ID: 932573504

View in Genome Browser
Species Human (GRCh38)
Location 2:72950591-72950613
Sequence TAGTTTTTGGTGGACAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932573504_932573512 8 Left 932573504 2:72950591-72950613 CCTCCCCTGTCCACCAAAAACTA 0: 1
1: 0
2: 0
3: 14
4: 263
Right 932573512 2:72950622-72950644 CCTTGAAGACCACCTCTCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
932573504_932573514 17 Left 932573504 2:72950591-72950613 CCTCCCCTGTCCACCAAAAACTA 0: 1
1: 0
2: 0
3: 14
4: 263
Right 932573514 2:72950631-72950653 CCACCTCTCTGAGGTAAGTGTGG 0: 1
1: 0
2: 2
3: 13
4: 147
932573504_932573515 18 Left 932573504 2:72950591-72950613 CCTCCCCTGTCCACCAAAAACTA 0: 1
1: 0
2: 0
3: 14
4: 263
Right 932573515 2:72950632-72950654 CACCTCTCTGAGGTAAGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 143
932573504_932573516 19 Left 932573504 2:72950591-72950613 CCTCCCCTGTCCACCAAAAACTA 0: 1
1: 0
2: 0
3: 14
4: 263
Right 932573516 2:72950633-72950655 ACCTCTCTGAGGTAAGTGTGGGG 0: 1
1: 1
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932573504 Original CRISPR TAGTTTTTGGTGGACAGGGG AGG (reversed) Intronic
901032107 1:6313142-6313164 TGGTGTCTGGGGGACAGGGGTGG + Intronic
901726823 1:11249217-11249239 TTGGTTTTGGGGGCCAGGGGAGG + Intronic
902066806 1:13695027-13695049 AAGTTCTTGGAGGAGAGGGGTGG + Intergenic
902741497 1:18441752-18441774 GAGTGTTTGGTGGGCAGGGCAGG - Intergenic
902827118 1:18983485-18983507 TATTTTTTGGGGGGGAGGGGTGG - Intergenic
903078225 1:20787962-20787984 CAGGTGTTGGGGGACAGGGGAGG + Intergenic
903093605 1:20946802-20946824 AACTTTTTGGAGGAAAGGGGAGG + Intronic
903322351 1:22550714-22550736 GAGTCCTTGGTGGACAGGAGTGG + Intergenic
904592380 1:31622214-31622236 AGGTTTTTGGGGGGCAGGGGTGG + Intronic
905029331 1:34871076-34871098 CAGTCTTGGGTGGACTGGGGAGG - Intronic
905522955 1:38614268-38614290 CAGTGTTTGGTGGGGAGGGGAGG - Intergenic
910688019 1:89938148-89938170 TTGTTTTTGAAGGGCAGGGGTGG + Intergenic
911168523 1:94746253-94746275 AAGATTTTGATGGAGAGGGGAGG - Intergenic
913974807 1:143446736-143446758 TTATTTATGGTGGTCAGGGGAGG - Intergenic
914069198 1:144272352-144272374 TTATTTATGGTGGTCAGGGGAGG - Intergenic
914109957 1:144694002-144694024 TTATTTATGGTGGTCAGGGGAGG + Intergenic
918384036 1:183986919-183986941 TACTCTTTGTTGGACAGGTGTGG - Intronic
918943125 1:191026999-191027021 TAGTTCCTGGTGGGGAGGGGCGG + Intergenic
919667372 1:200304946-200304968 TTGTTTTTGGGGGGCAAGGGTGG - Intergenic
919801471 1:201357186-201357208 TATTTTTCCATGGACAGGGGTGG - Intergenic
921018635 1:211215541-211215563 TAGTTTTTTATGGCCAGGCGTGG - Intergenic
