476 -6 Left 932572473 2:72945309-72945331 CCAGACCAGATCTCTTTCTTCTG 0: 1
1: 0
2: 3
3: 32
4: 371
Right 932572476 2:72945326-72945348 CTTCTGATGGTGTGTCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932572473 Original CRISPR CAGAAGAAAGAGATCTGGTC TGG (reversed) Intronic
902669093 1:17960054-17960076 CAAAAGAAAGAGATGTGTTTAGG - Intergenic
904008685 1:27377715-27377737 CAGAAGAGTGAGAACTGGGCTGG - Intergenic
904038322 1:27570476-27570498 CAGTAGAAAGAGACCTGGGCGGG - Intronic
905392051 1:37642554-37642576 CAAAAGAAAGAGTTTTGGGCAGG - Intergenic
907363917 1:53944929-53944951 CAGAACCAAGGGAGCTGGTCAGG - Intronic
907397554 1:54201960-54201982 CAGCAGAAAGAGCCCTGGACTGG - Intronic
907444834 1:54500815-54500837 CACAAGAAAGAGCACTGGCCAGG - Intergenic
907466093 1:54638147-54638169 CAGAAAAAATAGATTTGGGCTGG + Exonic
907558158 1:55363386-55363408 CAAAAGAAAGAGCCCTGGCCAGG - Intergenic
909013135 1:70355938-70355960 AAGAAAGAAGAGATCTGGCCGGG - Intronic
909144387 1:71911320-71911342 CTGTGGAAAGAGCTCTGGTCAGG + Intronic
909490846 1:76224837-76224859 TAAGAAAAAGAGATCTGGTCTGG + Intronic
909665716 1:78130395-78130417 AAAAAGAAAGTGATCTGGCCCGG - Intronic
909879877 1:80861651-80861673 CAAAAGACAGAGATTTGGCCGGG + Intergenic
910086043 1:83403842-83403864 CAGAAGCAAGTGAGCTAGTCCGG - Intergenic
910220355 1:84883682-84883704 CAGAAGGATGAGGGCTGGTCAGG - Intronic
910921891 1:92357366-92357388 CAGAAGTAAAAGATCTGTTTGGG + Intronic
911612628 1:99973563-99973585 AACTAGAAAGAGTTCTGGTCAGG - Intronic
911994172 1:104742567-104742589 AAGGAGAAAGAGATGGGGTCTGG - Intergenic
912967609 1:114249964-114249986 CATAGGAGAGAAATCTGGTCAGG - Intergenic
913585469 1:120271184-120271206 CAGAAGACTGGGATCTGGGCAGG - Intergenic
913622714 1:120627183-120627205 CAGAAGACTGGGATCTGGGCAGG + Intergenic
914567474 1:148883043-148883065 CAGAAGACTGGGATCTGGGCAGG - Intronic
914605348 1:149247202-149247224 CAGAAGACTGGGATCTGGGCAGG + Intergenic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914892096 1:151634446-151634468 CAGGAGAAAAAGCTCTAGTCAGG - Intronic
914956570 1:152167954-152167976 CAGAAGAGAGAGCACTTGTCTGG - Intergenic
915672637 1:157503378-157503400 TATAAGAAAGAGAACTGGGCCGG + Intergenic
915676969 1:157541113-157541135 CAGAAGAGAGGGAGCTGGTTTGG - Intronic
915686771 1:157642059-157642081 CAGAAGAGAGTGATCCGGTTTGG - Intergenic
916145581 1:161736138-161736160 AAGAAGAAAGAGACCTAGTATGG + Intergenic
916403810 1:164477088-164477110 AAGAACAGTGAGATCTGGTCGGG + Intergenic
916471178 1:165124303-165124325 CAGCAGAAAGAAACTTGGTCTGG + Intergenic
916583653 1:166130805-166130827 CAGGAGAAAGAGCACAGGTCTGG - Intronic
916608190 1:166363716-166363738 CAGAAGAGAGGCATCTGGTAGGG - Intergenic
916795404 1:168162477-168162499 TAGAAGAAAGAGAACTGGCAGGG + Intergenic
917208222 1:172600919-172600941 CAGCAGAAAGAAAGCTGGTATGG + Intronic
918229971 1:182519597-182519619 CTGAAAAAAGATATCTAGTCCGG - Intronic
918443851 1:184596572-184596594 TAAGAGAAAGAGATCTGGCCAGG + Intronic
918671664 1:187224497-187224519 CAGAAGAAAGGGATCTCTTTTGG + Intergenic
919818947 1:201460535-201460557 CAGAAGAGAGAGAGTTGGTGAGG - Intergenic
919853042 1:201686566-201686588 CAGCATAAAGAAATGTGGTCAGG - Intronic
920061531 1:203230033-203230055 GAGAAGCAAGAGAGCTGGTCTGG - Intronic
920072455 1:203312215-203312237 CAACAGAAAGAGTTCTGGACTGG + Intergenic
920726104 1:208436648-208436670 CAGATTAAAGTGATCTGGTAGGG + Intergenic
920937861 1:210452472-210452494 CAGATGAAAGAAAACTGGCCAGG - Intronic
