ID: 932576220

View in Genome Browser
Species Human (GRCh38)
Location 2:72963736-72963758
Sequence CCTTCATTCCAGTGCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932576212_932576220 -5 Left 932576212 2:72963718-72963740 CCTGGTGCCCCTGCTGGCCCTTC 0: 1
1: 0
2: 1
3: 60
4: 446
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576206_932576220 16 Left 932576206 2:72963697-72963719 CCGGAGCCAACTCAGACCCAGCC 0: 1
1: 0
2: 0
3: 27
4: 259
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576211_932576220 -1 Left 932576211 2:72963714-72963736 CCAGCCTGGTGCCCCTGCTGGCC 0: 1
1: 1
2: 10
3: 80
4: 580
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576205_932576220 17 Left 932576205 2:72963696-72963718 CCCGGAGCCAACTCAGACCCAGC 0: 1
1: 0
2: 0
3: 25
4: 273
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576210_932576220 0 Left 932576210 2:72963713-72963735 CCCAGCCTGGTGCCCCTGCTGGC 0: 1
1: 0
2: 5
3: 117
4: 1021
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576204_932576220 23 Left 932576204 2:72963690-72963712 CCTGGGCCCGGAGCCAACTCAGA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
932576208_932576220 10 Left 932576208 2:72963703-72963725 CCAACTCAGACCCAGCCTGGTGC 0: 1
1: 1
2: 2
3: 19
4: 239
Right 932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932576220 Original CRISPR CCTTCATTCCAGTGCCAGGG AGG Intronic
903338639 1:22641095-22641117 CCTGCATTCGAGGGACAGGGTGG - Intergenic
904604490 1:31691344-31691366 CGTTCATTCCCTGGCCAGGGTGG + Intronic
908099621 1:60777551-60777573 GCTTCATTCCATTGCTGGGGAGG + Intergenic
908420502 1:63954239-63954261 CCTACATTCCACTCCCAGGGAGG + Intronic
915033127 1:152901284-152901306 CTTTCATTCCAGTGGGGGGGTGG - Intergenic
916564040 1:165957747-165957769 TCTTCATTCCAGGCCCATGGTGG - Intergenic
916875196 1:168961567-168961589 CCTTCTTTCCAGTCCTTGGGTGG - Intergenic
919513103 1:198490930-198490952 CTTTCATTCCAGGGCCTAGGAGG - Intergenic
920259204 1:204677565-204677587 CCTTCCTTTCACTGCCTGGGTGG - Intronic
921596110 1:217055432-217055454 CCTACAGTCCAGTGGCAGGTTGG + Intronic
924416145 1:243858743-243858765 TCCTCCTCCCAGTGCCAGGGAGG - Intergenic
924709774 1:246522545-246522567 CCCTCATTCCTGTGCCAGCAGGG + Intergenic
1067217536 10:44315617-44315639 CCTACATTCTAGTGCAAGGATGG + Intergenic
1069686259 10:70320987-70321009 CCGTCTTTCCAGCGCCAGGTTGG + Intronic
1069954354 10:72040632-72040654 CCTTCATTACCCTGCCTGGGTGG - Intergenic
1072611399 10:97019629-97019651 CCTCCATGCCTGAGCCAGGGAGG + Intronic
1072814431 10:98490720-98490742 CCTTGATTCCAGAGCCAGAAAGG + Intronic
1074032858 10:109705886-109705908 CCTGCATTTCAGAGCTAGGGTGG - Intergenic
1074509445 10:114099439-114099461 CCTTCCTTCCCGAGGCAGGGAGG - Intergenic
1074997141 10:118767305-118767327 CCTACATTTCAGTGCCAGGAAGG - Intergenic
1075086245 10:119416144-119416166 CCTTGTTTCAAGTGTCAGGGTGG - Intronic
1076844514 10:133062710-133062732 GCCTCAGGCCAGTGCCAGGGTGG + Intergenic
1077463609 11:2723043-2723065 CCTCCATTCCCGTGCCAGGGTGG + Intronic