922241714 1:223759691-223759713 TATTTTTGGTTGGAAAGGGGTGG + Intronic
924359702 1:243225243-243225265 TGGTTTTTGGTGAGCAGTGGAGG - Exonic
1065857409 10:29841647-29841669 AAGTATTTGTTGGCCAGGGGCGG - Intergenic
1067767157 10:49095487-49095509 CAATTGTTGGGGGACAGGGGTGG - Intronic
1068515509 10:58021034-58021056 TAGTTTTTGGGGAAAAGGTGGGG - Intergenic
1070073817 10:73115785-73115807 TAGTTCTTGGGGGAAGGGGGTGG - Intronic
1071662748 10:87521439-87521461 TAGTTTCTGGAGGAAAGGGAAGG - Intronic
1071954319 10:90741353-90741375 CATTTTTTGGTGGGTAGGGGTGG + Exonic
1072649871 10:97286692-97286714 ATGTTTCTGGAGGACAGGGGAGG - Intronic
1073041791 10:100612806-100612828 TAGGTTTTGCAGGACAGTGGTGG - Intergenic
1073347626 10:102796164-102796186 TTGCTTATGGTGGACATGGGAGG + Intronic
1074070927 10:110068538-110068560 TGGATTTTGGTGGCCATGGGAGG + Intronic
1077453029 11:2662382-2662404 TCTTTTTTGGGGGGCAGGGGAGG - Intronic
1077737721 11:4808766-4808788 TTTTTTTTGGTGGACAATGGAGG + Intronic
1078334741 11:10454749-10454771 TAGTGTTTTGGGGAAAGGGGAGG - Intronic
1079115422 11:17637887-17637909 AACGTTTTGGTGGATAGGGGAGG - Intronic
1079381010 11:19937352-19937374 GAGGTTTTGGTGGGCGGGGGGGG - Intronic
1080137971 11:28880066-28880088 TAGTGTTTAGTGAACATGGGAGG - Intergenic
1080994617 11:37583236-37583258 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
1082197179 11:49320759-49320781 TGTTCTCTGGTGGACAGGGGTGG + Intergenic
1083490424 11:63011434-63011456 GTGTTTTTGGAGGACATGGGCGG + Intronic
1085634817 11:78150470-78150492 TATTTTTTGGTGGAGTGGGAGGG + Intergenic
1086319491 11:85629621-85629643 TTGTTTTTGGTGGAAGGTGGAGG + Intronic
1090178998 11:124677180-124677202 TTGTCTTTGGTTGACATGGGTGG - Intronic
1091182618 11:133620463-133620485 TAGTTTTTAGAGCACATGGGAGG + Intergenic
1092895269 12:13004264-13004286 CACTTTTTGGTGGGTAGGGGTGG - Intergenic
1095398396 12:41787376-41787398 TGGCTTGTGCTGGACAGGGGAGG - Intergenic
1097289896 12:57905776-57905798 TAATTTTGGGTGGAGCGGGGTGG + Intergenic
1099106635 12:78505489-78505511 TAGGATTAGGTGAACAGGGGAGG + Intergenic
1100676570 12:96875019-96875041 TAATTTTTGGTTAACAGGTGAGG + Intronic
1101757468 12:107632219-107632241 TCTTTTTTGGCGGACAGCGGTGG - Intronic
1102318253 12:111907765-111907787 TAGTTTCTTGTGGCCAGGTGTGG - Intergenic
1104404994 12:128509764-128509786 CGGCTCTTGGTGGACAGGGGAGG + Intronic
1106368610 13:29108699-29108721 CAGCATTTGGTGGGCAGGGGAGG + Intronic
1107781154 13:43903748-43903770 TCCTTTTTGGGGGGCAGGGGAGG - Intergenic
1111131475 13:83982318-83982340 TAGTTACTAGTGGACAGGGATGG + Intergenic