921134884 1:212251226-212251248 CTCAAGAAAGAGGTCTGGGCTGG + Intergenic
922219917 1:223550654-223550676 CAGGAGAAAAAGAGCTGGGCTGG - Intronic
1063726906 10:8647279-8647301 CAGAAAATATAAATCTGGTCAGG - Intergenic
1065268453 10:24001858-24001880 CAGAAGAAAGAGTGCTGCTCTGG + Intronic
1065295531 10:24270840-24270862 CAAAAGAAAGAAATCTGGCTGGG - Intronic
1065918525 10:30371512-30371534 CAGAACAGAGAGACCTGGGCTGG + Intronic
1066220387 10:33332533-33332555 CAGATTAAAGAGCTCTGGTGTGG - Intronic
1067453481 10:46397027-46397049 CAGAAGAGAAAGAGCTTGTCAGG + Intergenic
1067583750 10:47462719-47462741 CAGAAGAGAAAGAGCTTGTCAGG - Intronic
1067633754 10:47988067-47988089 CAGAAGAGAAAGAGCTTGTCAGG - Intergenic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1068005706 10:51391162-51391184 CAGAAAAAAGAGTTCTGTTTCGG - Intronic
1068196813 10:53727590-53727612 CAGTAGAGAGAGATCTTGTGCGG + Intergenic
1069656953 10:70097077-70097099 GAGTAGAAAGAGCACTGGTCTGG + Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069785534 10:70985704-70985726 CACAAGAAAGAATTCTGGGCGGG - Intergenic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1069959052 10:72068867-72068889 GAGAAGAAAGAGATATGACCAGG - Intronic
1070484018 10:76912573-76912595 CACAAGGAAGAAATCTGGTGTGG + Intronic
1070728244 10:78807114-78807136 CAGAGGAAAGAAAGCTGGCCAGG + Intergenic
1072318453 10:94225670-94225692 CAGATGAAAGAGCACTGGGCTGG + Intronic
1072457534 10:95589869-95589891 AAGAAAAATGAGATCTGGCCAGG + Intergenic
1072791139 10:98318700-98318722 TACAAGGAAGAGATCTGCTCAGG + Intergenic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073332824 10:102681889-102681911 CAGCAGAAAGAGCTGTGGTTTGG + Intronic
1074775261 10:116763458-116763480 CAGAAGAAAGAGGTCTGCAGAGG - Intergenic
1075566757 10:123510645-123510667 CAGAAGGGAGAGAGGTGGTCTGG - Intergenic
1076121386 10:127939725-127939747 CAGAAGGAAGAGATAGGCTCTGG + Intronic
1076210510 10:128639914-128639936 CATAAGAAAGAAATCTGATAAGG - Intergenic
1078716138 11:13840664-13840686 CAGAAGCAAGTGATATGGACAGG - Intergenic
1079145632 11:17848975-17848997 CAGAAGAAAGAGAGCTAGAGTGG - Intronic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1079607181 11:22384677-22384699 CAGAAGAAACAGAACTGCTTGGG + Intergenic
1080034042 11:27692631-27692653 AAGAAAAAAGAGGTCTGGTGTGG - Intronic
1082193874 11:49278585-49278607 CAGGAGAGAGAGATATGGGCAGG + Intergenic
1083071944 11:59993674-59993696 CAGAAGAAAGAGCTCTCTTTTGG + Intergenic
1083275906 11:61597025-61597047 CACCAGAAAGAGCCCTGGTCTGG + Intergenic
1083953561 11:65970447-65970469 AAGAAGAAAAAGATCTCGGCAGG + Intronic
1084143978 11:67254003-67254025 GAGAAGAAAGAAAACTTGTCTGG + Intronic
1084417445 11:69041258-69041280 CAGAATACAGAGAGCTGGTTTGG + Intergenic
1085210978 11:74778033-74778055 CAGGAGAAAGAGAACAGGGCTGG - Intronic
1085281712 11:75335286-75335308 CAGAAGAAGCAGATCTTGGCCGG + Intronic
1085707324 11:78798502-78798524 CCAAAGAAAGAGATCTGATGTGG + Intronic
1087294407 11:96353254-96353276 AAGAATAAACAGATCTGGACAGG + Exonic
1088804459 11:113339411-113339433 TAGAACAAGGGGATCTGGTCAGG - Exonic
1088872035 11:113898850-113898872 CAGAATGAACAGATCTGCTCAGG - Intergenic
1090003448 11:122980949-122980971 TGGAAAAAAGAGATCTGGCCTGG + Intronic
1091632041 12:2169551-2169573 CAGAAGAGAGAGACCTGTTATGG - Intronic
1093513370 12:19955495-19955517 CAGGAGAAAAAGATCTGATAAGG - Intergenic
1093901871 12:24644761-24644783 GGGAAGAAAAAGATCTGGCCAGG + Intergenic
1095184469 12:39186070-39186092 CAGAAGAAAGAGATCAGTATAGG - Intergenic
