ID: 932575517

View in Genome Browser
Species Human (GRCh38)
Location 2:72960423-72960445
Sequence CAGTGGGCATGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 2, 2: 14, 3: 103, 4: 558}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932575517_932575530 29 Left 932575517 2:72960423-72960445 CCCACTTCTCTCCATGCCCACTG 0: 1
1: 2
2: 14
3: 103
4: 558
Right 932575530 2:72960475-72960497 GCTTGCTGGATGCCCGCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 91
932575517_932575526 15 Left 932575517 2:72960423-72960445 CCCACTTCTCTCCATGCCCACTG 0: 1
1: 2
2: 14
3: 103
4: 558
Right 932575526 2:72960461-72960483 AAGCCGCCATCACCGCTTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932575517 Original CRISPR CAGTGGGCATGGAGAGAAGT GGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903564970 1:24258385-24258407 CACAGGGCATTGCGAGAAGTAGG + Intergenic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
904874173 1:33641281-33641303 CAGAGGGCATGGCATGAAGTAGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906384534 1:45356289-45356311 CAGAGAGCAAGGAGAGGAGTAGG + Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907299234 1:53476216-53476238 CAGAGGGCAGGCAGAGAAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912121059 1:106472890-106472912 CAGTGGGCAAGGTGGCAAGTGGG + Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913405422 1:118485736-118485758 CAGTCTGCATGGAGATAAGGAGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915924408 1:160004991-160005013 CAGTGAGCCTGGAGAGACCTTGG - Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919289612 1:195612418-195612440 CACTGGGCATGTAGACAATTCGG - Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921273081 1:213490107-213490129 CAGTGGGCTTGGAAAGAGCTGGG + Intergenic
921890975 1:220353299-220353321 TAGTGGGCAGAGACAGAAGTGGG + Intergenic
921984708 1:221299964-221299986 CAGGGGGAATGAAGAGAGGTGGG - Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922851419 1:228736214-228736236 GAGTGGGCTTGGAGAGAGGAGGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924783485 1:247172866-247172888 CAGTGCCCAGAGAGAGAAGTGGG + Intergenic
1062894803 10:1095070-1095092 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062894811 10:1095113-1095135 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062907029 10:1186224-1186246 CCCTGGGCATGGGAAGAAGTGGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064806825 10:19144411-19144433 CAGTTTGCATGTAGAGAAATCGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065846887 10:29751907-29751929 ACGTGGGCATGGAGAATAGTGGG + Intergenic
1067093791 10:43285433-43285455 CTGTGAGCAGGGACAGAAGTTGG - Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067662324 10:48245708-48245730 CAGAGGCCATGTAGACAAGTGGG - Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070485880 10:76930993-76931015 CAGGGGGAATGGGGAGATGTTGG + Intronic
1070514101 10:77187651-77187673 CAGGGGGCAGGCAGAGAAGCAGG + Intronic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072246391 10:93547642-93547664 GAGTGGGCAGGTAGATAAGTGGG + Intergenic
1073821792 10:107272678-107272700 GACTGGGAAAGGAGAGAAGTTGG - Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076234963 10:128856337-128856359 CAGTGGCCATGGACAGAGGAAGG - Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081578797 11:44337356-44337378 CAGTGGGCTAGGAGAGACTTGGG + Intergenic
1082026694 11:47578005-47578027 CAGCTGGCAGAGAGAGAAGTTGG - Exonic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087088544 11:94244571-94244593 CACCTGGCATGGAGAGAGGTGGG + Intergenic
1087364590 11:97202491-97202513 CAGAGGGCATGGGGAGCAGCAGG + Intergenic
1087486662 11:98765277-98765299 CAGTGGGCATTGAGAGAGCCAGG + Intergenic
1087979174 11:104590084-104590106 CAGTGGGCATGATGGGACGTGGG - Intergenic
1089688874 11:120173697-120173719 CAGTTGGCTTGGAGACAAATGGG - Intronic
1090248631 11:125235877-125235899 CAGTGGGCAGACTGAGAAGTAGG - Intronic