1113057978 13:106290057-106290079 CAGATTTTGGTGGTCATGGGAGG + Intergenic
1113067350 13:106385842-106385864 TTGTTTTTGGTGGACTGACGTGG - Intergenic
1114550776 14:23531702-23531724 TAGTTTCTGCTGGACATGGAGGG - Exonic
1115151158 14:30287231-30287253 TACTTTTTGGTGCATAGGAGTGG + Intergenic
1115988091 14:39123362-39123384 TATTTTTTCTTGGGCAGGGGAGG - Intronic
1116704413 14:48278642-48278664 TGTTCTTTGGTGGGCAGGGGTGG + Intergenic
1118583976 14:67333843-67333865 TAGTTTTTTGTATACATGGGAGG + Exonic
1121215452 14:92244237-92244259 TAAGTTTTGGGGGCCAGGGGTGG - Intergenic
1121323358 14:93005744-93005766 TATTTTTGGGTGCACAGGTGAGG - Intronic
1121372711 14:93374994-93375016 GAGTTTTGGGGGGTCAGGGGTGG + Intronic
1122327342 14:100890612-100890634 TAGTTTCTGGAGGCCAGGAGAGG - Intergenic
1123399484 15:19970131-19970153 AAATTTCTGGTGGACAGGTGTGG - Intergenic
1125080686 15:35669327-35669349 TATTTTTTGGTGGGCTGGTGGGG + Intergenic
1126555296 15:49980844-49980866 TAGCTTATGGTGGGCAGGGCTGG - Intronic
1128112023 15:65082486-65082508 AGGTCCTTGGTGGACAGGGGTGG - Intergenic
1129081556 15:73045566-73045588 TAGTATTTTGTGGCCAGGCGTGG + Intergenic
1129978474 15:79844664-79844686 TAGCTTTTGGTGGTTAGTGGAGG - Intronic
1132505302 16:305126-305148 CAGGATTTGGAGGACAGGGGAGG + Intronic
1132929681 16:2452457-2452479 CAGCTTTTGGTGGCCAGGGTTGG - Intronic
1135131710 16:19859039-19859061 TAGTGTTTGGGGGCCGGGGGAGG - Exonic
1137679516 16:50327675-50327697 TAGTGTTTGGGGGTCAGGGAAGG - Intronic
1138572657 16:57885451-57885473 GAGTGTAGGGTGGACAGGGGAGG - Intronic
1141425853 16:83943951-83943973 CAGGATTTGGTGGACAGAGGTGG + Intronic
1141864488 16:86740796-86740818 TGGTTTTTGGGGAACAGGTGGGG - Intergenic
1144274472 17:13652484-13652506 TACTGTTTGTTGGACAGGCGCGG + Intergenic
1146684357 17:34830823-34830845 TGGTGTGTGGTGGATAGGGGTGG - Intergenic
1147039944 17:37710777-37710799 TTCTTGTGGGTGGACAGGGGAGG - Intronic
1147181424 17:38688365-38688387 AAGTATTTGGTGGCCAGGTGTGG - Intergenic
1147241680 17:39094783-39094805 TAATTTGTGGTGGGCTGGGGAGG - Intronic
1148515061 17:48209192-48209214 AAGTTTTTGATGGAAAGAGGAGG - Intronic
1149273011 17:55002991-55003013 TAGTTTTTGGGGTCAAGGGGAGG - Intronic
1149978366 17:61288896-61288918 TTGGTTTTGGAGGACAGGGGTGG + Intronic
1150460641 17:65347436-65347458 TAGTCTATGGGGGACAGTGGGGG + Intergenic
1155326381 18:24669109-24669131 TAGTGTTTGGTGAGCTGGGGTGG + Intergenic
1155902150 18:31405069-31405091 TAGATTTTGGTGGACATAGCTGG + Intronic
1156080594 18:33329962-33329984 TTTTTTTTGGTGGAGTGGGGAGG + Intronic
1157000194 18:43513967-43513989 TAGTTTTTAGGGGATAGAGGAGG + Intergenic