1083270780 11:61571536-61571558 GCTTCCTTCTAGTGCCTGGGTGG + Intronic
1083990349 11:66242769-66242791 CCCACAGCCCAGTGCCAGGGAGG + Intronic
1084956349 11:72693631-72693653 CCTCTCTTCCAGAGCCAGGGTGG - Intronic
1087172136 11:95060023-95060045 CCTGCATTCCAGGGCCAATGAGG - Intergenic
1089605888 11:119641086-119641108 GCTCCATTCCAGTGCCCGGAAGG + Intronic
1091286097 11:134409394-134409416 CCTGCATTCCAGGACCAGGAGGG + Intronic
1095221739 12:39624288-39624310 CTTTCCTTCCAGTCACAGGGAGG - Intergenic
1097174763 12:57136202-57136224 CCTTTATTCCAGGCTCAGGGTGG + Intronic
1097423199 12:59407930-59407952 CCTTCATTCTAGCCACAGGGAGG - Intergenic
1100207193 12:92363614-92363636 CATTCATTCCAGTGTCGGGGAGG - Intergenic
1104658555 12:130592282-130592304 CCTAAGTCCCAGTGCCAGGGAGG + Intronic
1105805148 13:23948108-23948130 CCTGCAGGCCAGTGGCAGGGTGG - Intergenic
1105986496 13:25572463-25572485 CCTTGACTCCAGTTGCAGGGGGG - Intronic
1117161715 14:52996107-52996129 CCACCATTCCTGTGCCTGGGGGG - Intergenic
1118907387 14:70032650-70032672 CCTACATTCCAGTGAGAGGAAGG - Intergenic
1119360127 14:74042294-74042316 CATTCCTGACAGTGCCAGGGAGG - Intronic
1119848386 14:77847597-77847619 ACTTCATACCAGGGCCAGTGAGG + Intronic
1119892710 14:78194863-78194885 CATTCAAACCAGTGCCAAGGGGG - Intergenic
1122806678 14:104263320-104263342 CCTTGGTTCCAGTGCAGGGGTGG + Intergenic
1128559331 15:68654391-68654413 CATTCCTTGCAGAGCCAGGGAGG + Intronic
1129892656 15:79081760-79081782 CCATCCTCCCAGTGCCAGGGAGG + Intronic
1130651119 15:85762691-85762713 CATTCGTTCCTGTGCCAGGCTGG - Intronic
1131885066 15:96903720-96903742 CCATTCTCCCAGTGCCAGGGTGG - Intergenic
1132177914 15:99730056-99730078 CATTCCTTTCAGTGCCATGGTGG - Intronic
1134452506 16:14372167-14372189 CCTTCAGTCCAGTGGTTGGGAGG + Intergenic
1135483170 16:22840279-22840301 CCTTCATACTTGTGTCAGGGAGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141592290 16:85077088-85077110 CGACCATGCCAGTGCCAGGGAGG - Intronic
1141929141 16:87189596-87189618 CCGCAATTCCAGTGCCTGGGTGG + Intronic
1142238153 16:88932311-88932333 CATTGAGTCCAGCGCCAGGGCGG - Intronic
1203141719 16_KI270728v1_random:1771462-1771484 CCTCCATCCCAGCCCCAGGGGGG + Intergenic
1151850058 17:76684845-76684867 CCTTCTGGTCAGTGCCAGGGAGG + Intronic
1152128961 17:78464807-78464829 CCTGCAATCCTGTGCCAGGGAGG - Intronic
1152256762 17:79244495-79244517 CCTTCAGGGCAGTGCCAGCGAGG + Intronic
1153448271 18:5197308-5197330 CCCTCATTCCTGTGCCAGCTCGG + Intronic
1153656651 18:7288830-7288852 TCTTCATCCCAGTGACAGGGTGG - Intergenic
1155202887 18:23533034-23533056 CCTTCATCTCAGTGGCAGGGAGG + Intronic
1157223021 18:45840558-45840580 CCTTCAGCAGAGTGCCAGGGGGG - Intronic
1159032732 18:63247745-63247767 CCACCATTCCAGTGCCAAGCTGG + Intronic
1160168725 18:76535088-76535110 CTTTCATTTCTGTCCCAGGGCGG + Intergenic
1161144823 19:2671298-2671320 CCTTCCTGCAACTGCCAGGGTGG - Intronic
1163633103 19:18426936-18426958 CCTTCCTTCCTGGGCCGGGGAGG + Intronic
1164518544 19:28958122-28958144 CCTTCCTTTCAGTACCAGGAAGG + Intergenic
1165076954 19:33284887-33284909 CTTACATTCCAGTGTCAGGAAGG - Intergenic
