ID: 932575034

View in Genome Browser
Species Human (GRCh38)
Location 2:72958139-72958161
Sequence GTTCCTCTGGGGCATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932575034 Original CRISPR GTTCCTCTGGGGCATATAAT GGG (reversed) Intronic
903327825 1:22581391-22581413 GTTCACCTGGGACAAATAATTGG - Intronic
907620960 1:55979391-55979413 GTTCCTCTGGGTCACATTTTGGG - Intergenic
909227465 1:73044161-73044183 GGTCCTCTGTGAGATATAATTGG - Intergenic
909489785 1:76213110-76213132 TTTCCTCCTGGGCACATAATGGG + Intronic
917467977 1:175300011-175300033 GTTTCCCTGGGGATTATAATTGG - Intergenic
918915899 1:190635754-190635776 GTTCCTATGGGGAAGACAATTGG + Intergenic
919479317 1:198067772-198067794 GGTACTCTGTGGCATATAGTAGG + Intergenic
919997533 1:202766986-202767008 CTGCCTCTGGGGAATATCATGGG + Exonic
922088552 1:222373799-222373821 GTGACTCTGGGGCATGTAACTGG - Intergenic
922332705 1:224591418-224591440 GTACCTCTGGGTCTTACAATTGG + Intronic
1063266052 10:4452228-4452250 GTTACAGTGGGGCATAGAATAGG - Intergenic
1063774591 10:9246708-9246730 TTTCTTCTGTGGCATCTAATCGG - Intergenic
1065630706 10:27677841-27677863 GATCCTTTGGGGGAAATAATTGG + Intronic
1067903949 10:50271522-50271544 GTACCTCTGGGGTATGTAAGAGG + Intergenic
1068611237 10:59062627-59062649 ATTCCTCTTGGGTATATACTAGG - Intergenic
1078557360 11:12340529-12340551 GTTTCTCTGGAGTATATATTAGG - Intronic
1087307610 11:96503984-96504006 GTTCCTCTTGGGTATATATAGGG - Intronic
1088282166 11:108146337-108146359 GTTTCTCTGGGACATCCAATTGG + Exonic
1088519323 11:110677870-110677892 ATTCCTCTTGGGTATATACTAGG - Intronic
1089933363 11:122337453-122337475 CTTCCTCTGTGGCAGATAACGGG - Intergenic
1094412263 12:30179104-30179126 GTTCCTATTTGGCACATAATAGG - Intergenic
1097402789 12:59150099-59150121 TTTCCTCTGGGGATTATAAGAGG - Intergenic
1100154395 12:91780692-91780714 GTTCTTCAAGGGCATATAGTTGG - Intergenic
1106775544 13:33004841-33004863 CTTCCTCTGGGGGATAGAGTTGG + Intergenic
1108437161 13:50411737-50411759 GTTTCACTGGGGCCTATATTGGG + Intronic
1109166753 13:59044880-59044902 GTTCATTTGGGGCAGATATTTGG + Intergenic
1114676136 14:24441630-24441652 GTTCCCCTGGCGAATATAAGGGG + Exonic
1115971363 14:38948509-38948531 TTTTCTCTGGGGTATATAACTGG - Intergenic
1116925455 14:50630689-50630711 TTTCTACTGTGGCATATAATTGG + Intronic
1121294518 14:92807633-92807655 GCTGCTCTAGGGCATATAAAAGG + Intronic
1123672282 15:22671241-22671263 GACCCTCTGGGGCATAAAGTGGG - Intergenic
1124172039 15:27383384-27383406 GTTTCTATGGGGCATATCACAGG - Intronic
1124324330 15:28744533-28744555 GACCCTCTGGGGCATAAAGTGGG - Intergenic
1128720969 15:69948029-69948051 GGTGCTCTGGGGCATATGACAGG - Intergenic
1131126027 15:89857809-89857831 CTCCCTCTTGGGCACATAATAGG + Intronic
1131786470 15:95917733-95917755 GTTCCACTGGGCCACATGATTGG - Intergenic
1134397868 16:13882002-13882024 TATCCTCTGGGGGAAATAATGGG + Intergenic
1138072411 16:54006079-54006101 GCTTCTCTGGGACATATGATGGG + Intronic
1138680882 16:58682943-58682965 GTTCCTGTGGGGAACAAAATTGG + Intronic
1140335566 16:74101903-74101925 GCTCCACAGGGGAATATAATTGG + Intergenic
1143470434 17:7171159-7171181 GTGGCTCTTGGGCATATAGTTGG + Intergenic
1145756450 17:27394914-27394936 GTTCCTATGGGGAAGATGATTGG + Intergenic
1147481044 17:40762879-40762901 GTTCCTTTGGGGGATATGAGTGG + Intergenic
1148706624 17:49639398-49639420 GTTTCTCTAGGCCATATACTTGG - Intronic
1149784531 17:59423937-59423959 GTTTCTCCGGGGCATATCCTGGG - Intergenic
1152688760 17:81707989-81708011 GTTCCTCTGGGGCCCTTAAGTGG + Intergenic
1153695595 18:7637634-7637656 GTTTCTTTGGGGGATATAGTAGG + Intronic
1155863839 18:30939300-30939322 GTTCCTTGGGGTCAAATAATAGG + Intergenic
1165645236 19:37430640-37430662 GTTCCTGTGGGGAGTATGATCGG - Intronic