1090590657 11:128263456-128263478 GAGAGGGCATGAAGAGAAGTTGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092927144 12:13281624-13281646 CAGTGATCATGGTGAGAAATGGG - Intergenic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095685551 12:45029516-45029538 GAGTGGGCAGGGAAAGAAGTGGG + Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098316283 12:69196848-69196870 CAGAGGGCAGTGAGAGACGTAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100587097 12:95990526-95990548 CAGGAGGCTGGGAGAGAAGTAGG + Exonic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1101784404 12:107870302-107870324 GAGAGGGAATGGAGAGACGTAGG + Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1101954284 12:109199635-109199657 CAGTGGTCAAGGGGAGAGGTAGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1103939845 12:124495693-124495715 CGGGGGCCATGGAGTGAAGTTGG - Intronic
1105587275 13:21756847-21756869 CAGGGGGCAGGGAGAGAGGAAGG - Intergenic
1105894981 13:24709860-24709882 CAATGAGCATGGAGAGAATCAGG - Intronic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106937593 13:34740096-34740118 CAGAGGCCATGGGGAGAATTGGG - Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107207218 13:37807097-37807119 GAGAGGGCAGGGAAAGAAGTTGG - Intronic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110574700 13:77042042-77042064 CAGTGGGCAGGGAGATATATTGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112923073 13:104639652-104639674 CAGTGGCCAGGGACAGTAGTAGG + Intergenic
1113522722 13:110952121-110952143 CAGTTGCCAAGGAGAGAACTGGG - Intergenic
1113595241 13:111527053-111527075 CAGTGGGCCTGGACAGAAACCGG + Intergenic
1113702651 13:112398716-112398738 CAGTTGCCAAGGAGAGAACTGGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1117428196 14:55623031-55623053 AAGTGGGCATAGAAAGAAATTGG - Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118151976 14:63199520-63199542 CAGTAGCCATGGACAGAAGGTGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118480539 14:66160786-66160808 CAGTGGACCTGGGTAGAAGTAGG + Intergenic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119949189 14:78727188-78727210 CAGCAGTCATTGAGAGAAGTGGG + Intronic
1119994649 14:79240009-79240031 TAGGGGGAATGGAGAGATGTTGG + Intronic
1120112770 14:80577557-80577579 CAGAGAGCATGAAGAGGAGTGGG - Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1121780798 14:96620937-96620959 GAATGGGCATGGAGTGAAGCCGG - Intergenic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1123102690 14:105816338-105816360 CAGTGGGCTTGGGAAGGAGTGGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124216636 15:27812938-27812960 TAGTGGGCATGTGGGGAAGTGGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125744974 15:41991817-41991839 CCGTGGGCCTGGACAGAGGTGGG + Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130959374 15:88649591-88649613 CACGGGGCGTGGAGAGATGTGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133853317 16:9526289-9526311 AATTGGGCATGGATACAAGTGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1136087300 16:27894701-27894723 CAGAGGCCATGGAGAGCTGTAGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136409719 16:30069232-30069254 CAGTGGCTGTGGAGAGATGTAGG + Intronic
1137530516 16:49276166-49276188 CAGAGGGCCTGGGGAGATGTGGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138542194 16:57695210-57695232 TGGTGGGCAAGGAAAGAAGTAGG - Intronic
1138548886 16:57736260-57736282 CAGGGGGCAGGGAGAAAAGGGGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1140905190 16:79403487-79403509 CAGTGGGCATGCACAGAGGCAGG - Intergenic
1141664406 16:85458470-85458492 AAGGGGGCATGGAGAGATGGAGG + Intergenic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142599585 17:1047107-1047129 GAGGGGGCTTAGAGAGAAGTGGG + Intronic
1143023616 17:3929008-3929030 CAGTGGGCAAGGGCAGAGGTGGG - Intronic
1143042973 17:4053033-4053055 CAGTGAGAATGAACAGAAGTGGG - Intronic
1143332666 17:6149080-6149102 AAGTGGGCATGGCGAGAGGGAGG - Intergenic
