ID: 932576792

View in Genome Browser
Species Human (GRCh38)
Location 2:72966784-72966806
Sequence CTGTGGGCCTGGCAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932576792_932576796 -5 Left 932576792 2:72966784-72966806 CCTTCTTGCTGCCAGGCCCACAG 0: 1
1: 0
2: 3
3: 56
4: 410
Right 932576796 2:72966802-72966824 CACAGTGCTTCCTCTTCTCAAGG 0: 1
1: 0
2: 3
3: 34
4: 275
932576792_932576797 4 Left 932576792 2:72966784-72966806 CCTTCTTGCTGCCAGGCCCACAG 0: 1
1: 0
2: 3
3: 56
4: 410
Right 932576797 2:72966811-72966833 TCCTCTTCTCAAGGTCACCTTGG 0: 1
1: 0
2: 1
3: 30
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932576792 Original CRISPR CTGTGGGCCTGGCAGCAAGA AGG (reversed) Intronic
900131844 1:1090580-1090602 CTGTGGGCCTGGGAGCAAGGAGG + Intronic
900203488 1:1421417-1421439 CTGGGGCCCTGGCAGCCAGCAGG - Exonic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900702690 1:4058116-4058138 ATGTGGGCTTGGCACCAAGTGGG - Intergenic
900721513 1:4178922-4178944 CTCTCAGCCTGTCAGCAAGATGG - Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900967635 1:5970046-5970068 CCCTGGGCCTGGCAGGAAGGCGG - Intronic
901334016 1:8433170-8433192 CTGTGTTCCTGGGTGCAAGATGG + Intronic
901383590 1:8891598-8891620 CTGTGAGGCTCGAAGCAAGATGG + Intergenic
901434639 1:9239695-9239717 CTGTGCGCCAGGCAGGAGGAAGG - Intronic
901514144 1:9733925-9733947 AGGTGGGCCAGGCTGCAAGAGGG - Intronic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
902692758 1:18120323-18120345 TTGGGGGCCTGGCAGGAAGCTGG + Intronic
902848678 1:19134613-19134635 GTGAGGTCCTGGCAGCCAGAAGG - Intronic
902851603 1:19162286-19162308 ATTGGGGCCTGGCAGCAACAAGG + Intronic
902943594 1:19817547-19817569 CTGTGGTCCTGGCAGCCCCAGGG - Intergenic
903574391 1:24329334-24329356 CTAGTGGCCTGGCAGCAGGAGGG + Intronic
905234523 1:36536832-36536854 CGGTGGGCCTGGAAGCAGCAAGG - Intergenic
905404083 1:37721621-37721643 CCGTGGGCTGGGCAGCAGGAAGG + Intronic
906009338 1:42509167-42509189 CTTTGGGGCTGGAAGCAAGATGG - Intronic
906100606 1:43257953-43257975 CTGTGCACCTGGAAGCAGGAGGG + Intronic
906194962 1:43924291-43924313 CTGTGGACAAAGCAGCAAGAAGG - Intronic
906242700 1:44251788-44251810 CTGTGTACCTGGCAGCAACATGG + Intronic
906784895 1:48606652-48606674 CTGTGAGGCTCCCAGCAAGAAGG + Intronic
909827337 1:80142719-80142741 CTGTGGGCCTGCCATCAGGGAGG - Intergenic
910036613 1:82796593-82796615 CTGTCAGCCTAGCAGTAAGAAGG + Intergenic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
912581409 1:110724262-110724284 ATGTGGGCCAGGCTTCAAGACGG - Intergenic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
913200856 1:116494358-116494380 CTGTGCGGCTGGCTGCAAGGGGG + Intergenic
914214517 1:145613126-145613148 CTGAGGGACAGCCAGCAAGATGG - Intronic
914466458 1:147933516-147933538 CTGAGGGACAGCCAGCAAGATGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
920397826 1:205659588-205659610 CTTAGGGCCTGGCAGGAAGCTGG + Exonic
922067437 1:222157898-222157920 CTGAGGGCCTGGCAGGCAAAGGG - Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922466045 1:225846067-225846089 CTGTGGCTCTGGCAGGAAGGAGG - Exonic
922602814 1:226870366-226870388 CTGCGGGCCTGGCAGCAGCGTGG - Intronic
922790523 1:228308482-228308504 CTGGGGGCCTGGCAGGGAGGTGG + Intronic
922859434 1:228803510-228803532 GTGTGGTCCTGGCAGCATGGGGG + Intergenic
923250782 1:232177974-232177996 GTGTGAGGCTGGAAGCAAGATGG - Intergenic
923997495 1:239512044-239512066 CTGTTGGCATGGCAACCAGATGG + Intronic
1063050279 10:2439621-2439643 ATGTGGTCCCTGCAGCAAGATGG + Intergenic
