ID: 932574484

View in Genome Browser
Species Human (GRCh38)
Location 2:72955226-72955248
Sequence CTAATTAGGAGCAGTTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932574484_932574487 -3 Left 932574484 2:72955226-72955248 CCTGTTAAACTGCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 932574487 2:72955246-72955268 TAGTTCCCTGTCACCACGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 683
932574484_932574486 -7 Left 932574484 2:72955226-72955248 CCTGTTAAACTGCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 932574486 2:72955242-72955264 TAATTAGTTCCCTGTCACCACGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932574484 Original CRISPR CTAATTAGGAGCAGTTTAAC AGG (reversed) Intronic
909052355 1:70781533-70781555 CTACTTAGTATCAGTTAAACGGG - Intergenic
917226744 1:172791388-172791410 CAAATTAGGAGAAGTATAATAGG - Intergenic
917575749 1:176320030-176320052 CTAATTTTAAGCAGTGTAACTGG + Intergenic
917677928 1:177338033-177338055 CTTTTTAGAAGCAGTTTAAAAGG - Intergenic
1069408950 10:68132846-68132868 CTCAGTAAGAGCAGTTTGACAGG + Intronic
1081962534 11:47148931-47148953 CTAATTAGGGTCAGTTTCCCTGG - Intronic
1090972494 11:131655384-131655406 CTAATTAGTAGCATTTAATCTGG + Intronic
1091160640 11:133416517-133416539 AGGATTAGGAGCAGTTTATCAGG - Intronic
1092159439 12:6308014-6308036 CTAATGAGGAGCATCTTACCTGG + Intergenic
1093214495 12:16347586-16347608 CTAATTAACAGGAGATTAACTGG + Intronic
1094213066 12:27912913-27912935 CTAATTTGGAACAGTGCAACTGG - Intergenic
1099084414 12:78227262-78227284 CTAAAAAAGAGAAGTTTAACTGG + Intergenic
1100910290 12:99353074-99353096 CTAATTAGGAGAAGGGTAACCGG - Intronic
1100951117 12:99851334-99851356 TTAATTAGGAAGAGTTGAACTGG - Intronic
1108207144 13:48101889-48101911 CTAATTAAAAGCAGTTAAAATGG - Intergenic
1108338339 13:49470544-49470566 CTAATCTTGAGCAGTTTAGCTGG - Intronic
1110958254 13:81584577-81584599 CTAAATAGGAGCTTTATAACAGG - Intergenic
1111326746 13:86707441-86707463 CTAATTTGGAGCAAGTTAATTGG + Intergenic
1111811120 13:93095785-93095807 CTTATTAGGAACAGTATCACCGG - Intergenic
1113266562 13:108624663-108624685 CTAGTGAGGACCAGTTAAACTGG - Intronic
1115669670 14:35595978-35596000 CTAATTAGTAGGAGTTAACCAGG + Intronic
1115729321 14:36251178-36251200 ATACTTAAGAGCTGTTTAACCGG + Intergenic
1120041335 14:79756702-79756724 CTTATTGGGAGCACTTTGACTGG - Intronic
1122887912 14:104718749-104718771 ATTATTAGGAGCAGTTTTGCTGG - Intronic
1127749714 15:62022858-62022880 CTGATTAAGAACTGTTTAACTGG - Intronic
1130053486 15:80503121-80503143 TAGATTAGGAGCAGTGTAACTGG + Intronic
1135038313 16:19096939-19096961 TTAATGATGAGCAGGTTAACTGG - Intergenic
1135905047 16:26504243-26504265 TTAATTAGGACCATTTTATCTGG - Intergenic
1137863947 16:51874511-51874533 ATAATTAGGAACAGAGTAACAGG - Intergenic
1138017690 16:53445025-53445047 CTAATTAAGAGAATTTTAAAAGG + Intronic
1146797699 17:35794782-35794804 CTAGTTCTGAGCAGTTTAAATGG + Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1153651353 18:7243132-7243154 CTAACTGGCAGCAATTTAACAGG + Intergenic
1156231851 18:35161005-35161027 CTAATAAGGAGCAGTAGAATAGG - Intergenic
1161471417 19:4458553-4458575 CTAGGTAGGAGCTGTTTAAGAGG + Intergenic
932574484 2:72955226-72955248 CTAATTAGGAGCAGTTTAACAGG - Intronic
937177186 2:119951063-119951085 CTCATTATGAGTAGTTTAAACGG + Intronic