1158498620 18:57979772-57979794 TTATTTCTGGTGGACAGGTGTGG - Intergenic
1158898602 18:61939735-61939757 TTTTTTTTGGTGGAAGGGGGAGG - Intergenic
1159682030 18:71366908-71366930 CAGTTATTGGTGGAGAGGTGTGG + Intergenic
1164943675 19:32271616-32271638 TATCTTTGGGTGGAAAGGGGAGG - Intergenic
1166026121 19:40086705-40086727 TTCTTTTTGGGGGGCAGGGGTGG + Intronic
1166056734 19:40294430-40294452 TTTTTTTTGGTGGTGAGGGGAGG + Intergenic
1166858151 19:45793435-45793457 TAGGTTTTGGAGGACAAGTGAGG - Intergenic
1167328717 19:48840958-48840980 TAGTGGTGGGTGGACAGGAGTGG - Intronic
1167559725 19:50218629-50218651 TAGTTTTTGGGAAACAGGCGGGG + Intronic
926764287 2:16310146-16310168 TAATTTTTTGTGTACAGTGGGGG - Intergenic
926958380 2:18327427-18327449 TAGCTACTGGTGGACGGGGGTGG + Intronic
930952759 2:57163194-57163216 TAGGCTATGGTGGACAGGTGAGG + Intergenic
932272704 2:70424782-70424804 TGGCTTTTGATGGACAGGTGTGG + Intergenic
932573504 2:72950591-72950613 TAGTTTTTGGTGGACAGGGGAGG - Intronic
932696895 2:73964580-73964602 TAGTAATTGGGGGGCAGGGGAGG - Intergenic
933030532 2:77323248-77323270 AATTTTTTGGTGGTCAGCGGAGG + Intronic
934179506 2:89607704-89607726 TTATTTATGGTGGTCAGGGGAGG - Intergenic
934289798 2:91681972-91681994 TTATTTATGGTGGTCAGGGGAGG - Intergenic
936856780 2:116967688-116967710 TATTCCTTGGTAGACAGGGGAGG - Intergenic
939571401 2:143844326-143844348 AAGTTTTTTGGGGAGAGGGGAGG + Intergenic
941975366 2:171398521-171398543 AAGTTTTTAATGGATAGGGGAGG + Intronic
943705262 2:191027336-191027358 GAGTTTTGGGGGGCCAGGGGAGG + Intergenic
943865072 2:192918535-192918557 TATTCTCTGGTGGGCAGGGGTGG - Intergenic
944658328 2:201898996-201899018 TAGAAATTGGTGGAAAGGGGAGG + Intergenic
945180594 2:207087397-207087419 TAGTGTTTGGTGAATAGGGAAGG - Intronic
947177969 2:227386364-227386386 CAGTTTTAGGTGGGCAGGAGGGG - Intergenic
947769359 2:232658726-232658748 TAGTTGCTGGGGGATAGGGGTGG + Intronic
948671520 2:239571609-239571631 TAGAGTTTGGGGGGCAGGGGAGG - Intergenic
1169269309 20:4187186-4187208 GAGGTTCTGGTGGAGAGGGGTGG + Intronic
1173961044 20:47072801-47072823 TAATTTTAGGTGTACAGGGAAGG - Intronic
1175694679 20:61092785-61092807 GAGTTTGTGGTGAACAGGGGAGG + Intergenic
1176273500 20:64248706-64248728 TACTTGGTGGTGGTCAGGGGTGG - Intergenic
1178543381 21:33474174-33474196 TGTTTTTTGGGGGGCAGGGGAGG + Intronic
1180258779 21:46651707-46651729 TAGTTGTTGGGGCACAGGGTTGG + Intronic
1181780870 22:25192245-25192267 TTGTGTTGGGTGGAAAGGGGAGG - Intronic
1183524855 22:38317067-38317089 TTGTTTTTGCTGGAGAGGGAGGG - Intronic