1063254911 10:4316661-4316683 CAGTGGGCCTGGCAGAACCAAGG + Intergenic
1063609553 10:7551630-7551652 GAGTGGGCCTGGCAGCAGGGAGG - Intergenic
1063646601 10:7889966-7889988 CTGTTGCTCTGGCAGCAGGATGG - Intronic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1065127200 10:22584980-22585002 CTGGGGGCCTGGTAGAAAGGCGG + Intronic
1065303088 10:24342053-24342075 CTGTGGCCTTTGCAGCCAGAGGG + Intronic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1066298621 10:34077452-34077474 CTGTGGTCTTGGCACTAAGAAGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067054822 10:43044412-43044434 CAGGGGCCCTGGCAGCAAGCAGG - Intergenic
1067836532 10:49644959-49644981 CTGTGATCCAGGCAGCAGGATGG + Intronic
1068813093 10:61278769-61278791 CTCAGGGCCTGCCAGCAATAGGG + Intergenic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069618314 10:69820440-69820462 CTGGGGGCCTGGCACCCAGAAGG - Intronic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1069917354 10:71795816-71795838 CTGTGGGCCTGCCAGCCATGAGG - Exonic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070986624 10:80695190-80695212 CTGAGGGCCTGGCCACAGGAAGG - Intergenic
1071491375 10:86138843-86138865 CTGTGGGCTGAGCAGCAGGATGG + Exonic
1071986889 10:91060991-91061013 CAGTGAGCCTGGCAGGAAGGTGG - Intergenic
1072696440 10:97607230-97607252 CTGTGTGTCTGGCAGCAGGTGGG + Intronic
1072717740 10:97762824-97762846 GTGGGGGCCAGGCAGAAAGAGGG - Intergenic
1073006707 10:100330342-100330364 CCCTGGGGCTTGCAGCAAGAGGG - Exonic
1073070805 10:100791956-100791978 ATGTGGTCCAGGCAGCAAAAGGG + Intronic
1073176385 10:101560016-101560038 GGGTGGGCCTGGGACCAAGAGGG - Intergenic
1073330923 10:102669446-102669468 CTGACGTCCTGGCAGCAAGGAGG + Intergenic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075847292 10:125555173-125555195 GCGTGGGGCTGGCAGCAAGCAGG - Intergenic
1076533121 10:131158848-131158870 CTCTGGGCTTGGCCGCGAGAGGG + Intronic
1076774716 10:132688317-132688339 CTGGGGGCAGGGCTGCAAGAAGG - Intronic
1077253266 11:1570074-1570096 CTGTGGACCTGGGAGAAAGTGGG + Intronic
1077258000 11:1597751-1597773 CAGTTGGACTGGCAGCAACAGGG + Exonic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1078147269 11:8730461-8730483 CAGGGGGCATGGCAGCAGGAAGG - Exonic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078437889 11:11340507-11340529 CTGAGGACCTGGGAGCATGAAGG + Intronic
1078539028 11:12198729-12198751 GGGTGGCCCTGGCAGCAAGCTGG - Intronic
1080588771 11:33703588-33703610 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080589313 11:33707741-33707763 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080982063 11:37419862-37419884 CTGTGGAAATGGCAGCAACAAGG + Intergenic
1081461121 11:43273884-43273906 CCCTGGGCCTGGCATCAGGAGGG + Intergenic
1082799275 11:57402409-57402431 CTGAGGGGCTGGCAGGAAAAAGG + Intronic
1082943979 11:58739090-58739112 CTGTGTGCCTGGCAGAATGGTGG - Intergenic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083365550 11:62139698-62139720 GTGTGGCCCTGACAGCAGGAGGG - Intronic
1083429900 11:62608923-62608945 TGGTGGGCTTGGCAGGAAGAGGG - Intronic
1083818145 11:65149323-65149345 CTGTGGTCCAGGCAGCCAGCTGG + Intergenic
1084296503 11:68215936-68215958 CTGGGGGCCTGGGAGCAGGCTGG - Intergenic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1085306512 11:75488992-75489014 CACTGGGCCTGGCACCAAGGAGG + Intronic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1085531486 11:77194683-77194705 CTGTGTGCCTGGCACACAGATGG - Intronic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1086306553 11:85486333-85486355 CTGTGGGCCTACCACCAGGAAGG - Intronic
1086863722 11:91954711-91954733 CCATGGGCCTTGCAGCCAGAGGG - Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1089844238 11:121445967-121445989 CTGAGGGCCTGTCAGCACCAGGG - Intergenic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1091597295 12:1886648-1886670 CTGAGGGGCTGGCAGCAGAAAGG + Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1096462960 12:51832772-51832794 CAGTGGGGATGTCAGCAAGAAGG - Intergenic
1096789858 12:54037926-54037948 CAGAGGGCCTGGCAGTTAGAGGG + Intronic
1096842736 12:54389443-54389465 CTGTGGGCTTGGCATAAGGAGGG + Intronic
1097167103 12:57091706-57091728 CTGGGGGGCTGGCAGCAGGTGGG + Exonic
1097815166 12:64065695-64065717 CTGTGGGCCAGGCACCATAATGG - Intronic
1097998139 12:65912775-65912797 CTGTGGGCCAGAGAGGAAGAGGG - Intronic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1099573040 12:84348984-84349006 CTCTTGGCCTGGCAGTTAGATGG + Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100892043 12:99136350-99136372 CTGTGTGCCTGGCAGCACTAAGG + Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1101884245 12:108648113-108648135 GTGTGGGGCTGGCAACAAGGGGG - Intronic
1101928559 12:108993470-108993492 CTTTGGGCCTGGCACAAAGCAGG - Intronic
1102241632 12:111328177-111328199 CACTGGGCCTGGAAGCAAAAGGG + Intronic
1103957207 12:124583865-124583887 CTGTAGGCCGGGGAGCAAGAGGG + Intergenic
1104152416 12:126096320-126096342 CTGTGAGCCTGCCAGCTGGATGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105588444 13:21767203-21767225 CTGTTGGCCAGGCAGTAGGAAGG - Intergenic
1105704800 13:22962253-22962275 CCCTGGCCCTGGCTGCAAGAGGG + Intergenic
1105755099 13:23456726-23456748 CTGTGAAGCTGGGAGCAAGATGG + Intergenic
1106146235 13:27052401-27052423 CTGAGTCCCTGCCAGCAAGAAGG + Intergenic
1106165856 13:27245625-27245647 CTGTGAGGCTGGAAGCAAAATGG - Intergenic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1106641535 13:31588956-31588978 CTTTGGGCCTGGTAGCTTGAGGG - Intergenic
1107286804 13:38802457-38802479 CTGTGGGCCTGCCACCAGGAAGG + Intronic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1113047178 13:106168500-106168522 CTGGAGGCCTGGGAGCCAGACGG - Intergenic
1113887797 13:113670130-113670152 CTGAGGGCCTTGCACCAGGAGGG + Intronic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1121457384 14:94047059-94047081 CTGTGGGCTGGCCGGCAAGATGG + Exonic
1121615223 14:95309488-95309510 CTGTGGCCCTGGGACAAAGAGGG - Intronic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1123409349 15:20045575-20045597 CTGTGGGCTTTGCAGTGAGAGGG - Intergenic
1123518680 15:21052283-21052305 CTGTGGGCTTTGCAGTGAGAGGG - Intergenic
1123683560 15:22781567-22781589 CCGTGAGACTGGAAGCAAGATGG - Intronic
1124335763 15:28855937-28855959 CCGTGAGACTGGAAGCAAGATGG - Intergenic
1126155396 15:45560992-45561014 CTGTGGTTCTGGCATAAAGAAGG + Intergenic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128527558 15:68422771-68422793 GACTGGGTCTGGCAGCAAGAGGG - Intronic
1128569877 15:68726277-68726299 CAGTGGACCAGGAAGCAAGAGGG + Exonic
1128691730 15:69729569-69729591 CTCTGGGCCAGACATCAAGATGG + Intergenic
1129663142 15:77564600-77564622 CTGTGGGATTTGCAGCAAGAGGG - Intergenic
1130387836 15:83427634-83427656 CACTGTGCCTGGCTGCAAGATGG + Intergenic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131423866 15:92329603-92329625 CTGGGGGCCTGACAGCAAACAGG - Intergenic
1131816499 15:96226601-96226623 CTGCAAGCCTGGCAGGAAGAAGG - Intergenic
1131846535 15:96495160-96495182 CTGTGGGGCTGGAATCATGAGGG + Intergenic