1143418190 17:6765769-6765791 TAGGGGGCAAGGTGAGAAGTAGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144140621 17:12343701-12343723 CATTGGGCCTGTAGAGAAGGAGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146249034 17:31321739-31321761 CAGTGGCCAACTAGAGAAGTTGG - Exonic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146460366 17:33041426-33041448 CAGTGAGCAAGAAGAGATGTGGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146645027 17:34571565-34571587 AGGAGGCCATGGAGAGAAGTTGG + Intergenic
1146679565 17:34797315-34797337 CTGTTGCCATGGAGAGATGTGGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147455609 17:40536388-40536410 CAGGGGGCTTGGAGAGAGGCAGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148211697 17:45812775-45812797 AAGTGGGCCAGGAGAGAGGTGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149303759 17:55328988-55329010 GAGTGGCCAGGGAGAGAATTTGG - Intergenic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1150957012 17:69870292-69870314 CAGTGGGCCTGAAGAGACTTGGG + Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1152336888 17:79703750-79703772 CTGTGGGCATGGAAAGATGCTGG - Intergenic
1152672429 17:81617036-81617058 CAGGGGGCAGGGATACAAGTGGG + Intronic
1153802037 18:8679844-8679866 AAGGGGGCAGGGAGTGAAGTAGG + Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156456394 18:37297039-37297061 CAGCGAGCAGGGAGAGAAGAGGG + Intronic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158433542 18:57415828-57415850 CAGGAGGCAAGGTGAGAAGTTGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159553048 18:69917029-69917051 AAGTGGGAAAGCAGAGAAGTAGG - Intronic
1160932614 19:1577846-1577868 CAGCGGGCATGGGGAGGAGCTGG + Exonic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1163453309 19:17391709-17391731 GAGTGGGCAGGGATAGAAGTGGG - Intergenic
1163993109 19:21017884-21017906 CATTGGGCATGGATACAAGGGGG - Intergenic
1165378263 19:35459279-35459301 CAGTGGGCATGGAGAGGGTCTGG + Intergenic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165951517 19:39476184-39476206 CAGGGGGCAAGGAGATAAGATGG + Intronic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168165467 19:54544207-54544229 CAGGGGGTATGGAGAGCATTAGG - Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168368355 19:55809492-55809514 AAGTGGGCATGTAGATCAGTGGG + Exonic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926681309 2:15665914-15665936 CACTGGGCTAGGAGAAAAGTGGG + Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928035046 2:27815138-27815160 CAATGGGCATTGAGGGCAGTGGG + Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932854630 2:75220360-75220382 AAGAGGGCATGGAGAGATGTTGG - Intergenic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935715445 2:105935415-105935437 CACTGGGCATGTAGTGAGGTGGG - Intergenic
935909345 2:107878350-107878372 CAGTGTGCATGTCTAGAAGTGGG - Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
939120943 2:138115766-138115788 TAGTGGGCAAAGATAGAAGTAGG - Intergenic
939424660 2:142019558-142019580 CAATGGGGAAGGATAGAAGTGGG - Intronic
939609676 2:144295156-144295178 CAGGGCGCATTGAGAGAAGCTGG - Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940842076 2:158595301-158595323 CAATAAGCATGGTGAGAAGTAGG - Intronic
941139196 2:161756597-161756619 CAGTGGGCAAGGAGATTAGGTGG - Intronic
941885324 2:170521785-170521807 CAGTGGACCTGGACAGCAGTTGG - Intronic
943182688 2:184563005-184563027 AATTGGGCAAAGAGAGAAGTTGG + Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943769978 2:191705640-191705662 GGGTGCGCATGCAGAGAAGTGGG + Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945865941 2:215175768-215175790 GAGAGGGCATGAAGAGAGGTTGG - Intergenic
946628195 2:221637580-221637602 GAGTGGACATGGAAAGAGGTGGG + Intergenic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170990941 20:21301532-21301554 CAGTAGGCAATGAGAGAAGCAGG - Intergenic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173046792 20:39520461-39520483 CAGTGGACATACAGAGTAGTGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174312564 20:49669265-49669287 TAGAGGTCATGGATAGAAGTTGG - Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175841061 20:62027824-62027846 CCGTGCGCATGGAGCGATGTGGG - Intronic