1165822360 19:38684565-38684587 CCTTCATGCCAGCCCCAGGAAGG + Intronic
1168268713 19:55238030-55238052 CCTTCATTCTCCTGCCAGGGTGG + Intronic
925802034 2:7611015-7611037 CCTTCATTCCAGGGGTTGGGAGG - Intergenic
929934238 2:46282713-46282735 CTTTCCTTCCTGGGCCAGGGAGG - Intergenic
932542968 2:72675922-72675944 GCTTGATTCAAGTGCCAGGGAGG - Intronic
932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG + Intronic
934934602 2:98455611-98455633 ACTCCATTCCACTGTCAGGGAGG - Intronic
935922872 2:108034076-108034098 CGTTTATCCAAGTGCCAGGGTGG - Intergenic
937157921 2:119734321-119734343 CTGTCATTCCAGGGCCTGGGTGG - Intergenic
937568113 2:123321163-123321185 CCTAAATTCCAGAGCCATGGTGG - Intergenic
946249932 2:218405762-218405784 CCCACATACCAGTGCCAAGGGGG + Exonic
948198727 2:236114155-236114177 CCCTCATTCCAATCCCCGGGAGG - Intronic
948606245 2:239137484-239137506 CCTCCTCTACAGTGCCAGGGAGG - Intronic
948795888 2:240401934-240401956 TCTTCATTCCAAGTCCAGGGGGG + Intergenic
948833971 2:240615351-240615373 CGTTCATTTCAGGGCCAGTGAGG + Intronic
1169054628 20:2610493-2610515 ACTTCAGTCCAGTGCGTGGGTGG - Exonic
1172613455 20:36267956-36267978 CCTTCCTTCCCCAGCCAGGGTGG - Intronic
1173693909 20:44990730-44990752 CCTCCAGTCTAATGCCAGGGTGG + Intronic
1175946924 20:62563300-62563322 TCCTCACTCCAGGGCCAGGGAGG + Intronic
1178698514 21:34814763-34814785 CCTGCAGTCCAGTGGCAGGCAGG - Intronic
1178807991 21:35855316-35855338 CCTTTATTCCAGTGCCAAAATGG + Intronic
1179416068 21:41199565-41199587 CCTTCTGTCCTGTGCTAGGGAGG + Intronic
1182379339 22:29873519-29873541 CCTGCAGTCCAGTGTCAGGGAGG - Intergenic
1184872551 22:47250124-47250146 CCTGTATTCCACTGCCAGAGAGG - Intergenic
950365434 3:12480264-12480286 CCTTGGTTCCGGAGCCAGGGAGG - Intergenic
952267455 3:31800426-31800448 CCATCATGCCAGGGCCAGGCTGG - Intronic
952342135 3:32455642-32455664 CCTCCATTCCATTGCCCTGGAGG - Intronic
952846225 3:37690146-37690168 CCTACATTGCAGAGCTAGGGTGG + Intronic
954510792 3:51123133-51123155 GCTTCATTCCACTGCCCGGGAGG + Intronic
954930520 3:54277098-54277120 CCTTCAGGCCTGGGCCAGGGAGG + Intronic
962288271 3:134106735-134106757 CCTTCATGCCAGGGGCATGGAGG - Intronic
962451803 3:135525292-135525314 CCAACATTCCAGGGCCAGGCAGG - Intergenic
963865444 3:150355798-150355820 CCTTCATTCCTTTGCCAGCACGG + Intergenic
965514866 3:169610292-169610314 CCATGATTCCAGTGCCACTGAGG - Intronic
967633657 3:191776431-191776453 CCATCATACCAGTTCTAGGGTGG + Intergenic
972583888 4:40419281-40419303 CCTGCATTCCTGTCCCATGGGGG + Intergenic
972730792 4:41792727-41792749 CTTTCATTCTAGTGGCAGAGTGG - Intergenic
973346275 4:49059885-49059907 GGTTCATTCCAGCACCAGGGTGG - Intronic
985284989 4:188328306-188328328 TCTTCATTCCACTTCCAGGCTGG - Intergenic
989123220 5:38025688-38025710 CCTTCACGCCAGGGCCTGGGAGG - Intergenic
989660567 5:43792743-43792765 GCTTTATTCCATTGCCAGTGAGG - Intergenic
989810717 5:45669952-45669974 CCTTCATTCCAATTACAGAGGGG - Intronic
990943542 5:61227902-61227924 CCGTCCATCCAGTGCCAGTGTGG + Intergenic
990946155 5:61252027-61252049 CCTTCAATGCAATGCAAGGGAGG - Intergenic