1132621783 16:871218-871240 CTCTGGGCCAGGCAGCCTGAAGG - Exonic
1132783925 16:1643919-1643941 CGGTGGGCCTGTCAGCAGGATGG + Intronic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133121114 16:3608609-3608631 CTAGGGGCCTGGCTGCCAGACGG + Exonic
1133285111 16:4687046-4687068 CCGTGGGCCTGGCATCACCATGG + Intronic
1133594659 16:7279934-7279956 CAGTGGGCCTGGTAACAATAGGG + Intronic
1133817736 16:9210981-9211003 CTGTGTGCCTGGCATGAAGTAGG + Intergenic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134194546 16:12149212-12149234 CTGTGTTCTTGGCAGCAGGAAGG + Intronic
1137561527 16:49505530-49505552 CTGGGGGTCTGTCAGCAAGGGGG - Intronic
1139393871 16:66624236-66624258 CTGTGGGCCAGGCACCATGCTGG - Intronic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1140935963 16:79670432-79670454 GAGTGGGCCTGTCAGAAAGAAGG + Intergenic
1142934539 17:3317434-3317456 CTGTGTGGCAGGCAGCAAGCTGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1146214267 17:30966249-30966271 CTGTGAGGCTAGCAGCAAGATGG + Intergenic
1146729501 17:35181872-35181894 CTGGGGGCCTGGCAGCCATAGGG + Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147191373 17:38739984-38740006 CTGTGGGCTTGGCAGCAGGGGGG - Intronic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1148838682 17:50480182-50480204 CTGTGTCCCTGGCACCCAGAAGG - Intronic
1149657362 17:58317371-58317393 CTGTGGGCCGGGCAAGTAGACGG - Intronic
1149780884 17:59395595-59395617 CTGGGGGCCTGGCAGTTAGGTGG + Intronic
1150658727 17:67057373-67057395 TTGTGGGCCATACAGCAAGAGGG - Intergenic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1151346813 17:73507392-73507414 CAGTGGTCCTGGCAGCCAGGAGG + Intronic
1152391934 17:80008561-80008583 CTGTTGGCCTGGCACCACCAGGG + Intronic
1152535111 17:80946090-80946112 CTGCGGGCAGGGCAGCAAGCTGG - Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1155425791 18:25705924-25705946 ATGTGTACCTGGCAGCAAGTTGG + Intergenic
1155491305 18:26404542-26404564 CTGTGGGCCATGCAGGAGGAGGG + Intergenic
1157582988 18:48784050-48784072 CTGTGTTCCAGGCAGCGAGATGG + Intronic
1157608270 18:48939815-48939837 GTGGGAGCCTGGCAGCAAGGTGG - Intronic
1159855164 18:73578431-73578453 CTGAGGGCCAGAAAGCAAGAGGG - Intergenic
1160535626 18:79589938-79589960 CTGAGGCCCTGGGAGGAAGAGGG - Intergenic
1160988016 19:1848463-1848485 CCGGGGGCCTCGGAGCAAGATGG - Exonic
1161003769 19:1924423-1924445 CTGTGGCCCTGGCAGGAGGGGGG - Exonic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162769402 19:12940063-12940085 CTGTGGCCCTGGCACCAAGAAGG + Exonic
1163819467 19:19487727-19487749 CTGTGGGCCAGGCCCCAGGAGGG + Intronic
1164311263 19:24048393-24048415 CTGTAGACCTGGCAGCCAGAAGG - Intronic
1164414250 19:28033113-28033135 CTCTGAGGCTGGAAGCAAGATGG - Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165840594 19:38787240-38787262 CTGGGGGCCTGGGACAAAGAGGG + Intergenic
1166037107 19:40176641-40176663 CTGTGAGCTTAGAAGCAAGATGG - Intergenic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
927103614 2:19806516-19806538 GTCAGGGCCTGGCAGCAAGGGGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929265267 2:39912047-39912069 CTGTGGGCTTGGGAGTAAGATGG + Intergenic
929567809 2:43000641-43000663 CCCTGGGCCTGGCAGCACAAAGG - Intergenic
929834466 2:45382285-45382307 TTGTGGGCCTGGCTATAAGAAGG + Intergenic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
930555829 2:52894638-52894660 CTGTGGGCCTGCCACCAGGGAGG + Intergenic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
933625249 2:84590562-84590584 CTTTGGTCCTGTCAGCAAGACGG + Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935718342 2:105958493-105958515 CTGTGGGTTGGGCAGCAATATGG - Intergenic
936144035 2:109967265-109967287 CTGTGGGCCTGAAAGCAGCAGGG - Intergenic
936180717 2:110265226-110265248 CTGTGGGCCTGAAAGCAGCAGGG - Intergenic
936200652 2:110404204-110404226 CTGTGGGCCTGAAAGCAGCAGGG + Intronic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937144933 2:119636682-119636704 ATGTGGGCCTGGGAACAGGAAGG + Intronic
937956291 2:127423356-127423378 CTGTGCGCCTGGCTACAAGCTGG + Exonic
938051602 2:128177736-128177758 CTGTGAGCCTGTCATCAATAGGG - Intronic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938945572 2:136209052-136209074 CTCCTGACCTGGCAGCAAGAGGG + Intergenic
939719214 2:145626447-145626469 CTTTGGGCCTGGCAGAAGGATGG + Intergenic
939739285 2:145886030-145886052 ATGTGGCCCAAGCAGCAAGATGG + Intergenic
940389951 2:153120805-153120827 CTGTGAGCCTGGCAAAAAGAAGG - Intergenic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942292090 2:174483482-174483504 TTGTGTTCCTGGCAGCAAGAGGG - Intronic
943770771 2:191713996-191714018 CTATGTCCCTGGCAGCCAGAGGG + Intergenic
944677183 2:202043444-202043466 CCTAGGGCCTGGCAGCAAGAGGG + Intergenic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
946717329 2:222566389-222566411 AAATGGGCCAGGCAGCAAGAAGG - Intergenic
946779380 2:223177235-223177257 CTGTATTCCTGGGAGCAAGAAGG + Intronic
948127993 2:235578904-235578926 CTGTGTGACTGACAGCTAGAGGG - Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948829631 2:240591995-240592017 CCGGCGGCCTGGCAGAAAGATGG + Exonic
1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG + Intergenic
1170796100 20:19548097-19548119 ATGTGGGCCTGGTATCAAAAGGG + Intronic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1172098749 20:32473409-32473431 CTGGGAGGCTGGCAGCACGAGGG + Intronic
1172106927 20:32522561-32522583 CAGTAGGCCAGGCAGCAAGAAGG + Intronic
1172107035 20:32523031-32523053 CAGCTGGCCAGGCAGCAAGAAGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172639484 20:36432209-36432231 CGGTGGCAATGGCAGCAAGAAGG + Exonic
1172903126 20:38349382-38349404 CTGTGTGCCAGGTAGCATGAGGG - Intronic
1173966286 20:47115236-47115258 CTGCTTCCCTGGCAGCAAGAGGG - Intronic
1174112282 20:48205034-48205056 CTGGGGGTCTGGCAGCAGGAGGG + Intergenic
1174672273 20:52319307-52319329 CTGAGGGCCTCTCAGGAAGAAGG + Intergenic
1175065838 20:56287640-56287662 CGTTATGCCTGGCAGCAAGATGG + Intergenic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1176908626 21:14535389-14535411 ATGTGGGGCTGGCAGCATGAAGG + Intronic
1177919434 21:27132537-27132559 CTGAGGTCCTGGAAGCAACAAGG + Intergenic
1178486821 21:33024804-33024826 CTGTGGGCCAGACAGCGAGATGG - Intergenic
1180096391 21:45557193-45557215 CTGAAGCCCTGGCAGCAGGAAGG + Intergenic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180260785 21:46667465-46667487 CTGGGGGCTCGGCAGCCAGAGGG + Intergenic
1180762570 22:18221135-18221157 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1180773097 22:18403473-18403495 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180804453 22:18653022-18653044 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180806298 22:18716388-18716410 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1181217244 22:21342169-21342191 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1181781554 22:25197537-25197559 CTGTGGGCCAGCCAGCGAGAGGG + Intergenic
1182709040 22:32309072-32309094 CTGCTGGCCTGGCAGCTGGAGGG + Intergenic
1182846063 22:33431983-33432005 CTGTGGGTATAGCACCAAGAAGG + Intronic