1175890502 20:62313827-62313849 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890509 20:62313855-62313877 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890516 20:62313883-62313905 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890523 20:62313911-62313933 GAGTGGGCACGGAGAGACGAGGG + Intronic
1175890547 20:62314013-62314035 GAGTGGGCACGGAGAGACGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178348283 21:31850969-31850991 TAGGGGGCAAGGAGAGAGGTGGG - Intergenic
1179027713 21:37693580-37693602 GAGTGGGCAGGAAGAGAGGTGGG + Intronic
1179918181 21:44491637-44491659 CAGGGGGCATGGAGAACATTAGG - Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1180647193 22:17348913-17348935 CAGAGGGCATGAAGAAAAGGAGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181136021 22:20766826-20766848 CACTGGGCCGGGAGAGAGGTGGG + Intronic
1181337984 22:22155270-22155292 CATTTGGCATGGAGAGGACTTGG + Intergenic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1181571122 22:23768215-23768237 CAGAGGGCAGGGAGCGGAGTTGG + Exonic
1181711907 22:24696398-24696420 CAGTGACCATGGAGAGAGCTCGG + Intergenic
1181755633 22:25022450-25022472 CAGTGAGCATTGGCAGAAGTAGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182882747 22:33747544-33747566 CAATGGGCTTGGTGAGGAGTGGG - Intronic
1183029437 22:35092389-35092411 CAGTGGGCAAGGTGAGAACAGGG - Intergenic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1184108623 22:42382818-42382840 CAGTGAGCAAGGAGAGAGGCAGG - Exonic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
949489146 3:4571208-4571230 CAGAGGGCATGGATACAAGGAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
953055695 3:39385538-39385560 CAAGGGGCCTGGAGAGAGGTGGG + Intronic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954573548 3:51662372-51662394 GAGTGGCCAGGGAGAGAAGAAGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954971155 3:54652723-54652745 CAGTGGGCACAGTGAGATGTTGG + Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956141278 3:66149104-66149126 CTGTGGACATGGGGATAAGTGGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957021715 3:75135577-75135599 CAGTGGGCATGGAAAGAACGTGG - Intergenic
957953275 3:87151056-87151078 AAGTTGGTATGTAGAGAAGTGGG - Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958684015 3:97369372-97369394 CAGTGGACATATAGAAAAGTGGG + Intronic
958826438 3:99036321-99036343 CAGGGAGCATGGAAACAAGTTGG + Intergenic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960302731 3:116023643-116023665 CAGTGAGCATGAAGAGAGGAAGG - Intronic
961122458 3:124384592-124384614 CAGTGTCCCTGGAAAGAAGTGGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961635084 3:128328234-128328256 CAGTGGGCACCCACAGAAGTGGG + Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087408 3:141451017-141451039 CAGTGGGCAAGCAAAGAAGGGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964683543 3:159368711-159368733 TAGTGGGCATGGTGAGAGATAGG + Intronic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966706033 3:182914919-182914941 AAATGGGCAGGGAGAGATGTTGG + Intronic
966714960 3:183005664-183005686 CATGGGGCATGGAAAGTAGTTGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969390834 4:6890281-6890303 CAGTGGGAATGGAGACAGCTTGG + Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972375745 4:38468572-38468594 CAGTTGGCATGGAGAACATTAGG + Intergenic
972632320 4:40853155-40853177 CAGAGGGCATGAAGAGAAGCAGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976025176 4:80679068-80679090 CAGAGGACAGGAAGAGAAGTGGG - Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