1095307993 12:40660902-40660924 GAGAAGAAAGAGATAGGGTTTGG + Intergenic
1095641668 12:44493047-44493069 TAGAAGAAAGAGATGAGCTCAGG - Intergenic
1095980984 12:47974700-47974722 GAGAAGAAACACATCTGGTTTGG - Exonic
1096133683 12:49181766-49181788 AAGAAGAAAGAATTCTGGGCCGG + Intergenic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1097958377 12:65509273-65509295 CAGAAGTAAGAGATTTAGCCAGG - Intergenic
1098528216 12:71511217-71511239 AAGGCAAAAGAGATCTGGTCTGG - Intronic
1098806902 12:75032278-75032300 TAGAAGAAAGAGGGCTGGTGGGG - Intergenic
1100338689 12:93657206-93657228 CAATAGAAAGAGATTTGGTAAGG - Intergenic
1100451509 12:94711374-94711396 CAGGAGAAAAAGTTTTGGTCTGG - Intergenic
1100467237 12:94857102-94857124 CAGAAGACAGGGACCTTGTCTGG - Intergenic
1101336715 12:103803082-103803104 CAGAATAGAGAGACCTGGTGAGG + Intronic
1101648893 12:106656725-106656747 CAGAAGAGAGACATTTGGTGGGG - Intronic
1102288753 12:111681691-111681713 CTGAAGAATGAAATCTGGTCTGG + Exonic
1104440929 12:128792405-128792427 GATAAGAAACAGATGTGGTCTGG - Intergenic
1104445721 12:128831825-128831847 GATAATAAAGGGATCTGGTCGGG + Intergenic
1105328819 13:19395196-19395218 CAGAAGACAGAGATCTACTGGGG - Intergenic
1107263837 13:38527135-38527157 CAGAAGTCAGGGATCTGGACAGG + Intergenic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1107698294 13:43022184-43022206 CAGTATAAAGAGAACTGGACTGG - Intergenic
1107921161 13:45209671-45209693 TTGAAGAAAGAGGTCTGGGCTGG - Intronic
1108369365 13:49752309-49752331 CAGAAGAAAAAGATCTTGAGTGG + Intronic
1109730509 13:66407295-66407317 TAGAAGAAAGAGATTCTGTCAGG - Intronic
1109920743 13:69054787-69054809 CAGGAGCAAGAGAGCTAGTCAGG + Intergenic
1109959498 13:69612561-69612583 CAGAAGAAAGAAATCTAGTGAGG + Intergenic
1110761980 13:79241002-79241024 CAGTAGAAAGAGATGTGGTTGGG - Intergenic
1111785562 13:92782252-92782274 CACAAGAAGGAGATTTGGTAAGG - Intronic
1113683054 13:112257639-112257661 CAAAAGAAAGATATTTGGTCTGG + Intergenic
1114211870 14:20622847-20622869 AGGGAGAAAGAGACCTGGTCAGG + Intergenic
1114697558 14:24641208-24641230 CAGCTGGAAGAGATCTGATCTGG + Intergenic
1115453070 14:33571160-33571182 CAGGAGAAAGGGCTCTGGACTGG + Intronic
1116464229 14:45213197-45213219 CAGAAGAAACAATTCTGGCCGGG - Intronic
1117044686 14:51801273-51801295 TAGAAGAGAGTGATTTGGTCAGG + Intergenic
1118384404 14:65243774-65243796 CAGGAGAGAAAGATCTGGGCTGG + Intergenic
1118602018 14:67477532-67477554 CACAGGAAAGAGGTCTGGCCGGG - Intronic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120191657 14:81445534-81445556 AAGAAGAAAGTGATCTGGGCTGG + Intergenic
1120354563 14:83414262-83414284 CAGAAGAAACAGGTATGATCTGG + Intergenic
1120766272 14:88329521-88329543 AAGAAGAAAGAGATTTAGACTGG - Intergenic
1121048354 14:90804038-90804060 CAAAAGAAAGAGCTGTGGCCGGG + Intronic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121824314 14:96998264-96998286 CAGCAGAAGGAGATCTGGGGTGG + Intergenic
1122485754 14:102078528-102078550 CAGATGAAAGAGTCCTGGCCAGG + Intergenic
1123663624 15:22588204-22588226 TAGAAGAGAGTGATTTGGTCGGG - Intergenic
1123894752 15:24817564-24817586 CAGAAGTGAGAAATGTGGTCAGG - Intergenic
1124317456 15:28682656-28682678 TAGAAGAGAGTGATTTGGTCGGG - Intergenic
1124565991 15:30814857-30814879 TAGAAGAGAGTGATTTGGTCGGG + Intergenic
1126106829 15:45152225-45152247 CAGAGGACAGAGAGCTGGTTAGG - Intronic
1129538471 15:76333008-76333030 CAGCAGGAAGAGGTCTGGCCTGG + Intergenic
1129699270 15:77758281-77758303 CAGAAGAAAGAGCACTGGACTGG + Intronic
1130380835 15:83371255-83371277 CTGAGGAGAGAGATCTGGGCTGG + Intergenic