992337618 5:75789012-75789034 CCTTCATTCCAGTTCCCAAGAGG - Intergenic
995510126 5:112900750-112900772 CCTCCATTCCAGTGCCTGATGGG + Intronic
995907550 5:117143565-117143587 CCTTCATTCCATTGCCTGCCTGG + Intergenic
996749606 5:126875388-126875410 CCTTCTTCACAGTACCAGGGAGG + Intronic
997434615 5:133865407-133865429 CTCTCATTCCAGAGCCCGGGTGG - Intergenic
998258541 5:140609471-140609493 CCTCCTTTCCAATGCCAGGGAGG - Intergenic
999773842 5:154795329-154795351 CCTGCATCCCAGCTCCAGGGAGG - Intronic
1000057131 5:157617037-157617059 CCATCATTCCAGTGACATGAAGG - Intergenic
1001020083 5:168175399-168175421 CACTCATTCCAGAGCCAGTGGGG - Intronic
1001966401 5:175912885-175912907 ACATCATTCCAGGACCAGGGTGG + Intergenic
1008072473 6:47111817-47111839 CCTGCATTCCTGAGCCAGGATGG + Intergenic
1010832424 6:80547143-80547165 CCTCCATTCCAGTGACAATGGGG + Intergenic
1012638314 6:101576519-101576541 CCTGCATACAAATGCCAGGGTGG - Intronic
1012895270 6:104940533-104940555 CATTCATTCCAGGGCCGGGCGGG - Intergenic
1017059598 6:150469858-150469880 CCATCATCCCATTGCCAGAGTGG + Intergenic
1017829609 6:158114185-158114207 CCTTCTTTCCTGTGCCCTGGTGG - Intronic
1020319556 7:6929792-6929814 CCTTCTTCCCACAGCCAGGGTGG + Intergenic
1022508656 7:30921965-30921987 CCTTCATGCCTGGGCCTGGGAGG + Intronic
1023600397 7:41876543-41876565 CCTTCATTACAGGGTGAGGGGGG - Intergenic
1024036686 7:45512726-45512748 CCTTCAATCCATCTCCAGGGAGG - Intergenic
1025899251 7:65730698-65730720 CCTGTATTACAGTGCCAGGTAGG - Intergenic
1034392158 7:150795058-150795080 CCTTCACTCCCATGCCATGGAGG + Intronic
1037581217 8:20247054-20247076 CTTGCATTCTAGTGCCACGGTGG + Exonic
1038005310 8:23424738-23424760 CCCTCAATTCAGGGCCAGGGAGG - Intronic
1041159551 8:55025692-55025714 GCTACTTTCTAGTGCCAGGGTGG + Intergenic
1044182190 8:89209723-89209745 CCATTATTCCAGCACCAGGGTGG + Intergenic
1044667264 8:94642612-94642634 CCTTGGTCCCACTGCCAGGGAGG + Intronic
1049315590 8:141965313-141965335 CCTTCATTGCAATTCCCGGGTGG + Intergenic
1050981424 9:12020624-12020646 CCTTCATACTTGTGCCATGGAGG + Intergenic
1055982077 9:82014052-82014074 CTTTGATTCCAGTTCCTGGGAGG + Intergenic
1059747228 9:117214738-117214760 CCTTCCTTCCTGCTCCAGGGTGG - Exonic
1060237764 9:121878140-121878162 ACTTCTCTCCATTGCCAGGGAGG - Intronic
1185550738 X:981035-981057 CCATCATCCCAGCCCCAGGGGGG - Intergenic
1185550787 X:981190-981212 CCATCATCCCAGCCCCAGGGGGG - Intergenic
1187230591 X:17418532-17418554 CCTTCAATCCAATGCCAAGGAGG + Intronic
1189097946 X:38159944-38159966 TCTTGATTCCAGTGCAAGAGAGG - Intronic
1189848707 X:45158384-45158406 CCTTCTTTCCAAGGGCAGGGTGG - Intronic
1192181051 X:68916084-68916106 CCCTCTTTCCAATGCCTGGGGGG + Intergenic
1193493968 X:82187720-82187742 CCTGTCTTCCAGTCCCAGGGTGG + Intergenic
1195098131 X:101525431-101525453 GCTTCATTCCATTGCTAGTGAGG - Intronic
1200069352 X:153520058-153520080 TCTCCATTCCAGATCCAGGGAGG + Intronic
1200878046 Y:8180355-8180377 CCTGCATTCCAGGTCCTGGGAGG - Intergenic
1201337074 Y:12892813-12892835 CCTTCTTACCAGTGCCAGGGTGG + Intergenic