979480398 4:121209461-121209483 TAGTTGGCATGGAGAGTTGTGGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981255968 4:142660661-142660683 CAGTTTGCATGGAGAGAGGGAGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984842102 4:184078325-184078347 CAGGGAGCATGGAGAGATATAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985106219 4:186502490-186502512 CATGGGGCATGGGGAGAGGTTGG + Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
988918713 5:35921248-35921270 CAGTTGGCATAGAGAAAAATTGG - Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990861372 5:60331419-60331441 AAGTTGGCATGAAGAGAAGGAGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991650557 5:68848153-68848175 GAATGGGCAAGGAGAGAAGCGGG + Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996117116 5:119631293-119631315 GAGTAGGCATGGAGAGCAGGGGG + Intronic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997564208 5:134874663-134874685 CGGTGCGCGGGGAGAGAAGTCGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998415703 5:141944856-141944878 CACTGGGCCTGGACAGGAGTGGG - Exonic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999041804 5:148421999-148422021 CAATGGGAAAGGAGAGATGTAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000441632 5:161270737-161270759 TGGTGGGCATGGAGAGAGGGGGG + Intergenic
1001085353 5:168696465-168696487 CAGGGGTCAGGGAGAGAGGTGGG + Intronic
1001594429 5:172888769-172888791 CAGAGGGCATGGCCAGAGGTTGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1001957079 5:175855128-175855150 CAGTCGGCAGGGAGAGCAGCTGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004330539 6:14716738-14716760 CCGTGGTCAAGGAGAGACGTTGG - Intergenic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1006372446 6:33653775-33653797 CAGTGGGCAGGGAGTGATTTGGG - Intronic
1006477218 6:34264328-34264350 TAGGGGGAATGGAGAGATGTTGG - Intergenic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007116954 6:39349550-39349572 CAGAGGGCAGGGGGAGCAGTGGG + Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG + Intronic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009593707 6:65708688-65708710 CAGAGGGCAAGGAGAGGAGGGGG - Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011049573 6:83129709-83129731 CAGTTTGCATGCAGATAAGTAGG + Intronic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014179604 6:118370765-118370787 GAGTTGGCCTGGAGAGAGGTGGG - Intergenic
1014203694 6:118631803-118631825 GAGGGGGCAGAGAGAGAAGTGGG + Intronic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1015921735 6:138273187-138273209 CATTGGGCCTTGAGAGAAGCGGG + Intronic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016684650 6:146867424-146867446 CACTGGGCATTGAGTGGAGTAGG - Intergenic
1016839464 6:148511834-148511856 CAGTGGGCAGTAAGAGAAATGGG - Intronic
1016925649 6:149344541-149344563 CAGTGTGCATAGAGAATAGTTGG + Intronic
1017121180 6:151025228-151025250 CAGTGGGCATGGAGCCCTGTGGG - Intronic
1017165877 6:151408062-151408084 CAGTGGACATGAAGAAAAGGTGG + Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019125977 6:169840300-169840322 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019125981 6:169840316-169840338 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019632604 7:2057939-2057961 AAAGGGGCATGGAGAGAAGCAGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021421330 7:20448484-20448506 CATTGGGCAGGGATAGAATTGGG + Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022374139 7:29797688-29797710 CAACAGGCTTGGAGAGAAGTAGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022746538 7:33178488-33178510 CACGGTGCAGGGAGAGAAGTTGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023706491 7:42946745-42946767 CAGAGCTCATGGAGGGAAGTTGG + Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024317193 7:48032111-48032133 GAGTGGGAATGGGGAGATGTTGG + Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026300566 7:69094224-69094246 CAATGGGCTTGGAAATAAGTTGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030972820 7:116081477-116081499 CAGTGGTCATAGAGAAGAGTAGG - Intronic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1033249397 7:139745790-139745812 CAGTGAGCATGCAGAGGAGGAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034721052 7:153293198-153293220 CATTGGGCATTGAGAGAAAAAGG - Intergenic