1130427572 15:83816708-83816730 CAGAGGAAAGTCATCTGGCCTGG + Intronic
1130866098 15:87934481-87934503 CAGGAGAAAGATCTCTGGTGAGG - Intronic
1130948950 15:88570590-88570612 CAGAAGCATGAGATCTTGCCTGG - Intergenic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133570254 16:7033695-7033717 CAGTAGAAAGACATTTTGTCCGG + Intronic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1137832255 16:51555037-51555059 CAGGAGAAAGAGCACTGCTCTGG - Intergenic
1138264870 16:55653101-55653123 CAAAAGAAAGAGAACTCTTCTGG + Intergenic
1138971355 16:62147913-62147935 CAGAAGCGAGAGATGTGGTGGGG + Intergenic
1140264158 16:73406076-73406098 CAGAACAAAAACATCTGGACTGG + Intergenic
1143358767 17:6350820-6350842 AAGAAGTAAGAGATGAGGTCAGG - Intergenic
1143586003 17:7850807-7850829 CAGGAGAAAGAGGGCTGGTGAGG + Intronic
1143601264 17:7947739-7947761 AAGAAGAAAGTGAGCTAGTCTGG - Intronic
1145102730 17:20090173-20090195 AAGAAGACAGAGATGTGGTGTGG - Intronic
1146509228 17:33431314-33431336 CAGAAGAAAGAGGTCAGGAGTGG + Intronic
1147539834 17:41348063-41348085 AAGCAGAAAGAGCTCTGGACAGG + Intronic
1147669243 17:42167255-42167277 AAGAAAAAAGAAATCAGGTCTGG - Intronic
1149720818 17:58842185-58842207 CAGTTTAAAGAGTTCTGGTCAGG - Intronic
1149806170 17:59619965-59619987 CAGACGAAAGAGCTCGGGTCGGG - Exonic
1150695469 17:67401228-67401250 CAAAAGAAAGAAAACTGGCCAGG - Intronic
1150825285 17:68469056-68469078 CAGGAGAAAGAGATCCCATCAGG - Intergenic
1151455623 17:74224024-74224046 CAGAGGACAGAGTTCTGGACAGG + Intronic
1155314986 18:24562670-24562692 CACAAGAAAGAGGTCGGGACTGG + Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1161578445 19:5067574-5067596 CAGAGGACAGAGAGCTGGTGTGG + Intronic
1163270756 19:16252136-16252158 CCAAAGAAAGAGAACTGGTCAGG - Intergenic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1163838241 19:19589471-19589493 AAGAAAAAAAAGTTCTGGTCAGG + Intronic
1164806648 19:31122217-31122239 CAGAGTAAAGAGAGCTGGCCAGG - Intergenic
1166299541 19:41906236-41906258 CTGAAGACAGAGATGTGTTCAGG - Intronic
1166944637 19:46389489-46389511 CAGGAGAAAGAGAACTTGGCAGG - Intronic
1167678376 19:50903668-50903690 TAGAAGAAAAAGAGCTGGCCGGG - Intergenic
925153227 2:1631480-1631502 CAGAAGCAAGAGCGCAGGTCAGG - Intergenic
925825546 2:7845293-7845315 CAGAAGAAAGAAATGGGCTCTGG - Intergenic
927696424 2:25242582-25242604 CAGAAGACAAACATCTGGCCGGG + Intronic
928208110 2:29301812-29301834 CAAAAGAGAGAGAACTGGACTGG + Intronic
929646526 2:43633852-43633874 AAGAAGAATGAGATCTGGCTTGG - Intergenic
930369935 2:50489549-50489571 CAGATGAGAGAAATCTGCTCAGG - Intronic
930777588 2:55189659-55189681 CAGAAGAAAGAGAGCTGCCTAGG + Intronic
932102528 2:68913702-68913724 CTCAAGAAAGAGACCTGGGCTGG + Intergenic
932564754 2:72898788-72898810 CAGCAGAAAGAGAACTGAGCTGG - Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
932682198 2:73835892-73835914 CAGAAGACTGAGGTCTGGGCTGG + Intronic
933455948 2:82519330-82519352 CACAACAAAGTGATCTGGTGGGG + Intergenic
936791549 2:116158715-116158737 CAGAAGTAAGATATCTAGGCTGG - Intergenic
936875934 2:117189268-117189290 CAGAGGAAAGAGATGTTGTTGGG - Intergenic
937467453 2:122147121-122147143 CAGAGAAAAGAGGTCTGGGCTGG + Intergenic
940358861 2:152775825-152775847 CAGATGAAAGAAATGTGCTCGGG + Intergenic
940728032 2:157357725-157357747 GGGAAGAAAGAGAGCTGGTGGGG - Intergenic
941476354 2:165955588-165955610 CAGAAGAAGGAGATTTTCTCAGG - Intergenic
942494267 2:176522543-176522565 CAGAAGAAAGATTGCTAGTCTGG - Intergenic