1183765736 22:39872499-39872521 TAGGTTTTGTTGGGCAGTGGGGG - Intronic
1184672764 22:46024018-46024040 TGGTTTCTGGTGGACAGAAGGGG - Intergenic
1184788160 22:46681922-46681944 CAGTGTTTGGAGGACAGGGTTGG + Intergenic
1184975433 22:48058240-48058262 TTGTTTTGGGTGGACTGGGGTGG - Intergenic
949176486 3:1069267-1069289 TGGTTTCTGGTGTACAGGGGAGG + Intergenic
949616036 3:5754712-5754734 TTGTTTCTGAAGGACAGGGGAGG + Intergenic
950445186 3:13033159-13033181 TGGTGTTTGGTGGTCAGGGCTGG - Intronic
950687796 3:14631229-14631251 TAGTTCTTGATGGGCGGGGGTGG - Intergenic
951028146 3:17851093-17851115 AAGATTTTGGTGGTCAGAGGGGG - Intronic
951298364 3:20967716-20967738 TGTTCTTTGGTGGGCAGGGGTGG + Intergenic
952834548 3:37591996-37592018 TAGTCATGGGTGGATAGGGGTGG + Intronic
953454251 3:43029471-43029493 TAGCTCTTGGTGGACAGTGGAGG - Intronic
954154801 3:48679444-48679466 GAGTTTCTGGTGGTCTGGGGGGG + Exonic
954743894 3:52775722-52775744 TGGTTTTTGGGGAACAGGGTGGG + Intergenic
957105165 3:75877704-75877726 TAGTATTTGGTTGACAGGTTTGG + Intergenic
958462198 3:94412900-94412922 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
959287895 3:104440105-104440127 TGTTTTCTGGTGGGCAGGGGTGG + Intergenic
959288713 3:104445519-104445541 TGTTTTCTGGTGGGCAGGGGTGG + Intergenic
959401774 3:105911373-105911395 TAGTTTTAGGTGGTCAGAGGAGG + Intergenic
960387518 3:117037894-117037916 TATTTTTTGGTAGAGATGGGGGG + Intronic
962044445 3:131740666-131740688 TAGTTTAAAGAGGACAGGGGAGG - Intronic
962459363 3:135594965-135594987 TTGTTTTTGGTGGTTGGGGGTGG - Intergenic
964025239 3:152065496-152065518 TAAATTATGGTGAACAGGGGTGG - Intergenic
964094673 3:152917417-152917439 TCCTTTCTGGTGGACAGTGGAGG - Intergenic
966303041 3:178499827-178499849 TTGTTTTTGGTGGAGAGAAGGGG + Intronic
966397117 3:179515479-179515501 TATTCTCTGGTGGGCAGGGGCGG + Intergenic
966508218 3:180730988-180731010 TATTTTTTGGGGAAAAGGGGTGG + Intronic
969089723 4:4684788-4684810 AAGTTGTTGGTGTACAGGGCTGG + Intergenic
969829775 4:9785914-9785936 TTATTTATGGTGGTCAGGGGAGG + Intronic
971013070 4:22460407-22460429 TCCTTTCTGGTGGAGAGGGGAGG - Intronic
971184341 4:24359249-24359271 TAGTGTTTGGAGGTCAGGAGAGG - Intergenic
973058690 4:45692005-45692027 TGTTCTCTGGTGGACAGGGGCGG - Intergenic
973655673 4:53044911-53044933 AAGTTTTTTGTGGGCGGGGGGGG - Intronic
976085847 4:81406485-81406507 TAGTTTATTGTGGACGGGTGGGG - Intergenic
976605720 4:86980948-86980970 TTTTTTTTGGTGGAGGGGGGGGG - Intronic
977452846 4:97221183-97221205 TAGTTTCTGGAGAACAGAGGTGG - Intronic
978231984 4:106410651-106410673 TATTCTTTGGCGGGCAGGGGCGG + Intergenic
