ID: 932573567

View in Genome Browser
Species Human (GRCh38)
Location 2:72950862-72950884
Sequence AGGGGCCTTCTCCGGGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932573563_932573567 -7 Left 932573563 2:72950846-72950868 CCACAGACTGGCTCTGAGGGGCC 0: 1
1: 0
2: 2
3: 28
4: 302
Right 932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932573567 Original CRISPR AGGGGCCTTCTCCGGGGATA AGG Intronic
900157286 1:1208345-1208367 AGGGGCCTTCTGCGGCGAGAGGG - Intergenic
902146832 1:14408764-14408786 AGGGACCTTCTCTGGTGCTATGG - Intergenic
907302335 1:53496137-53496159 TGGGGCCTTCTCCCAGGATGGGG + Intergenic
908634324 1:66145536-66145558 ATAGGCCTTTTCTGGGGATAAGG + Intronic
910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG + Intergenic
912682404 1:111737916-111737938 AGGGGCCAGCTCTGGGGGTAGGG - Intronic
915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG + Exonic
921363658 1:214353721-214353743 ATGGGCCATCTCCTGGGACATGG - Exonic
922485877 1:225972655-225972677 TGGTTCCTTCTCTGGGGATAGGG + Intergenic
923298270 1:232616086-232616108 AGGGGCCATCTCCATGGCTATGG - Intergenic
1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG + Intronic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1069637001 10:69930998-69931020 AGGGGCCTTCTCTGGGTCTCAGG + Intronic
1073484724 10:103809492-103809514 ATGGACCTTCTCTGGGGAAAAGG + Intronic
1074624503 10:115165601-115165623 AGGGGACCTCTCCAGAGATATGG + Exonic
1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG + Intergenic
1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG + Intronic
1076175088 10:128362284-128362306 ATGAGCCTTCTCAGGGGATATGG - Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1081633075 11:44702497-44702519 AGTGGGCTTCTCGGGGGAGATGG + Intergenic
1084542920 11:69798481-69798503 AGGGGCCCTCACCGGGCACATGG - Intergenic
1084942465 11:72620316-72620338 AGGGGCCTTCTCCTGGGCCTTGG - Intronic
1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG + Intronic
1089662513 11:119994563-119994585 AGGGGCCTCCACTGGGGAGAAGG - Intergenic
1091066958 11:132523424-132523446 AAGGGCCTTCTCTGAGTATAGGG - Intronic
1091611215 12:2011341-2011363 AGGAGCCTTGTCCTGGGACATGG + Intronic
1097454590 12:59781959-59781981 AGTGGCCTTCTCCAGGGAGGAGG + Exonic
1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG + Exonic
1105503098 13:20989116-20989138 GGGGGCCGACTCCGGGGAAAAGG + Exonic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1132390461 15:101434739-101434761 TGGGGGCTTCTCCGTGGAGACGG + Intronic
1136091474 16:27923290-27923312 AGGAGCCTTCTCGGGGTACAGGG - Intronic
1138273067 16:55710005-55710027 CTGGGCCTTCTCTGGGGACAGGG - Intergenic
1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG + Exonic
1146520232 17:33520649-33520671 AGGGGCCCTGTCCGTGGGTAAGG - Intronic
1147652887 17:42072234-42072256 AGGACCATTCTCCGGAGATAGGG - Intergenic
1148845206 17:50525993-50526015 AGAGGCCTTCTCTGTGGCTATGG - Exonic
1151306070 17:73263360-73263382 TGGGGCCATCTCTGAGGATAGGG - Intergenic
1152314570 17:79572608-79572630 TGGGGCCACCTCCGGGGAAAGGG - Intergenic
1152570327 17:81118844-81118866 GGGGGCCTTCTCCGAGGAGGTGG + Intronic
1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG + Intronic
1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG + Intergenic
1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG + Intronic
1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG + Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG + Exonic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935590805 2:104844378-104844400 AGGGTCCTTCTCTTGGGAGAGGG - Intergenic
937579150 2:123462263-123462285 AAGGGGTTTCTTCGGGGATAAGG - Intergenic
948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG + Intergenic
1171458278 20:25283932-25283954 AGGGGTCTTCTCATGGGAAAAGG - Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1173704722 20:45101208-45101230 AGGGGCATCCTCCGGAGTTACGG + Intergenic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1183377252 22:37472448-37472470 GGGGTCCTCCTCCGGGGAGAAGG + Exonic
1184879808 22:47297609-47297631 AGGGGCATTTTCCGGGCAGAGGG + Intergenic
1185334164 22:50264091-50264113 AGGGGCTTTCTCCTTGGATGTGG - Exonic
956958617 3:74371847-74371869 ATGGGGCTTCTCCGAGGCTAAGG - Intronic
961096041 3:124157856-124157878 AGGGGCATTCGCAGGGGAAAGGG - Intronic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
962144424 3:132825206-132825228 AGGGTCCTTCACCAGGGATTTGG - Intergenic
964423867 3:156532177-156532199 AGTGGCCATCTCATGGGATAGGG - Intronic
967065462 3:185911325-185911347 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967074738 3:185991807-185991829 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG + Intergenic
980467379 4:133203401-133203423 AGGGGCCTTTTCCAAGGAAATGG + Intronic
981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG + Intronic
983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG + Intronic
985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG + Intronic
998463766 5:142326856-142326878 AGGGTCCTGCACCGGGTATATGG + Intergenic
999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG + Intronic
999846327 5:155484640-155484662 AGTGGCCTTATCATGGGATAAGG - Intergenic
1004080793 6:12390709-12390731 AGGGGTCTTCTGCGGGCAGAGGG - Intergenic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1015985545 6:138880826-138880848 AGGGGACTTCACGGGGGCTACGG - Intronic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1019336497 7:485328-485350 ATGGGCTTTCTCCTGGGACAGGG - Intergenic
1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG + Intronic
1019540015 7:1547225-1547247 AGGGGACTTGTCCGGGGAGCTGG - Intronic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG + Exonic
1034449088 7:151127907-151127929 AGGAGCCTGCCCCGGGGACAGGG - Intronic
1037656366 8:20887653-20887675 AGGTCCCTTCTCAGGGGACATGG - Intergenic
1040550954 8:48437221-48437243 GGGGGCCTTCTCCTGGGCTTGGG + Intergenic
1049473162 8:142785198-142785220 AGGGGCCTTCCCTGGGGGGAAGG + Exonic
1051707869 9:19899504-19899526 ACTGGCCTTCTCCTGGTATAAGG - Intergenic
1052473492 9:28929454-28929476 AGCTGCCTTCTCTGAGGATATGG - Intergenic
1060811091 9:126611872-126611894 AGCCGCCTTCTCCGGGCATCTGG - Intergenic
1061834245 9:133318320-133318342 AGGGGCCTTCTCCAGGTGTCAGG + Intergenic
1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG + Intergenic
1062238052 9:135522032-135522054 AGGGGCCTTCTCCAGGTGTCAGG + Exonic
1186776875 X:12873646-12873668 AGGGGCCTTCCCTGGGAAGAGGG - Intronic
1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG + Exonic
1191668938 X:63731209-63731231 GGGGGCCTTCTGAGAGGATACGG - Intronic
1198274879 X:135090810-135090832 TGGGGCCTTCTCCTTGGACATGG - Intergenic
1200229612 X:154437479-154437501 AGGGGGCCTCTTCGGGGAGATGG - Intronic