942968995 2:181934159-181934181 CTGCAGAAAGAGATCGGATCTGG + Intergenic
943753463 2:191534338-191534360 GAGTAGAAGGAGATCTGATCTGG + Intergenic
944647734 2:201796370-201796392 CAGAATAAAGTGGTCTGGCCTGG - Intronic
944923437 2:204438626-204438648 CATAAGAATGAGCTCTGGGCTGG - Intergenic
946224946 2:218259496-218259518 CAGAACCACGGGATCTGGTCGGG - Intronic
946385048 2:219378507-219378529 CAGCAGAAAGAGCCCTGGGCTGG + Intronic
946485936 2:220100726-220100748 GAGAAGCAAAAGATGTGGTCAGG - Intergenic
946905537 2:224412721-224412743 CAGTGGGAAGAGAACTGGTCTGG + Intergenic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
948340763 2:237249422-237249444 GAAAAGAAAGAGATCAGATCAGG - Intergenic
1168818483 20:757172-757194 CTGAAGAATGAGATCAGGGCTGG - Intergenic
1169561275 20:6803216-6803238 AAGGGGAAAGAGATCTGGTGTGG + Intergenic
1169634606 20:7674943-7674965 GAGAAAAAAGAGATCAGGTCTGG + Intergenic
1169708276 20:8532750-8532772 AAGAAGAAAGAGACCTGGAAAGG + Intronic
1169770727 20:9197178-9197200 CAGAAGAAAGACAACTGGAGAGG - Intronic
1170055550 20:12198988-12199010 CACCAGCAAGAGATCTGGTTGGG + Intergenic
1172640536 20:36437729-36437751 CAGAGGGAAGAGAACAGGTCAGG + Intronic
1174310966 20:49654067-49654089 CAGAAGTATGACATCTGGACTGG + Intronic
1174365558 20:50054278-50054300 CAGAAGGAAGAGATCCAGGCTGG + Intergenic
1175333718 20:58181461-58181483 CAGGAGAGAGAGAGCGGGTCAGG + Intergenic
1175514715 20:59561663-59561685 CAGAAGAGACAGTTCTGGTATGG + Intergenic
1177606550 21:23386227-23386249 GAGAGGAAAAAGATCTAGTCTGG - Intergenic
1178170481 21:30034651-30034673 CAGCAGGAAGTGATATGGTCAGG - Intergenic
1178743841 21:35228098-35228120 CAGAACAAAGAATTCTGATCAGG + Intronic
1181625256 22:24118657-24118679 AAGAAGAAAGCTATCTGGCCCGG - Intronic
1181733441 22:24864034-24864056 AAGAAAAAAGAGCTCTGGCCAGG - Intronic
1181830841 22:25559083-25559105 GAGAAGAAACAGACCTGGCCAGG + Intergenic
1182042686 22:27250634-27250656 AAGAAGCAAGAGATGGGGTCAGG + Intergenic
1183160593 22:36110514-36110536 CAGAGAAAAGAGATTTGGACAGG + Intergenic
1183574409 22:38678096-38678118 CAGAAGACAGAGCCCTGGCCGGG - Intergenic
1183624203 22:38991836-38991858 CGAAAGAAAGAGAACTGGGCTGG + Intronic
1184651757 22:45922556-45922578 GAGAAGAAAGAGAACTTGCCGGG + Exonic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
952951993 3:38532928-38532950 CAGATGGAAGAGAGCTAGTCTGG + Intronic
953392529 3:42541861-42541883 CAGAAGGAAAAGATCCTGTCAGG + Intergenic
954473580 3:50722015-50722037 CAAAAGAAAGAGGACAGGTCAGG + Intronic
955767663 3:62361917-62361939 CAGAAGAAAGACTTCTGCTCTGG + Intergenic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956343204 3:68249160-68249182 CAAAAGAAACAGATTTGCTCAGG + Intronic
956525951 3:70161131-70161153 CAAAAGAAAGACATCTAGGCTGG - Intergenic
956997758 3:74847731-74847753 CAGGAGAAGGAGATCAGGTATGG + Intergenic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
957114238 3:76003924-76003946 CAGAAGACAGAGTACTGGTGAGG + Intronic
959008798 3:101050434-101050456 CAGAAAAAAGACAGTTGGTCAGG - Intergenic
959095465 3:101950836-101950858 CTGAAGAAAAAGATCTGGTGAGG + Intergenic
959663602 3:108897012-108897034 CAGAAGGCAGAGAGCTGGACAGG - Intergenic
960740182 3:120824727-120824749 CAGAAGAAAGGCTGCTGGTCTGG - Intergenic
961239090 3:125394737-125394759 GAGAACAAATAGATCTGGGCTGG + Intergenic
962174296 3:133136734-133136756 CAGAGGAAAGGGAGCTGGTCAGG + Intronic
962463909 3:135639332-135639354 CAGGAGAAGAAGACCTGGTCTGG - Intergenic
963155209 3:142088770-142088792 GATAAGAAAGATAGCTGGTCTGG - Intronic