1183347946 22:37318306-37318328 CTGTGTGCCAGGCTTCAAGATGG - Intergenic
1183362937 22:37392077-37392099 CTGTTGCACTGACAGCAAGAAGG - Intronic
1183441805 22:37827252-37827274 CCGTGGACTTGGCAGGAAGATGG + Intergenic
1183676916 22:39304327-39304349 CTGCAGGCCTGGCAGCCAGCAGG - Intergenic
1183970730 22:41475539-41475561 CTCTGGGCCTCTCAGCATGAAGG + Intronic
1184786870 22:46676274-46676296 CTCAGGGCCTGGCACCAGGAGGG - Intronic
1185371664 22:50463705-50463727 CTGTGAGCCTGTGAGCAAGGGGG - Intronic
1203234930 22_KI270731v1_random:144455-144477 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
950122596 3:10491579-10491601 CAGTAGGGCTGGCAGCAACAAGG + Intronic
950296855 3:11839585-11839607 CTGTGAGGCTGGCAGCAAGATGG - Intronic
950762192 3:15241253-15241275 CTGTGGGCGTGACAAAAAGATGG - Intronic
952443627 3:33358527-33358549 TTGTTTGCCTGGCAGAAAGATGG - Intronic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
954036148 3:47852334-47852356 CTTGGGGCAGGGCAGCAAGAAGG + Exonic
954466226 3:50656620-50656642 CTTTGGGCCTGGAAGCGAGAGGG + Intergenic
954618249 3:51981261-51981283 CTTTGGGCCTGGGAGCTGGAGGG + Intronic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
961014509 3:123457283-123457305 CTGGGTGCCTGGGAGCTAGAAGG + Intergenic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
961560197 3:127723484-127723506 CTTGGGGCCTGACAGCAGGAGGG - Intronic
962306068 3:134287433-134287455 CTGTGGGATGTGCAGCAAGAAGG - Intergenic
962343733 3:134605241-134605263 CTGTGGCCCTGGAAGCCAGGAGG - Intronic
962733855 3:138306704-138306726 CTCTGTTCCTTGCAGCAAGATGG - Intronic
962867774 3:139461844-139461866 CCATGGGCCTGGCAGGCAGAGGG - Intronic
963859276 3:150291013-150291035 CTGTGGTCTTTGCAGCAACATGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
964764189 3:160162601-160162623 CTGTTGCCCTGGTAACAAGAAGG + Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966077344 3:175953479-175953501 CTGTCTGCAAGGCAGCAAGAGGG + Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966986751 3:185187462-185187484 CTGTGTTCCAGGCAGGAAGATGG + Intergenic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968889605 4:3361493-3361515 AAGTGGGCCTGAAAGCAAGATGG + Intronic
968964233 4:3761454-3761476 CTGAGGCCCTGGAAGCCAGAAGG + Intergenic
971968777 4:33594968-33594990 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
974395506 4:61329936-61329958 TTGAGGGCCTGGAATCAAGAAGG + Intronic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
979035618 4:115712899-115712921 CTGTCTGCCAGGCAGGAAGATGG + Intergenic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982722045 4:158869249-158869271 CTGTGGGGATGACAACAAGAAGG + Exonic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
984769696 4:183426725-183426747 CTGGAGCTCTGGCAGCAAGATGG - Intergenic
984857234 4:184205683-184205705 TTGTGGGGCAGGCAGCGAGAGGG + Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985880587 5:2636149-2636171 CTGTGGCCCAGGCAGGAAAATGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986333332 5:6734288-6734310 TTGGGGGCCAGGCAGCAAGGCGG - Intronic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
988841343 5:35086851-35086873 GTGTGGGGATGGCAGAAAGATGG - Intronic
988884386 5:35539581-35539603 CTGTGGCCCACTCAGCAAGAAGG - Intergenic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
989949374 5:50279672-50279694 CTGTGGGGCTGGCAGAACAAAGG - Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
991985552 5:72282699-72282721 TTGTGGGCCTTGCAGGAAAAAGG + Intronic