978823887 4:112997409-112997431 TAGTTTTTGGAGGATAGAGGAGG - Intronic
979047138 4:115881953-115881975 TTTTTTTGGGTGGTCAGGGGAGG - Intergenic
979843158 4:125471759-125471781 TAGTTACTGGTGGCCAGGCGGGG + Intronic
983509227 4:168589536-168589558 TAGTTTTTGGTGGTGGGGGTTGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985528529 5:420421-420443 TAGTGTTTGGTGAGCAGTGGGGG - Intronic
986652667 5:9979879-9979901 TGATTTTTGGGGGAAAGGGGTGG - Intergenic
986793104 5:11182426-11182448 TAGTTTTTGGAGGAGAGGGATGG + Intronic
988270233 5:29004523-29004545 TAGATTCTGGGGGGCAGGGGTGG - Intergenic
989181072 5:38577603-38577625 AAGTTCTTGGTTGACAGGGCAGG - Intronic
989451164 5:41588014-41588036 TTGTTTTTGGAGGGCATGGGAGG + Intergenic
991542377 5:67743972-67743994 CAGTTTTCCATGGACAGGGGTGG - Intergenic
991573154 5:68076447-68076469 GAGTTTTTAGGGGCCAGGGGTGG + Intergenic
992407071 5:76469692-76469714 TAGTTTTTTGAGGCCAGGAGCGG - Intronic
995494134 5:112723655-112723677 TGGTTTTTTGTGGGCAGGGCTGG - Intronic
995578277 5:113565521-113565543 TATTTTTTGGAGGACAAGAGTGG + Intronic
995872964 5:116761742-116761764 CAATGTTTTGTGGACAGGGGTGG - Intergenic
996259816 5:121452740-121452762 TAGTTGTGGGTGGAGATGGGGGG + Intergenic
997144607 5:131419323-131419345 TATTATTTGGTGGGCGGGGGTGG - Intergenic
997215230 5:132104392-132104414 CAGTTCTTGGTGTACAGGGATGG - Intergenic
997303407 5:132822776-132822798 TAGTTATAGGTGGAGAGGGTGGG - Exonic
1001904983 5:175464545-175464567 TTGATTTTGGTGGACAGGTAGGG - Intergenic
1002350335 5:178578664-178578686 GAATTTTTGGGGGGCAGGGGTGG - Intronic
1004268166 6:14167779-14167801 TAGTTTTAGATCGACAAGGGAGG + Intergenic
1004395913 6:15246202-15246224 TAGTTTTTGGAGGAAAAAGGGGG + Intergenic
1005496990 6:26396315-26396337 CAGGTTTTGGAGGCCAGGGGAGG + Intergenic
1005722084 6:28612839-28612861 GAGTTTGTGGTGGAGAGGAGTGG - Intronic
1006073978 6:31517526-31517548 TATTTTTTGGTGGTGAGGGTTGG - Intergenic
1006357169 6:33566697-33566719 TTTTTTTTGGTAGACAAGGGGGG + Intergenic
1007904646 6:45447129-45447151 TAGGTTTTGGAAGATAGGGGAGG + Intronic
1008982563 6:57502026-57502048 TGGTTTTTGGTGGAGGGGGTTGG - Intronic
1009170631 6:60394889-60394911 TGGTTTTTGGTGGAAGGGGTTGG - Intergenic
1009363404 6:62839988-62840010 TTGTTTTTAATGGCCAGGGGAGG + Intergenic
1009842295 6:69092915-69092937 CAATGTTTGGTGGAGAGGGGTGG + Intronic
1010894944 6:81350904-81350926 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
1011394482 6:86891819-86891841 TGGGTTTTGGGGGATAGGGGTGG - Intergenic
1011936293 6:92782515-92782537 TAGTTTTTGAGGGTCAGGAGTGG + Intergenic
1012066871 6:94559336-94559358 TATTCTCTGGTGGGCAGGGGTGG + Intergenic