1035739345 8:1914405-1914427 CAGGGGCCAGGGAGAGAAATCGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1038522172 8:28243132-28243154 TAGTTTGCATGGAGAGGAGTTGG - Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039400528 8:37265422-37265444 CACAGGGCATGGACAGTAGTAGG - Intergenic
1040698294 8:50029500-50029522 CAGAGGGCAGGAAGAGAAGTGGG - Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041336732 8:56793765-56793787 CAGGAGGCAGGGAGACAAGTAGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041722126 8:60985265-60985287 CATTGGGCATGCACAGAAGCTGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044177255 8:89142716-89142738 CAGAGGGCATGGGGAGAGGTAGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045161372 8:99549753-99549775 CAGCGGGCCTGGAGAGAGGCAGG - Intronic
1045294935 8:100864287-100864309 CACTGGGCATGCAAAGAAATAGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046684090 8:117205481-117205503 AAGTGGGCAGGGAGAGTATTAGG + Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047457613 8:125030293-125030315 CAGTTGGCAAGGAAAGCAGTAGG - Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048451461 8:134537465-134537487 CAGTGGACCGGGAGAGATGTGGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054800649 9:69345104-69345126 CAGTGGGCATGCAAAGTAGATGG + Intronic
1055068231 9:72140397-72140419 AAGAGGGCAGAGAGAGAAGTTGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1056443090 9:86639829-86639851 CAGTGCTCTTAGAGAGAAGTAGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059045073 9:110857831-110857853 TGGTGTGCATGGAAAGAAGTGGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059702158 9:116785742-116785764 AAGTCAGCATGGAGAGAGGTGGG - Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061378567 9:130240616-130240638 CAGTGGGCATGGAAAGGGGCTGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1062665353 9:137668101-137668123 CAGTGGGGAGGCAGACAAGTAGG + Intronic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186716234 X:12254936-12254958 GAGTGAGCATGAAGTGAAGTGGG - Intronic
1186730407 X:12403539-12403561 CGGCGGGCAGGGAGAGGAGTGGG - Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187718717 X:22130138-22130160 CAATGGGGAGGGAAAGAAGTGGG - Intronic
1187830464 X:23375606-23375628 CAGTGAGCATGAAGACAACTTGG - Intronic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189568937 X:42274476-42274498 GAGTGGGCAGAGAGAGGAGTGGG - Intergenic
1189707178 X:43770332-43770354 GAGTGGGCATAGGGAGAACTTGG - Intronic
1190209047 X:48429749-48429771 CAGAGGGCAGAGGGAGAAGTAGG + Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192268802 X:69559211-69559233 AAATGGGCATGAAGAGGAGTAGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192938825 X:75891639-75891661 CAGGGGGAATGAAGAGATGTTGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193806389 X:86000857-86000879 CAGAGGGCATGAAGTAAAGTTGG + Intronic
1194897428 X:99461577-99461599 CAGAGGGCATCAAGAGAAGTAGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195573024 X:106417615-106417637 CAAGGGGCAAGGACAGAAGTAGG + Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195925567 X:110021359-110021381 CAGGGGGCATGGAGAGATTATGG + Intronic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198112031 X:133510248-133510270 CATTGGGCAAGGAGAGATGAGGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199259783 X:145758986-145759008 AAGTGGACAGGGAGAGAAGCAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199708898 X:150453994-150454016 CACAGGCCAGGGAGAGAAGTGGG - Intronic
1199870069 X:151890471-151890493 CAGTTGGCATGGTAAGAAGTGGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1201291064 Y:12421176-12421198 CAGTGGGCACGGGGAGACGGAGG - Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic