ID: 932577015

View in Genome Browser
Species Human (GRCh38)
Location 2:72968316-72968338
Sequence CAGTTTGTGTAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932577015_932577027 15 Left 932577015 2:72968316-72968338 CCTTCCACCCTCTACACAAACTG 0: 1
1: 0
2: 3
3: 26
4: 246
Right 932577027 2:72968354-72968376 CACCCCCTCATCTCTTGCCTGGG 0: 1
1: 0
2: 4
3: 33
4: 292
932577015_932577032 23 Left 932577015 2:72968316-72968338 CCTTCCACCCTCTACACAAACTG 0: 1
1: 0
2: 3
3: 26
4: 246
Right 932577032 2:72968362-72968384 CATCTCTTGCCTGGGCCAGCCGG 0: 1
1: 0
2: 2
3: 16
4: 256
932577015_932577026 14 Left 932577015 2:72968316-72968338 CCTTCCACCCTCTACACAAACTG 0: 1
1: 0
2: 3
3: 26
4: 246
Right 932577026 2:72968353-72968375 CCACCCCCTCATCTCTTGCCTGG 0: 1
1: 0
2: 3
3: 43
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932577015 Original CRISPR CAGTTTGTGTAGAGGGTGGA AGG (reversed) Intronic
900841177 1:5049783-5049805 CAGACTGTGTAGAGGCGGGAAGG - Intergenic
900887120 1:5423049-5423071 CAGTTTGTGGAGAGGGTAAGAGG - Intergenic
901817631 1:11803836-11803858 CAGTTCGTGCACAGGATGGAAGG + Intronic
903059955 1:20662570-20662592 TACTGTGTGTCGAGGGTGGAAGG - Intergenic
905219326 1:36433404-36433426 CAGTTTGTGTTGGGGATGGCAGG + Intronic
905587969 1:39136445-39136467 CTGTTTGTTTATAGGGTGGAAGG + Intronic
906114860 1:43349604-43349626 CAGTTTGGCTGAAGGGTGGACGG - Intronic
906201951 1:43966175-43966197 CAGTTTGTGAACAGGGTAGCAGG - Intronic
906449187 1:45930090-45930112 AAGTTTGTTTTGAGGGGGGATGG + Intronic
906609570 1:47192242-47192264 CAGTGTGTGTAGCGGGGGTAGGG + Intergenic
907318172 1:53585866-53585888 AAGTTTCTGTAGGGGGTGGAGGG - Intronic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908744411 1:67361833-67361855 CAGTTTTTTTTGTGGGTGGAGGG - Intronic
910183130 1:84506552-84506574 CAGTTTGTGGGAAGGGTTGAGGG + Exonic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
911091100 1:94017653-94017675 CAGTTTGTGTTGTGGTTGTATGG + Intronic
912807665 1:112770744-112770766 CATTTTGGGTGGAGGGTGGGAGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913400251 1:118423654-118423676 CAGCTGGTGTGGAGGGTGGCTGG + Intergenic
914435847 1:147658693-147658715 CAGCTTGTGTAGAAGCTTGAGGG + Intronic
914850661 1:151311520-151311542 CATTTTGGGTAGAAGGTGGTGGG + Intronic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
920920390 1:210293159-210293181 AAGTTTGGCTGGAGGGTGGAGGG + Intergenic
921692889 1:218172748-218172770 GAATTAGTGTATAGGGTGGATGG + Intergenic
922048722 1:221970317-221970339 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1064636074 10:17368603-17368625 CAGTTTGTGTAGAGTGGCCAAGG + Intronic
1065861436 10:29875737-29875759 CAGTTTCAGTAGAGGGGTGAGGG - Intergenic
1065916578 10:30358455-30358477 CAGTGTGTGTAGGGTGTGGAGGG + Intronic
1066366563 10:34782653-34782675 AAGTTGGTGTAGAGTGGGGATGG - Intronic
1066585548 10:36930425-36930447 CAGTTTGTGTAGAGAGACAATGG - Intergenic
1072178856 10:92959325-92959347 CAGTTTTTGTGAAGGGTGTAAGG - Intronic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1073466796 10:103698958-103698980 CAGTGAGGGTAGTGGGTGGACGG + Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076888837 10:133274383-133274405 CAGGCAGGGTAGAGGGTGGAGGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078613972 11:12847572-12847594 AAGTGTGTGTAGAGAGTGGCAGG + Intronic
1080725151 11:34891306-34891328 TAGTTGTTGTTGAGGGTGGAGGG - Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1083244469 11:61415750-61415772 CACTCACTGTAGAGGGTGGAGGG + Exonic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1085902587 11:80719455-80719477 CAGTTTGTGTAGAGAGACAATGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090579741 11:128146791-128146813 CAGTTTGCGAAGAGTGTGAAAGG - Intergenic
1091184027 11:133631376-133631398 CAGACTGTATAGAGGTTGGAAGG - Intergenic
1091462675 12:656974-656996 TAATTCTTGTAGAGGGTGGAAGG - Intronic
1093357866 12:18191086-18191108 GAGTCTGTGTAGTGGGAGGATGG - Intronic
1093628789 12:21383798-21383820 CAGTTAGTTTACAGGCTGGATGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1101589671 12:106114455-106114477 CAGATTGTGTATATGATGGAAGG + Intronic
1102430977 12:112882572-112882594 GCGTGTGTGTTGAGGGTGGAGGG - Intronic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1107079299 13:36357191-36357213 CAGTTTTTTTCAAGGGTGGATGG + Intronic
1109907636 13:68865640-68865662 TACTTTGTGTAGAGAGGGGAAGG - Intergenic
1112318349 13:98384917-98384939 TAGTTTGTGTGGGGGGTGGAGGG - Intronic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1114696691 14:24632757-24632779 AAGTTTGTGGAGAGAGGGGAAGG - Intronic
1115957083 14:38793581-38793603 CAGATTGTGTAGAGGCTTGAAGG + Intergenic
1116895427 14:50311405-50311427 CAGTTTGTGTGAAGGCTGTAAGG - Intronic
1118388474 14:65276657-65276679 CAGTTAATGTAGGGGGGGGAGGG - Intergenic
1118770011 14:68936534-68936556 CAGTCTGTCTAGGGGGTGGCGGG + Intronic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1121812934 14:96907530-96907552 CAGTTTGTTAGGAGGGTGGCTGG + Intronic
1122679168 14:103443905-103443927 CAGTTTCTGTAGAGTGATGAGGG + Intronic
1122782217 14:104148577-104148599 CAGCCTGTGCAGAGGTTGGAAGG + Intronic
1123477652 15:20601851-20601873 TAGTTTTTGTATAGGGTGTAAGG + Intergenic
1123640363 15:22398531-22398553 TAGTTTTTGTATAGGGTGTAAGG - Intergenic
1126572896 15:50170498-50170520 CAGTTCTTGTGGAGGGTGGGGGG - Intronic
1128462781 15:67883974-67883996 CAGTTTCTGTAGAGGTTGAGTGG + Intergenic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1131118882 15:89810890-89810912 CAGCTTGTGTGTAGGGAGGAAGG - Intronic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132941847 16:2512423-2512445 GAGTGTGTGGAGAGGGTGGCAGG + Intronic
1133827980 16:9295892-9295914 CAGTTTGTTTTGGGGGTGGAGGG - Intergenic
1135842186 16:25886994-25887016 AAGTTTTTGGAGTGGGTGGAAGG + Intronic
1137998100 16:53242166-53242188 CAGTTTTTGTATAGAGTGGTTGG - Intronic
1139558975 16:67729799-67729821 CAGTTTGTGGAGATGGTGAATGG - Exonic
1139897526 16:70299432-70299454 CAGGTTGATTAGAGGCTGGATGG + Intronic
1139943401 16:70622132-70622154 CAGACTGTATAGAGGGGGGAAGG + Intronic
1141068798 16:80934781-80934803 GAGTTGGTGTAGTGGGTGGAGGG - Intergenic
1147394491 17:40131135-40131157 TAGTTTGTTTGGAGGGAGGAGGG + Intronic
1147846272 17:43406233-43406255 GTGTTTGTGTAGAGGTTGGGTGG + Intergenic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148534584 17:48429344-48429366 CAGTGTGTGTTGAGTGTTGACGG + Intronic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1148843394 17:50513828-50513850 GAGTTTGTGTAGAAGGGAGAAGG + Intronic
1150994400 17:70299460-70299482 CAGTTTCTGTAGAGACGGGAGGG + Intergenic
1151359040 17:73577477-73577499 CAGCTGGTGTGGAGAGTGGAGGG + Intronic
1151694721 17:75708451-75708473 CAGTTCCTGTTGTGGGTGGATGG + Intergenic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1153064730 18:1033393-1033415 CAGTTTCTTTATAGGGTTGATGG + Intergenic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1155274027 18:24168923-24168945 CACTCTGTGAAGAGGTTGGAAGG + Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1156923721 18:42553694-42553716 CAGATTGTATAGAGGTGGGAAGG + Intergenic
1158038806 18:53068410-53068432 CAGTTTGTGGGGTGGGGGGAGGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1159553941 18:69925635-69925657 CAATTTGTATAGAGAGTGTAGGG - Intronic
1160324951 18:77937383-77937405 GAGCTTGTGAAGATGGTGGAAGG + Intergenic
1162794049 19:13077632-13077654 CAGTTTGGGTGAGGGGTGGAGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1164209507 19:23086468-23086490 TAGTTTTTGTATAGGGTGTAAGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165898983 19:39159844-39159866 CAGCGTCTGTGGAGGGTGGAGGG - Intronic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
925868037 2:8245991-8246013 GAGTTTGTGTAGAGAGTGGCAGG + Intergenic
927385742 2:22532056-22532078 AAGTTTATGTAGAGGGTATAGGG - Intergenic
929293892 2:40224609-40224631 CAGTTTGTCTAGTGGGTGATGGG - Intronic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
931766918 2:65465095-65465117 CGGTCTGTGTAGGGGGTGGTGGG - Intergenic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932992491 2:76805143-76805165 CTCTTTGTTTAGAGGTTGGATGG + Intronic
933796403 2:85923398-85923420 CAGTTTTTGTGTAGGGTGGATGG - Intergenic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934723951 2:96602930-96602952 TAGTTGGTGGTGAGGGTGGATGG - Intronic
935406171 2:102711922-102711944 CAGTATGTGCAGAGGTTGTATGG + Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
941513740 2:166445852-166445874 TAGTTTTTGTATATGGTGGAAGG - Intronic
944868596 2:203886699-203886721 CGGTTTGTGTGGAGTGGGGAAGG - Intergenic
946532512 2:220587430-220587452 GTGTTTTTGTAGAGGTTGGAGGG - Intergenic
948101871 2:235381613-235381635 CTGTTTGTATAGGGGGTGGTTGG + Intergenic
1170141077 20:13125409-13125431 CAGTTTGAGTAGAGGCTTGTGGG - Intronic
1171256083 20:23690022-23690044 CAGTGTGTGTAGAGGATGGTAGG + Intergenic
1172184375 20:33022104-33022126 CAGTTTGTCTACAAAGTGGAAGG - Intronic
1172281572 20:33711467-33711489 GAGTTTGTGGGGAGGGTGCAGGG + Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174624757 20:51904919-51904941 GAGTTTGTGGAAAGGCTGGATGG - Intergenic
1176340544 21:5690777-5690799 CAATTTATGTATAGGGTGTAAGG - Intergenic
1176472798 21:7122930-7122952 CAATTTATGTATAGGGTGTAAGG - Intergenic
1176504283 21:7633679-7633701 CAATTTATGTATAGGGTGTAAGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1177739522 21:25136723-25136745 CAGTTAGTGTGCAGGGTGGGAGG + Intergenic
1178578730 21:33818043-33818065 GACTTTGTGAAGAGGCTGGAAGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183261379 22:36797972-36797994 CATCTTGTGTGGAGGGGGGATGG - Intergenic
1183507883 22:38219646-38219668 CTGTTTGCGTGGAGGGTGGGGGG - Exonic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1203239807 22_KI270733v1_random:5235-5257 CAATTTATGTATAGGGTGTAAGG - Intergenic
949330634 3:2917767-2917789 AAGATTGTGTAGAGGTTGGAAGG + Intronic
950109385 3:10408779-10408801 CAGGTGGTGGAGGGGGTGGAGGG - Intronic
951000786 3:17557022-17557044 TATTTTGTGTTGAGGGAGGAAGG - Intronic
951871337 3:27366011-27366033 CAGCTTGTGGACAGGGTGTATGG - Intronic
951933165 3:27992849-27992871 CAGTTTGTGTATGGGGAGGAGGG - Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
952410568 3:33046458-33046480 GAGCTTCTGTAGAGAGTGGATGG - Intronic
952895737 3:38077609-38077631 CAGATTGTATAGAGGTGGGAAGG + Intronic
953414587 3:42708488-42708510 AAGTCTGTGTAGGGTGTGGACGG + Exonic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
954425852 3:50442775-50442797 CAGCTGGGGTAGAGGGAGGAGGG + Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956525564 3:70155788-70155810 CAGTTTCTGCTTAGGGTGGAGGG + Intergenic
957795537 3:85000992-85001014 CATTTTGTGTAACAGGTGGAAGG - Intronic
958183187 3:90085441-90085463 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
959003432 3:100991521-100991543 GAGTTTGGGGTGAGGGTGGAAGG - Intronic
960274419 3:115711695-115711717 CAGTTTGTTTGGGGGTTGGAGGG - Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961629232 3:128284118-128284140 CAGGTTGTGTGGGGGGTGGAGGG - Intronic
961710067 3:128821316-128821338 TAGTTTGTGTATATGGTGCAAGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962362214 3:134752045-134752067 CAGCATGTGTTGAGGGTGGATGG + Intronic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
963743048 3:149098231-149098253 CAGCTTGTGAGGAGGGTGGAAGG - Intergenic
964974127 3:162599677-162599699 CAGCTTGTGGGGAGTGTGGAGGG + Intergenic
967642594 3:191883832-191883854 TAGTTTGTGTAGAGAGAAGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
971916350 4:32874737-32874759 CAGTTTTTGTATAAGGTGTAAGG + Intergenic
972213869 4:36872779-36872801 CAGGTTTTGTAAAGGGTAGAAGG - Intergenic
974335566 4:60540010-60540032 GAGTTTGTGTGTGGGGTGGAGGG - Intergenic
974559027 4:63493485-63493507 CAGCTTGTGTCTAGGGTGAAAGG + Intergenic
975358347 4:73435009-73435031 CATTTTTTTTAGAGGGTGGGAGG + Intronic
975944203 4:79684940-79684962 CAATGTGTGTTGGGGGTGGAGGG - Intergenic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
979894854 4:126146468-126146490 CAGACTGTGTAGAGGTGGGAAGG + Intergenic
981301656 4:143193601-143193623 AAGTTTGTGTAGAGAATGGAGGG + Intronic
982326885 4:154137335-154137357 CAGGTGGTGGAGAGGGTTGAAGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986125776 5:4881320-4881342 CTGTGTGTGTAGTGGGTGAATGG - Intergenic
988553714 5:32218935-32218957 CAGTTTCTGTTGAGGTAGGAGGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990492156 5:56313005-56313027 CATTTTGTGTAAAAGATGGAAGG + Intergenic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
991329911 5:65482841-65482863 CAGCTTGTGTGTAGGGGGGAGGG - Intergenic
992428186 5:76680308-76680330 CACTTTTTGTATAGAGTGGAAGG - Intronic
993389996 5:87307895-87307917 CATTTGCTGTAGAGGATGGACGG + Intronic
994557231 5:101319283-101319305 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
998220636 5:140275780-140275802 CAGTTTGTGTAGATGGCAGGAGG - Intronic
999618560 5:153451041-153451063 CAGACTGTATAGAGGTTGGAAGG + Intergenic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000645335 5:163754636-163754658 CAGTTTGTGGAGGGAGTGTAGGG - Intergenic
1000709052 5:164548101-164548123 TAGTTTTTGTAGAAGGTGTAAGG + Intergenic
1002038593 5:176493259-176493281 CAGTTTTTGTTGAGTGTGGTGGG - Intronic
1003861754 6:10328427-10328449 AAGTTTGTGGAGTGGGTGGTAGG - Intergenic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005785112 6:29237005-29237027 CAGATTTTCTTGAGGGTGGAAGG - Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1010163427 6:72886620-72886642 CAGTTTGTCTATAGTGTGTATGG - Intronic
1010342052 6:74765381-74765403 GAGTTAGGGTAAAGGGTGGAGGG + Intergenic
1011594909 6:89007100-89007122 CAGTTTTTTTAGAGTCTGGAGGG - Intergenic
1013072099 6:106738724-106738746 CAGTTTAATTAGGGGGTGGATGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016979057 6:149837608-149837630 CAGGTTCTGGAGAGGTTGGAGGG + Intronic
1017779025 6:157701989-157702011 CAGACTGTGTAGAGGTGGGAAGG + Intronic
1020724187 7:11788501-11788523 CAGTTTGTGTAGCAGCTGAAAGG - Intronic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1022602719 7:31776984-31777006 CAGTTTGTGGGGTGGGGGGAGGG + Intronic
1023967611 7:44971028-44971050 GAGTTTGTGGAGACGGAGGAGGG - Exonic
1024036435 7:45510884-45510906 CAGTTTGTCTATATGTTGGAAGG + Intergenic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1028019132 7:85749408-85749430 CAGTTTGGGTAGAAGTGGGATGG - Intergenic
1029330441 7:99849234-99849256 TAGTTTGTGTTGAGTGTGGATGG - Intronic
1029345757 7:99977333-99977355 TAGATTATGTAGAGGATGGATGG + Intergenic
1032589046 7:133175438-133175460 CTCTTTGGGTAGAGGGTGGTGGG - Intergenic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1034594977 7:152181298-152181320 CAGTTTGTGTAGATGGTCTTGGG + Exonic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1035778902 8:2211585-2211607 CAGGTTGTGTAGAAGGTGCCTGG - Intergenic
1036690992 8:10944707-10944729 CAGGGTGTGTGCAGGGTGGAGGG - Intronic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1039560752 8:38510633-38510655 CAGTTTGTGCAGAGCAGGGAGGG + Intergenic
1039790618 8:40872774-40872796 CAATTGGGGTAGGGGGTGGAGGG + Intronic
1039866669 8:41511256-41511278 TAGTTGGTGGAGAAGGTGGAGGG - Intergenic
1039898581 8:41734191-41734213 GAGTGTGTCTAGAGGTTGGAAGG + Intronic
1040614414 8:49020078-49020100 CAATTTGTGTAGAGGCAGCAGGG - Intergenic
1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG + Intergenic
1043587206 8:81783294-81783316 CAGATTGATAAGAGGGTGGAAGG + Intergenic
1043814723 8:84788185-84788207 CAGTTTTTGTATAAGGTGTAAGG + Intronic
1043819574 8:84845811-84845833 CAGTTTTTGTATATGGTGAAAGG + Intronic
1044742731 8:95344158-95344180 CTGTTTCTTTAGAGGTTGGAAGG - Intergenic
1048223563 8:132564669-132564691 CACATGGAGTAGAGGGTGGAGGG + Intergenic
1050308156 9:4327148-4327170 CAGTTGGTGTAGAGGTGAGAAGG + Intronic
1051799589 9:20917597-20917619 CAGTTAGAGAAGATGGTGGAAGG - Intronic
1052042173 9:23751368-23751390 CAGTTTGTGTGTATGGGGGAGGG - Intronic
1052560678 9:30079288-30079310 CAGTCTGTGTTGAGGGCTGAGGG - Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058983724 9:110193146-110193168 AAGTTTGTGAAGAATGTGGAGGG + Intronic
1059695936 9:116730542-116730564 GAGATTGTGTGGAGGGAGGAAGG + Intronic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060569786 9:124627974-124627996 CGGTGTGTGTAGAGAGTGAAGGG + Intronic
1203422523 Un_GL000195v1:7216-7238 CAATTTATGTATAGGGTGTAAGG + Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1186958329 X:14707568-14707590 TGGTTTTTTTAGAGGGTGGAGGG - Intronic
1188712351 X:33416030-33416052 CACTCTGTGTAGAGGTGGGAAGG - Intergenic
1190448116 X:50551206-50551228 CAGTTGATGTTGAGGGTGGGAGG - Intergenic
1190931568 X:54953028-54953050 CTGTTTGTGTAGAAGCTGAAGGG + Intronic
1193047054 X:77064616-77064638 CAGATTGAGTAGATGGGGGAGGG - Intergenic
1193886242 X:86986179-86986201 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1193939486 X:87662960-87662982 CTGATTCCGTAGAGGGTGGATGG - Intronic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1195996543 X:110737411-110737433 CACTTTGAGTAGAGGGTTGGTGG - Intronic
1196980715 X:121210177-121210199 CAGCTTCTGGAGAGGCTGGAGGG - Intergenic
1197822798 X:130558571-130558593 CAGTTTCAGTAGAAGGTGTATGG - Intergenic
1199340384 X:146670545-146670567 TACTTTGTGTAGAGGGAGAAGGG + Intergenic
1199606925 X:149585470-149585492 AAGTGTGTGTTGGGGGTGGAGGG + Intronic
1199632198 X:149783898-149783920 AAGTGTGTGTTGGGGGTGGAGGG - Intronic
1201473227 Y:14355712-14355734 CAGACTGTGTAGAGGTTGGAAGG + Intergenic