963199734 3:142574167-142574189 CAGAAGAAAGAAACTTGGCCGGG + Intronic
963398396 3:144763553-144763575 CCGAAGAAAGAGACCTGGTCTGG - Intergenic
964107663 3:153056389-153056411 CAAAAGAAAGAGCTTTGGCCGGG + Intergenic
964367228 3:155963356-155963378 CAGGAGAAAGAGACATGGGCAGG - Intergenic
964446267 3:156762298-156762320 CAGAAGAAAGAGAACATGTGTGG + Intergenic
965020488 3:163222462-163222484 CAGAAGAAAGTCATCTATTCTGG - Intergenic
966157217 3:176929831-176929853 CTGGAGAAAGAGAGTTGGTCAGG + Intergenic
966408399 3:179623304-179623326 CAGATGAAAGTGATCTGTGCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966936430 3:184712520-184712542 CCGAAGACACAGATCTGGTCTGG - Intergenic
967551051 3:190796426-190796448 CAGAAGGAAGGGATCTCTTCTGG - Intergenic
967755303 3:193161882-193161904 AAGAAGAAAGAAACCTGGTTAGG - Intergenic
969798314 4:9542938-9542960 CAGAAGAAAAAGGTGTGGACAGG - Intergenic
969923381 4:10561598-10561620 CTGAAGACACAGTTCTGGTCCGG - Intronic
970375323 4:15451265-15451287 GAGAAGGAAGAGATCTGGGAGGG - Intergenic
970431593 4:15993776-15993798 CACAAGAAAGACAACTGGTCGGG + Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971862921 4:32131332-32131354 CAGAAGAAAGTGACCTGTTCTGG - Intergenic
974298499 4:60034922-60034944 GAGTAGAAACAGCTCTGGTCTGG - Intergenic
975912176 4:79279918-79279940 CAGAAATAAAAGATCTGTTCAGG + Intronic
977032106 4:91896562-91896584 CAGAAGACAGAAAGCTGGTGAGG + Intergenic
977889456 4:102291465-102291487 CTGAAGATAGAGAACTGGTGTGG - Intronic
978287758 4:107098701-107098723 CAGAAGAAAGGGATCTCCTTTGG - Intronic
978454568 4:108874106-108874128 TAGAGGAAAGAGACCAGGTCGGG + Intronic
980428899 4:132664503-132664525 CAGTTGAAAGAGATCAGGACAGG + Intergenic
981874633 4:149527421-149527443 CAGAAGGAAGAGCTCTTGTTAGG - Intergenic
982559856 4:156916460-156916482 CAGAAGGAAGACATAAGGTCTGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
984846802 4:184115287-184115309 CAGATGAAACTGATCTGGGCAGG - Intronic
985178833 4:187233855-187233877 CTGAAGAAGGAGATTAGGTCAGG + Intergenic
985663218 5:1167770-1167792 CAGAAGAAGCAGGTGTGGTCAGG + Intergenic
986672231 5:10152502-10152524 AAGAAAACAGAGATCTAGTCAGG - Intergenic
990819968 5:59827651-59827673 CAGAAGAATCAGTTCAGGTCAGG + Intronic
991293045 5:65051172-65051194 AAGAAGAAAGGGATTTGGGCTGG + Intergenic
991437593 5:66612550-66612572 AAGAAATAATAGATCTGGTCAGG + Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992037887 5:72798834-72798856 CAGAAGAAAAAGAACTTGGCGGG + Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
994364753 5:98900296-98900318 AAGAAAAAAGAAATGTGGTCAGG + Intronic
995311846 5:110722083-110722105 CAGAAGATAGAGATGTGGTAGGG + Intronic
995364922 5:111347666-111347688 AAGAAGAGAGAAATCTGGACAGG - Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
997306092 5:132837616-132837638 TAAAAGAAAGATATCTGGGCTGG - Intergenic
997587321 5:135051135-135051157 CAGAAGAGAGGTATCTGGGCAGG - Intronic
998299533 5:141004403-141004425 CAGGAGGCAGAGATCTAGTCAGG - Intronic
998496568 5:142595275-142595297 CTGATTAAAGAGATCTGTTCTGG - Exonic
998596867 5:143539813-143539835 CAGAAGAAGCAGCCCTGGTCAGG - Intergenic
999407106 5:151316443-151316465 CATATAAAAGAGATCTGGCCAGG + Exonic
1000017278 5:157289167-157289189 CAGGAGAAAGAGATCAGGACTGG - Intronic
1000588033 5:163123898-163123920 CAGAAGCACGAGATCTAGACTGG + Intergenic
1000671204 5:164065397-164065419 CAGAAGAAAGAGCTCTGCTTTGG - Intergenic
1001459856 5:171902114-171902136 CAGAATAGAGAGATATGGACTGG - Intronic
1001785040 5:174404775-174404797 CAGCAGGTAGAGATCTGGGCAGG - Intergenic
1003438013 6:6111821-6111843 CAGAGGAAACAGATCTCTTCTGG + Intergenic
1003501580 6:6707555-6707577 CAGATGAAAGAGAACTTGGCTGG - Intergenic
1005265838 6:24111353-24111375 CAGAACAAAGACATTAGGTCAGG - Intergenic
1005821941 6:29605879-29605901 CAGGAAAAAGTGATGTGGTCTGG - Intronic
1007083682 6:39127570-39127592 CAGAAGAAATCCAGCTGGTCAGG + Intergenic
1007551800 6:42735607-42735629 CAAAACAAAAAGATCTGGCCAGG + Intergenic
1007635544 6:43297827-43297849 CAGCAGAAAGAAACCTGGTTAGG + Intronic
1008601398 6:53099443-53099465 CAGAAGGAAGAGAGTTGGCCAGG + Exonic
1008953953 6:57193386-57193408 AAGAAGAGAGACATCTGGTCAGG + Intronic
1009687869 6:66986897-66986919 CAGAAGAAAGAGGTCTCTTTTGG + Intergenic
1010025181 6:71206892-71206914 TAGAAAAAAGAAATCTGGACAGG - Intergenic
1011084512 6:83524134-83524156 AAGAAGAAAAAAATCTGGCCGGG + Exonic
1011357805 6:86490427-86490449 GGGAGGAAAGAGAACTGGTCAGG - Intergenic
1011643661 6:89437314-89437336 CTGAGGAAAAAGAACTGGTCGGG - Intronic
1011996605 6:93597132-93597154 CAGAAGAAAGAGTCCTGGAAAGG - Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1013066799 6:106692126-106692148 CAAAGGAAAGAGATCATGTCAGG - Intergenic
1013074259 6:106756461-106756483 CAAAGGAAAGAAAACTGGTCTGG + Intergenic
1013742860 6:113309292-113309314 CAGAAAACAGAGTTCTGCTCAGG - Intergenic
1013914121 6:115313695-115313717 CAGAATAAAGAGATTTGAGCTGG + Intergenic
1014438351 6:121445444-121445466 GATAAGAAAAAGATCTGGCCAGG - Intronic
1014611035 6:123546661-123546683 CAGAAGACAGAGATTTTGACAGG - Intronic
1015632253 6:135243598-135243620 TAAAAGAAATAGACCTGGTCAGG + Intergenic
1015934322 6:138393185-138393207 ATGAAGAAAGAGATTTGGTGAGG + Intergenic
1016725547 6:147361514-147361536 GAGAAGAAAGAGATGTTTTCAGG + Intronic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1016962443 6:149687004-149687026 CAGAAGAAGTAGTTGTGGTCTGG - Intronic
1017760510 6:157564319-157564341 GAAAAGAAAGAGACCTGCTCAGG - Intronic
1018441810 6:163820587-163820609 AAGAAGAGAGAGATCCGGTCAGG - Intergenic
1019771798 7:2887983-2888005 CAGCAGAAAGAGACCTTGGCAGG - Intergenic
1020362754 7:7347342-7347364 AAGAAGAAAGAGCTATGTTCTGG - Intergenic
1024330670 7:48151677-48151699 CAAAACAAAGACATCTCGTCTGG + Intergenic
1024471259 7:49770647-49770669 GAGCAGAAAGATCTCTGGTCAGG - Intergenic
1024551062 7:50562609-50562631 CATGAGAAAGAGCCCTGGTCAGG + Intronic
1025031986 7:55565001-55565023 CAGAACAAAGAGATATTATCCGG - Intronic
1025257334 7:57393403-57393425 CAAAAGATGGAGATCTGGCCGGG + Intergenic
1027044649 7:74983305-74983327 AAGAAGAAAGAAATGTGGCCGGG - Intronic
1027260922 7:76464014-76464036 CAAAAGACAGAGATCTTATCTGG - Intronic
1027312300 7:76962126-76962148 CAAAAGACAGAGATCTTATCTGG - Intergenic
1028198405 7:87933954-87933976 CAAAAGAAAGAGATCAGCACTGG - Intergenic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029876083 7:103753231-103753253 AAGAAGAAAGACAACTGATCAGG + Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1031165114 7:118218517-118218539 CAGAAGAGATAGAGCTGGTTTGG - Intronic
1031934327 7:127720602-127720624 CAGAAGAAAAAGAACTAGTCTGG - Intronic
1032960715 7:137030477-137030499 CAATAGAGAGAGATCTGTTCAGG + Intergenic
1033305225 7:140220425-140220447 CAGAGAGAAGAGAGCTGGTCTGG + Intergenic
1033440089 7:141370630-141370652 AGGAAGAAAGAGATTTGGACAGG + Intronic
1035031700 7:155865235-155865257 CAGCAGAAGGAGATCTGGCAAGG - Intergenic
1035185809 7:157125265-157125287 CAGAAGAAAGACAGCGTGTCTGG - Intergenic
1035464960 7:159068945-159068967 CAGCAGAAAGAGAACTGCACAGG + Intronic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1038305043 8:26392645-26392667 CAGAAGAGAGCCATCTGCTCTGG - Intronic
1039516611 8:38139067-38139089 CAGAAAAGAGGGACCTGGTCAGG - Exonic
1039591625 8:38754865-38754887 CATAAAAGAGAGATCTGGCCGGG + Intronic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1043216126 8:77591330-77591352 AAGAAAAAAGAGATATGGTTTGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044661995 8:94600636-94600658 CAGAAGAAAGCGATGAGGCCGGG + Intergenic
1044867211 8:96583608-96583630 AAGAAGAAAGATAACTGGTTAGG - Intronic
1045245319 8:100437280-100437302 AAGAAGAGAAAGATCTGGACAGG + Intergenic
1045566887 8:103327297-103327319 AAGAATAAAGAGCTCTGGCCGGG + Intronic
1045953297 8:107876592-107876614 CAGAAGAAGGAAAGCTTGTCAGG + Intergenic
1047099374 8:121659347-121659369 TAGAAGAAAGAAAACTGGGCTGG + Intergenic
1047116354 8:121845828-121845850 CAGAAGAAAGTGAACTGATGAGG + Intergenic
1047387346 8:124422208-124422230 CATAAGAAAGAATTCTGGCCAGG - Intergenic
1047646451 8:126875306-126875328 CAGAAGATATAGAACTGGGCCGG + Intergenic
1048256583 8:132909464-132909486 CTGAAGACAGAGATAGGGTCAGG + Intronic
1049147693 8:141013715-141013737 CAGAAAGAAGAGAACTGATCTGG + Intergenic
1050224129 9:3431863-3431885 CAGAAGAAAGTGCTCTATTCTGG + Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1052384031 9:27804285-27804307 CACAAGAATGAGAGCTGTTCAGG + Intergenic
1052585720 9:30425280-30425302 CAGAAGAAAGAGGTCTCTTTTGG + Intergenic
1054790736 9:69254093-69254115 CAGAGGTAAGTGATCTGCTCGGG + Intronic
1055244002 9:74218470-74218492 CAGAAGAAAGAGATGTCTTTTGG + Intergenic
1056116903 9:83449379-83449401 TAGAAGAAGGACATCTGGTCTGG + Intronic
1057198922 9:93130148-93130170 CAGAGGAAATATATCTGGCCTGG - Intronic
1057937829 9:99255857-99255879 CAGAGAAAAGAGTTCTGGTCAGG - Intergenic
1058184777 9:101841482-101841504 CAAAAGAAAGAAAGCTGGACTGG + Intergenic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1058832974 9:108835915-108835937 AAGAAGGAAGAGAGCTGCTCCGG + Intergenic
1060269837 9:122132550-122132572 CAGTAGAAAGAGCCCTGGACTGG + Intergenic
1061864293 9:133484665-133484687 CAGCAGAAAGAGAGCTGGTCTGG + Intergenic
1062269813 9:135703237-135703259 CAGAAGAAAGGGCTCTGTCCTGG - Intronic
1186371413 X:8951221-8951243 AAAAAGAAAGAGAGCTGCTCCGG - Intergenic
1188409903 X:29858978-29859000 CAGAGGAAAGAGCTTTGGTAAGG - Intronic
1189880947 X:45491587-45491609 AAAAAGAATGAGATCTGGCCAGG - Intergenic
1190363819 X:49673223-49673245 AAGAAGAAGAAGATCTGGCCAGG - Intergenic
1191829544 X:65401663-65401685 CAGAAGGAAGGGATCTGTTTTGG - Intronic
1195097267 X:101515100-101515122 CAGAAGAAAGGGATGAGCTCAGG - Intronic
1195379868 X:104260325-104260347 CAGAATAAAGACCTCTGGTCTGG - Intergenic
1195468548 X:105208666-105208688 TTGAAGAGTGAGATCTGGTCTGG - Intronic
1197323584 X:125064336-125064358 AAAAAGAAAGATATCTGTTCAGG + Intergenic
1198134349 X:133732705-133732727 CAGGAGAAAGAGATCTGTAGAGG + Intronic
1198368943 X:135973135-135973157 CAGGAGAAAGAGCACTGGACTGG - Intronic
1198526022 X:137501841-137501863 GAGAAGAAAGAGTTGTGGCCTGG - Intergenic
1198991178 X:142516177-142516199 CAGAAGAAAGAGGGCTGATATGG - Intergenic
1199532383 X:148864825-148864847 CAGATGAGAGAGAGCTTGTCAGG - Intronic
1199813073 X:151370384-151370406 CAGAACAAAGAGATTTGTACAGG - Intergenic
1199928825 X:152497069-152497091 ATTAAGGAAGAGATCTGGTCTGG - Intergenic
1201668142 Y:16482905-16482927 CAGTGGGAAAAGATCTGGTCAGG - Intergenic
1202603069 Y:26614389-26614411 CAGAAGACAGAGATCTACTGGGG + Intergenic