939395029 2:141617931-141617953 CTATTTATTAGCAGTTTAATAGG + Intronic
941862157 2:170293988-170294010 GTAAATAGGAGCAGGTGAACAGG - Intronic
1169661812 20:7986842-7986864 CTAGTCAGGATTAGTTTAACTGG + Intronic
1170149941 20:13219327-13219349 CTAATTAGGATCACTTAAAAGGG - Intergenic
1177457069 21:21354197-21354219 CTACGTAGGAGAAGTATAACAGG - Intronic
951341156 3:21489083-21489105 TTATTTAGCAGCATTTTAACAGG - Intronic
952569677 3:34699810-34699832 ATAATTAGGAAAAATTTAACAGG + Intergenic
955171599 3:56570932-56570954 CCAATAAGGAGCAGTTTTATTGG - Intronic
956998353 3:74854121-74854143 CTAATTAGAAACAGTTTTAAGGG + Intergenic
966615915 3:181912207-181912229 CTGATTTGGACCAGTTTTACTGG + Intergenic
972038632 4:34559887-34559909 AGAATCAGGAGCAGCTTAACTGG + Intergenic
974400584 4:61400583-61400605 CTAATTAGCAGCACAATAACTGG - Intronic
978960874 4:114676686-114676708 CTAATTAAGAGAATTTTTACTGG + Exonic
987236904 5:15951817-15951839 GGAATTAGGAGCAGTTTAGCTGG + Intergenic
994974013 5:106779435-106779457 CTAGTTAGGAGTGGTTTAAATGG - Intergenic
1001037059 5:168304797-168304819 CTAATTAAGACCATTTCAACTGG - Intronic
1004230889 6:13831970-13831992 CTTATCAGGGGCATTTTAACTGG - Intergenic
1004284759 6:14311029-14311051 CTAATCAGGAGCGGTTTTAAGGG - Intergenic
1010143243 6:72635652-72635674 AAAACTAGGAGCAATTTAACTGG - Intronic
1013851524 6:114521718-114521740 CTAATTATAAGCAGTTAAAGGGG - Intergenic
1014444366 6:121510156-121510178 CTATTCAGCAGCAGTTGAACTGG - Intergenic
1015134529 6:129852696-129852718 CCCATTAGCAGCAGGTTAACAGG + Intronic
1016364174 6:143297633-143297655 CTGAGTAGGAGCAGTGTTACAGG - Intronic
1017849631 6:158294061-158294083 CTAATTAGAAGCAGGTCATCGGG + Intronic
1019806989 7:3135000-3135022 GAATTCAGGAGCAGTTTAACTGG - Intergenic
1023673997 7:42611620-42611642 TTTGTTAGGAGCAGTTCAACTGG - Intergenic
1025857192 7:65291633-65291655 CTAAATATGATCAGTTTAATGGG + Intergenic
1026385390 7:69842323-69842345 ATAATTAGGACAAGTTTATCTGG - Intronic
1028674069 7:93438431-93438453 CTAACTGGGAGCATTTTGACTGG - Intronic
1030034728 7:105399172-105399194 CAATTTGGGAGCAGTTTAGCTGG + Intronic
1035944027 8:3939323-3939345 TTAATTAGGACCATTTTTACAGG - Intronic
1039017380 8:33166696-33166718 CTAATTAATAGCAGTATAATTGG + Intergenic
1041621740 8:59977858-59977880 CTAATTATGTGCAGTTTACCAGG - Intergenic
1041824309 8:62075148-62075170 CTAATTAGGAGCACCAAAACTGG - Intergenic
1043246667 8:78011952-78011974 CTAATTAGGAGTGCTCTAACAGG + Intergenic
1045349373 8:101324129-101324151 GAACTTAGGAGCAGCTTAACTGG + Intergenic
1047384608 8:124397171-124397193 CTAACTAGGATCATTTGAACAGG + Intergenic
1047783482 8:128130836-128130858 CTAATTAGGAGCAATGGTACGGG - Intergenic
1051789030 9:20778687-20778709 CCAATTATGACCAGTTCAACAGG - Exonic
1056482803 9:87022852-87022874 GAAATCAGGAGCATTTTAACAGG + Intergenic
1189591983 X:42523242-42523264 ATAATTTATAGCAGTTTAACTGG - Intergenic
1191731325 X:64338814-64338836 TTAATTATGAACATTTTAACAGG + Intronic
1193495765 X:82210515-82210537 ATAATTAACAGCAGTTAAACTGG - Intergenic
1193586993 X:83335690-83335712 ATAATTTGGAGCAAATTAACAGG - Intergenic
1193875948 X:86862879-86862901 CTAATTAAAGGCAGTTTAAGTGG - Intergenic
1196715666 X:118808639-118808661 CTAATTTGGAGGAGTTTTAGGGG - Intergenic
1198768250 X:140100284-140100306 GGAATTAGGCGCAATTTAACAGG + Intergenic