1013000330 6:106015565-106015587 TGGTCTCTGGTGGACAGGTGTGG + Intergenic
1013580447 6:111529034-111529056 TAGTTTGTGGTGGAAAGAAGAGG + Intergenic
1015579920 6:134713350-134713372 TAGTATTTGTTGGCCAGGTGTGG + Intergenic
1016130023 6:140456694-140456716 TAGTTATTGCTGGATGGGGGAGG + Intergenic
1016822020 6:148355888-148355910 TAGTTTTTGGGGAACAGGTCAGG + Intronic
1016873710 6:148843666-148843688 TAGTTTTAGGTAGACAGAGCTGG - Intronic
1018593605 6:165454357-165454379 TGAATTTTGGTGGCCAGGGGTGG + Intronic
1018765677 6:166931444-166931466 TAGTTGTTGGTGGATGAGGGTGG - Intronic
1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG + Intronic
1025023113 7:55495423-55495445 GAGCATTTGGTGGACAGGAGTGG - Intronic
1027331686 7:77102790-77102812 TGGTTTTTGGTGGGTAGGGGTGG + Intergenic
1029232097 7:99078928-99078950 AATTTTTCCGTGGACAGGGGTGG - Intronic
1029380367 7:100210271-100210293 TTGTTTTTAGTGGAGAAGGGGGG + Intronic
1029696796 7:102218878-102218900 TAATTTTTTGTGGAGATGGGGGG - Intronic
1029784084 7:102768545-102768567 TGGTTTTTGGTGGGTAGGGGTGG - Intronic
1030459646 7:109816906-109816928 TATTTTATGGGGGGCAGGGGAGG - Intergenic
1030773426 7:113503373-113503395 TAGTTTTTGAAGGACAGGTTAGG + Intergenic
1031468594 7:122143813-122143835 TCTTTTTTGGCGGACAGTGGTGG - Intronic
1032058052 7:128699265-128699287 TTGTTTTTGGTGGTGGGGGGGGG - Intergenic
1032759794 7:134929262-134929284 TAGTTTTGGGGGAACAGGTGGGG + Intronic
1034029929 7:147750107-147750129 TGGTATTTGGTGGGCTGGGGTGG - Intronic
1036513615 8:9422858-9422880 TTTTTTTTGGTGGACGGTGGGGG - Intergenic
1036758215 8:11485941-11485963 TTGTTATGGGTGAACAGGGGTGG - Intergenic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1037513341 8:19605497-19605519 TAGGCATTGGAGGACAGGGGAGG - Intronic
1037550000 8:19961245-19961267 TTATTTTTGGGGGGCAGGGGGGG + Intronic
1038055759 8:23856223-23856245 TAGTTTGTGGTTAACAGGGGTGG - Intergenic
1038551899 8:28477684-28477706 TGGGTGTTGGTGGACAGAGGAGG - Intronic
1040323780 8:46331049-46331071 TTGTGTTTGGTGGCCATGGGTGG + Intergenic
1040978104 8:53216119-53216141 GAGTTTTTGGTGGGCAGAGAGGG + Intergenic
1041010354 8:53536271-53536293 TGTTCTTTGGTGGGCAGGGGAGG - Intergenic
1041922389 8:63196702-63196724 TATTTTTGGGTTGAGAGGGGTGG + Intronic
1042409953 8:68453462-68453484 TAGTTTTTGGTGTACAAGACTGG + Intronic
1042590385 8:70392727-70392749 CAGTTTTTAGTGGATAGAGGAGG - Intronic
1042705797 8:71664833-71664855 TGTTCTTTGGTGGGCAGGGGCGG - Intergenic
1042706618 8:71670252-71670274 TGTTCTTTGGCGGACAGGGGCGG - Intergenic