992000635 5:72432646-72432668 CAGTGGGCTTGGCAGCCAGGTGG - Intergenic
992312129 5:75511604-75511626 TAGTGGGCCAGGCAGGAAGATGG - Intronic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
993565924 5:89475339-89475361 CATTGTTCCTGGCAGCAAGAAGG - Intergenic
995001980 5:107144123-107144145 CTGTGGGCCTGCCAACAACCTGG - Intergenic
995275422 5:110272621-110272643 CTATGGGCAAGGCAGCAAGAAGG - Intergenic
995581667 5:113608628-113608650 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
995968362 5:117937754-117937776 CAGTGGACCTGGCAGTAGGAGGG + Intergenic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
1001255540 5:170180559-170180581 CTGTGTGCCTGGCAACATGCTGG - Intergenic
1001332617 5:170773005-170773027 TAGAGGGCCAGGCAGCAAGAAGG + Intronic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001704549 5:173732495-173732517 CTATGTGCCTGGCAACAGGAAGG - Intergenic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1006034417 6:31200352-31200374 CTGTCTGCCAGGCAGGAAGAGGG + Intronic
1006358528 6:33574518-33574540 CTGCTGGCCTGGCAGCCCGAGGG + Intronic
1007367980 6:41407963-41407985 CTCTGAGCCTGGCAGGAAGGAGG - Intergenic
1007647740 6:43395908-43395930 CTCTCGGCCTGCCAGGAAGATGG + Intergenic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1008555652 6:52670976-52670998 CTGTAGGCCAGGCAGCCAGGAGG - Intergenic
1010559768 6:77334281-77334303 CTGTGCTCCAGGCAGCAAGAAGG + Intergenic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011175823 6:84559304-84559326 TGGTGGGCCTCTCAGCAAGAAGG - Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013115580 6:107101323-107101345 GGGTGGGGATGGCAGCAAGAGGG + Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1017399828 6:154047307-154047329 CTGAGGGCCTGGGTGCAAGATGG + Intronic
1019195923 6:170283201-170283223 CTGCGGGCCGGGCATCAGGAGGG - Intronic
1019590119 7:1826661-1826683 CTGAGGGCCTGGCGGCAACTGGG + Intronic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1020842585 7:13238380-13238402 GTGTGGTCCTGGCTGCAAGCAGG + Intergenic
1021368646 7:19813373-19813395 CTGTATGCCTGCCAGCTAGAAGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1022439910 7:30424771-30424793 CTGTGGCCCTGGCATCCAAATGG - Exonic
1023679230 7:42667277-42667299 GTGTGGGGCAGGCAGCAAGGAGG + Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1028738613 7:94246976-94246998 GTGCGGGCCAGGCAGCATGAGGG + Intergenic
1029158088 7:98531641-98531663 CTCTGAGCCTGGGAGCAAGATGG + Intergenic
1032260471 7:130332002-130332024 CTGCAGTGCTGGCAGCAAGAGGG - Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1033147984 7:138887548-138887570 CTGTGGTCCGGGCAGCATGCTGG + Intronic
1033877615 7:145842211-145842233 CTGTGGGCCTGGTAACCACAGGG - Intergenic
1033928164 7:146489568-146489590 CTGTGGCCCTGGTAGCAGGTGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034675588 7:152890672-152890694 CTGTGTGCCAGGCACCAAGCTGG + Intergenic
1034819739 7:154205819-154205841 CTTTGTGGCTGGCAGTAAGAGGG - Intronic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036648314 8:10625744-10625766 CAGAGGGCCTGGCAGGAAGCGGG + Intronic
1037396732 8:18451331-18451353 CTGTGGGCCTGACCGCAATTGGG - Intergenic
1038195112 8:25360188-25360210 ATGTGGGCATGGCAGAAAGGTGG - Intronic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039711726 8:40061959-40061981 CTGTGGGCCTGCCACCAGGGAGG - Intergenic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1040355795 8:46617350-46617372 TTGCGCACCTGGCAGCAAGAGGG - Intergenic
1040834823 8:51720802-51720824 GTGGGGAGCTGGCAGCAAGAGGG - Intronic