1166826765 19:45614695-45614717 GGTCCCCTGGGGCAGAAAATGGG + Exonic
924983180 2:242753-242775 TCTCCTATGGAGCATATAATTGG - Intronic
925649690 2:6076629-6076651 GTTTCTCACGGGCATATGATGGG + Intergenic
932575034 2:72958139-72958161 GTTCCTCTGGGGCATATAATGGG - Intronic
935437982 2:103057117-103057139 GTTCCTCTGGGGGAAACAAGTGG + Intergenic
938658382 2:133459428-133459450 GTTCCTCTGGGGCCTATCAGAGG + Intronic
939274863 2:139988063-139988085 GCCACTCTGGGGCATTTAATTGG + Intergenic
944204105 2:197139176-197139198 GTTTCTCTAGGGTATATGATTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
948017399 2:234701757-234701779 CTTCCTCTGGGGCCTACCATTGG + Intergenic
1175015722 20:55787893-55787915 GTTCCTCTCTGCCATATATTTGG + Intergenic
1176722416 21:10403093-10403115 GTGCCTCTGGGGCAGATCAGAGG + Intergenic
1182798788 22:33013238-33013260 GTTCCACTGGGGCCTGTAGTGGG - Intronic
1183760845 22:39815625-39815647 GTTTCTCTAGGGCATATATTTGG - Intronic
1185143803 22:49118539-49118561 GTTCTTCTGGGGCATCTCACGGG - Intergenic
951525374 3:23648052-23648074 CTTCCTCTGGGGCCTATGTTGGG - Intergenic
952225731 3:31373871-31373893 GCCCCTGTGGGGCATATAAGAGG - Intergenic
957041457 3:75338721-75338743 CTTCCTCTGGACCATTTAATCGG + Intergenic
960906746 3:122609332-122609354 ATGTCTCTGGGACATATAATAGG - Intronic
960994517 3:123332210-123332232 GTTTGTCTGGGGCATATTAGGGG - Intronic
963757861 3:149254915-149254937 GCTCCTCTTGGGCATATAATAGG - Intergenic
963920522 3:150900597-150900619 GATCATCTGGCCCATATAATGGG + Intronic
968862246 4:3182131-3182153 GTTCCTCTAGGGCACATACAAGG - Intronic
970076302 4:12225006-12225028 CTTTCTCTGGGGAATATCATGGG + Intergenic
974392683 4:61292948-61292970 GTTCCTTTGGGGCCTCAAATTGG - Intronic
979094372 4:116527681-116527703 CTTCCTCTAGGGTAAATAATTGG - Intergenic
979734068 4:124060774-124060796 GTTCATCTGGGACACATATTTGG - Intergenic
985372324 4:189299136-189299158 TTTCCTCTGAGGAATAAAATTGG + Intergenic
986548216 5:8923404-8923426 GTTCCTGTGGGGAGTACAATTGG - Intergenic
989381553 5:40813924-40813946 GTTCCTGTGGAGGATGTAATTGG + Intergenic
990027198 5:51207701-51207723 TTACCTCTGGGGGATATAAGAGG + Intergenic
993704282 5:91152127-91152149 ATTCCTCAGAGGCATAGAATTGG + Intronic
1000199003 5:158989006-158989028 GTTCCTCTGGGGCAGAGAAGAGG - Intronic
1010784337 6:79982854-79982876 GTGCCTCTGGGGCAAAGAAGGGG - Intergenic
1011854501 6:91672395-91672417 ATTCTTCTGGGGAATATAAACGG + Intergenic
1011941657 6:92850235-92850257 GTTCCTCAGGGGTATATATAAGG - Intergenic
1016705555 6:147102553-147102575 TTCCCTCTGGGGTATAGAATGGG + Intergenic
1017568584 6:155715741-155715763 GTTCCTCTAGGGGATGAAATTGG + Intergenic
1018624279 6:165762756-165762778 TTTTCTCTGGGACATATATTTGG + Intronic
1021359499 7:19693098-19693120 CTTCCTCTGGGGCAAAGATTGGG + Intergenic
1030042365 7:105463480-105463502 GTTACCCTGGGGCAGATAAAAGG - Intronic
1030311255 7:108071484-108071506 GTGCCTGTGGGGCAACTAATAGG - Intronic
1038160170 8:25029423-25029445 GTTCCACGGTGGCATACAATTGG + Intergenic
1052811534 9:33065192-33065214 GTTCCTGTGGGACATACAAGTGG - Intronic
1055377085 9:75660189-75660211 GTTCCTATGGGTCACATATTTGG - Intergenic
1059555631 9:115277362-115277384 GTTCCTATGGGGAAGATGATTGG + Intronic
1060214373 9:121729865-121729887 ATTCCTATAGGGCAAATAATTGG + Intronic
1060304349 9:122397555-122397577 GTTCCTGTGGGGAAGACAATTGG - Intergenic
1186364979 X:8882282-8882304 GTTTCTCTAGGGCATATCCTAGG + Intergenic
1188521065 X:31038437-31038459 GTGCCTCTTGTGCATATAGTTGG - Intergenic
1189646333 X:43136684-43136706 TTTCCTATGGGGAATATAATGGG - Intergenic
1190251998 X:48733899-48733921 GTTCCTTTGGGGCCTATGAGGGG - Intergenic
1195638633 X:107148861-107148883 ATTACTCTGGGTCATATACTAGG - Intronic
1201911431 Y:19137172-19137194 TTTCCTCTGGGCCATCTGATAGG + Intergenic