1043944148 8:86230884-86230906 TTGTTTTTGGTAGAGATGGGGGG + Intronic
1044766936 8:95586505-95586527 CATTTTTTGGTGGGTAGGGGTGG - Intergenic
1045019997 8:98034126-98034148 TAGTTTCTGGAGGACAGGAGTGG + Intronic
1045737203 8:105310097-105310119 TAGGTTTTGGGAGACAGGGCAGG - Intronic
1046032558 8:108800995-108801017 TACTTTTTGGAGGACAGAAGAGG - Intergenic
1046652949 8:116859405-116859427 TATTTTTTAGTAGACATGGGGGG + Intronic
1046968554 8:120194397-120194419 TAGATTTTGGGGGTAAGGGGGGG - Intronic
1049805111 8:144535179-144535201 CAGTTTCTGGTGGACAGCTGAGG + Intronic
1049863967 8:144921358-144921380 TACTTTCTGGAGGACAGGTGTGG - Intergenic
1050854456 9:10334423-10334445 TATTTTTTGGTGGTGGGGGGTGG - Intronic
1051856298 9:21570530-21570552 TATTTTTTGGTGGAGGTGGGAGG - Intergenic
1052026442 9:23578107-23578129 TAGCTTTTGGAGGAGAGGGGAGG - Intergenic
1052098634 9:24415152-24415174 CTTTTTTTGGTGGAGAGGGGCGG + Intergenic
1052257412 9:26474581-26474603 TAGTTTTTGTTGGCCAAGGTGGG - Intergenic
1055587592 9:77771603-77771625 TAGTGTTTAGTGGACAGGACTGG + Intronic
1057593851 9:96397665-96397687 TTCTTTTTGGTGGAGAGTGGTGG - Intronic
1059441561 9:114310202-114310224 AAGTTTTTGGGGAACAGGTGGGG - Intronic
1061582741 9:131547427-131547449 TCTTTTCTGGTGGGCAGGGGTGG - Intergenic
1061939053 9:133874377-133874399 TTTTTCCTGGTGGACAGGGGAGG - Intronic
1062321309 9:135991694-135991716 TAATTTTTGGTAGAGATGGGGGG - Intergenic
1185973612 X:4693424-4693446 TAATTTTTGGTGGGGAGGAGGGG - Intergenic
1186325401 X:8471366-8471388 TATTTTTTTGTGGAGGGGGGAGG + Intergenic
1187336266 X:18384849-18384871 TTGTTTTTTGTAGACATGGGGGG - Intergenic
1187456829 X:19448557-19448579 TTTTTTTTCGGGGACAGGGGGGG - Intronic
1187999436 X:24966371-24966393 TTGCTTTTGGATGACAGGGGTGG - Intronic
1189308147 X:40002783-40002805 CAGCTTTTGATGGACTGGGGAGG - Intergenic
1190294001 X:49013707-49013729 TATTTTTTTGTGGCCGGGGGCGG + Intergenic
1190989437 X:55530508-55530530 TAATTTTTAGTGGTCAGGGAAGG + Intergenic
1192246606 X:69378295-69378317 TAGTCTTTGGGGTACAGGAGTGG - Intergenic
1195591376 X:106631531-106631553 TAATTTTTGGTAGAGATGGGGGG - Intronic
1196649900 X:118158023-118158045 TTTTTTTTGGTGGAGCGGGGAGG + Intergenic
1198109610 X:133491494-133491516 TAGCTTTGGTTGAACAGGGGTGG - Intergenic
1199424765 X:147688284-147688306 TAGTTTTTGGGGAACAGGTGGGG - Intergenic
1199721640 X:150546848-150546870 TCGTGTTTGGTGGAAGGGGGCGG + Intergenic
1199914265 X:152321895-152321917 TATTTTTTGATGGAGAGGAGAGG - Intronic
1201718338 Y:17071380-17071402 AAGTGTGTGCTGGACAGGGGAGG + Intergenic
1201719418 Y:17080395-17080417 AAGTGTGTGCTGGACAGGGGAGG + Intergenic