1042154484 8:65827933-65827955 CTGTGTGCCTGGCACATAGAAGG - Intronic
1042177115 8:66047829-66047851 CAGTGGGCCTGGCAACAACAGGG - Intronic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043861143 8:85318574-85318596 CTGTATGCCTTGCAGCATGAGGG + Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045272633 8:100674939-100674961 GGGTGGTCCTGGCAGCAAGCAGG - Intergenic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1047188715 8:122658777-122658799 CAGTTGTCCTAGCAGCAAGATGG + Intergenic
1047493798 8:125395425-125395447 CTGAGGCCCTGGCAGCAGGTAGG + Intergenic
1047795143 8:128247577-128247599 GTGTGGGCCAGCCAGCCAGATGG + Intergenic
1048473083 8:134720634-134720656 GGGCGGGCCTGGCCGCAAGAGGG + Intergenic
1049000759 8:139824398-139824420 CTGTGGCCCTGGCAGCTCCAAGG - Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049409944 8:142468511-142468533 CTGTGGTCCTGGAAGCATCAGGG - Intronic
1049860739 8:144896811-144896833 CTGTTGGCATGGCCTCAAGAGGG - Intronic
1049965555 9:776119-776141 CTGTGGGTCTGGTTTCAAGATGG - Intergenic
1049988150 9:970972-970994 CGGTGGTTGTGGCAGCAAGAAGG - Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1050431873 9:5570250-5570272 CTTTCAGTCTGGCAGCAAGAAGG - Exonic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051698233 9:19791233-19791255 CTGTGTTCCAGGCAGGAAGAAGG + Intergenic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1052830135 9:33208403-33208425 CTGTGAGGCTGGAAGCAAAAGGG + Intergenic
1055468146 9:76585620-76585642 CTGTGAGGCTTGAAGCAAGATGG + Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1056782051 9:89557774-89557796 CTGTGGGAGCTGCAGCAAGAAGG - Intergenic
1057080702 9:92172501-92172523 CTATGGGGATGGCAGCAAGCAGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1059386775 9:113970902-113970924 CTGTGGGCCTGGCCCCTAGCAGG + Intronic
1060054724 9:120403680-120403702 GTGTGGGCCTGTCTGCAGGATGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060473972 9:123971333-123971355 CTGTGCAGCTGGCAGCAAGAGGG - Intergenic
1060759455 9:126235363-126235385 CTGTAGGCCAGGCTGCAGGACGG - Intergenic
1060812196 9:126616050-126616072 CAGTGAGCCTGGCAGAAAGGGGG - Intronic
1061057592 9:128232689-128232711 CTGGGGCCCAGGCAGCACGATGG - Intronic
1061295928 9:129676708-129676730 CTGCGGGCTTGGAAGCCAGAGGG + Intronic
1061424646 9:130491391-130491413 CTCAGAGCCTAGCAGCAAGATGG - Intronic
1061809738 9:133155305-133155327 GTGTGGGCCTGGCAGCAGGGGGG + Exonic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061814860 9:133188582-133188604 CTGGGGGCCTGGCGGCTGGAAGG + Intergenic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1062133257 9:134911727-134911749 CTGAGGGCCTGATAGCAACAAGG - Intronic
1062528360 9:136987813-136987835 GTGAGGGGCTGGCAGCAGGACGG - Intergenic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1188159511 X:26783161-26783183 CTTGGGGGCTGGAAGCAAGATGG - Intergenic
1188274002 X:28178209-28178231 CTGTGGGCCTGCCACCAGGAAGG + Intergenic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1191605498 X:63057864-63057886 CTGTGGGCCTGCCACCAGGAAGG + Intergenic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1193998429 X:88395520-88395542 CTGTGTGCCAGGCAGAAAGAAGG + Intergenic
1195706739 X:107742918-107742940 CTGTGGGGCTGGCAGCCTGTGGG - Intronic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199900475 X:152167587-152167609 CTGCCAGCCTGGCACCAAGATGG - Exonic
1200105086 X:153707531-153707553 CTGGGAGCCTGGCACCAAGAGGG + Intronic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic