ID: 932578225

View in Genome Browser
Species Human (GRCh38)
Location 2:72974422-72974444
Sequence CTGGATGAGGGGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1045
Summary {0: 1, 1: 0, 2: 11, 3: 94, 4: 939}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932578225_932578237 11 Left 932578225 2:72974422-72974444 CCAGCCTCCTTCCCCTCATCCAG 0: 1
1: 0
2: 11
3: 94
4: 939
Right 932578237 2:72974456-72974478 CAATTCTGAAGCTGCCTGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932578225 Original CRISPR CTGGATGAGGGGAAGGAGGC TGG (reversed) Intronic
900088220 1:908665-908687 GGGGATGAGGGGAAGGTGGGAGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900266576 1:1760181-1760203 CTGGATGAGGGAAAGCAAACAGG + Intronic
900466689 1:2829101-2829123 CTGCATGATGGGCAGGAAGCTGG - Intergenic
900565553 1:3330196-3330218 CTAGAGGCGGGGAATGAGGCTGG + Intronic
901480283 1:9520445-9520467 CTGGCTGAGGGGATAGAGGTGGG - Intergenic
901551204 1:9997379-9997401 CGGGATCAGGCGAAGGCGGCCGG + Intronic
901646104 1:10717642-10717664 ATGGATGGGGGGCAGGGGGCAGG + Intronic
901759079 1:11459092-11459114 TGGGATGAGGGGAGGGGGGCAGG - Intergenic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
901919823 1:12528069-12528091 CTGGATGACAGGAGGGAGCCAGG + Intergenic
902105958 1:14036250-14036272 TTGGGTGGGAGGAAGGAGGCTGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
902821790 1:18947891-18947913 CTGGCTCAGGGTGAGGAGGCAGG - Intronic
902939936 1:19793719-19793741 CTGGAGGAGGGGCAGGAGGGTGG + Intronic
903184073 1:21619648-21619670 CTGGAGGAGGGGACAGATGCTGG - Intronic
903421126 1:23218201-23218223 CTGGATGAATGGAAGGGGGCGGG + Intergenic
903463134 1:23533096-23533118 CTGGCTGAGAGGAAGCAGGCAGG - Intergenic
903615469 1:24651508-24651530 CTGGAGCAGGGGAAGGACTCCGG - Exonic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
903815795 1:26063515-26063537 CTTTATCAGGGGATGGAGGCAGG - Intronic
904313893 1:29647331-29647353 CTGGGTGAGGGACCGGAGGCAGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904985099 1:34539216-34539238 CTGGGTGGGGGAAGGGAGGCTGG - Intergenic
905227152 1:36486782-36486804 ATGGAGGAGGGGCGGGAGGCAGG - Intergenic
905256827 1:36690135-36690157 GTGGATGATGGGAATGAGGGTGG - Intergenic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905481926 1:38267798-38267820 AGGGAGGAAGGGAAGGAGGCGGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906151991 1:43592822-43592844 CGGGAGGAGGGGCAGGAGGCTGG - Intronic
906242781 1:44252196-44252218 CTGGCTGAGGTGAAAGATGCTGG + Intronic
906728960 1:48064825-48064847 GTGGATGAGTGGATGGAGGGAGG - Intergenic
906728977 1:48064897-48064919 GTGGATGAGTGGATGGAGGGAGG - Intergenic
907354909 1:53864143-53864165 GTTGGTGAGGAGAAGGAGGCAGG - Intronic
907358249 1:53894085-53894107 CCGGGTCAGGGGAAGGAGTCAGG - Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
909471474 1:76033706-76033728 CTGGAGGAGGGGGAGGCAGCAGG + Intergenic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
910183075 1:84506302-84506324 CTGGAGGAGGGGGAGGAGAAGGG + Exonic
910846795 1:91611918-91611940 GTGGATGGGGGCAAGGAGGGAGG + Intergenic
910897930 1:92087303-92087325 TGGGATGGGGGGAAGGAGGGTGG + Intronic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911137692 1:94458954-94458976 GTGGAGGAGGGGAGGGAAGCGGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911965235 1:104360344-104360366 CAGGATGAGGGGAAGAAGACAGG + Intergenic
912422000 1:109548835-109548857 CTCGGTGAGGGGCTGGAGGCGGG + Exonic
912554150 1:110504129-110504151 CTGGAAGAGGGGAGAGAGGGAGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912650359 1:111433230-111433252 CTGGATGGCAGGAAGGGGGCAGG + Intergenic
912881997 1:113424416-113424438 CTGGATGTGGGGTAGGAAGGAGG - Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913353489 1:117890173-117890195 CTGGTGGTGGGGAAGGAGGTGGG + Intronic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
914024886 1:143903914-143903936 AGGGATGGAGGGAAGGAGGCGGG - Intergenic
914663315 1:149811634-149811656 AGGGATGGAGGGAAGGAGGCGGG - Intronic
914802459 1:150971566-150971588 CTGGCTGAGGTGGAGGGGGCAGG - Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
914937565 1:151993922-151993944 CAGGAAGAGGGGGAGGAGACAGG - Exonic
915086251 1:153390895-153390917 CTGGAGGTGGGGAGTGAGGCAGG - Intronic
915496965 1:156288758-156288780 CTGCATGATGGTCAGGAGGCTGG - Intronic
915523780 1:156464080-156464102 TTGTATGGGGGGAGGGAGGCTGG - Exonic
915544162 1:156586455-156586477 CTGGATGACCTGAAAGAGGCAGG - Exonic
915557779 1:156669890-156669912 CAGGAGGAGGGGAGGGAGCCAGG - Exonic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915948925 1:160174738-160174760 GTGGAGGAGGGTGAGGAGGCAGG + Exonic
915962468 1:160278725-160278747 CTAGATGAGGGGAAATAGGATGG + Exonic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916522503 1:165577517-165577539 CTGGATGTGGGGCTGGAAGCAGG + Intergenic
916914608 1:169392667-169392689 CTGGATGGGGGGAAGTTGCCAGG + Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917594910 1:176519391-176519413 CTGGTGGAAGTGAAGGAGGCAGG + Intronic
917837706 1:178954012-178954034 CTGGGAGAGGGGAATGAGCCTGG - Intergenic
918204669 1:182298194-182298216 GAGGATGTGGGGCAGGAGGCTGG - Intergenic
919772571 1:201171917-201171939 CTGGATGAGTGTAGAGAGGCAGG + Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920069535 1:203292287-203292309 CTGGAAGTGGGGATGGAGGGTGG + Intergenic
920095394 1:203483355-203483377 CTGGAGGGAGGGGAGGAGGCAGG - Exonic
920265417 1:204717912-204717934 CCAGATGAGGGGAATGAGACAGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920363034 1:205432369-205432391 TAGGATGAGGGGAAAGAGCCTGG - Intronic
920615404 1:207487472-207487494 TTTGAAGAGAGGAAGGAGGCAGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920912548 1:210232555-210232577 CGGGAAGCAGGGAAGGAGGCAGG + Intergenic
921177236 1:212606201-212606223 GGGGCTGAGGGGAGGGAGGCAGG + Intronic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
922072148 1:222205013-222205035 CTGTAGTAGGGAAAGGAGGCTGG - Intergenic
922613859 1:226949194-226949216 CTGGAGGCTGGAAAGGAGGCCGG + Intronic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
923092782 1:230752607-230752629 AGGGAGGATGGGAAGGAGGCGGG + Intronic
923154878 1:231269395-231269417 GTGGATGGTGGGGAGGAGGCGGG - Intronic
923265258 1:232307539-232307561 TTGGAAGAGGGGAAGGGTGCCGG - Intergenic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923482592 1:234397761-234397783 GGGGAGGAGGGGGAGGAGGCGGG + Intronic
923482603 1:234397782-234397804 GGGGAGGAGGGGGAGGAGGCGGG + Intronic
923988304 1:239406416-239406438 GTGGATCAAGGGAAGGAGTCAGG - Intronic
924202567 1:241675070-241675092 AAGGATGAAGGGAGGGAGGCAGG - Intronic
924281218 1:242439229-242439251 TTGCATGTGGGGAAGGAGCCGGG + Intronic
924445897 1:244130526-244130548 GTAGTTGAGGGGAAGAAGGCAGG - Intergenic
924589912 1:245393925-245393947 CTGGGGGAGGGGAAGGGGTCAGG + Intronic
1062791808 10:311469-311491 CTGGATGCGGGCAAGGCAGCGGG + Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062963654 10:1591934-1591956 GTGGGTGAGGTGAAGGATGCCGG - Intronic
1063201747 10:3790898-3790920 CTGGATGAAGGAGAGGAGGCAGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063440180 10:6066650-6066672 CTGGATGTGGGGCAAGAAGCGGG + Intergenic
1065483479 10:26216149-26216171 CCAGCTGAGGGGAAGGAAGCGGG - Intergenic
1065555578 10:26912324-26912346 TTGGAAGAGGGCAATGAGGCGGG + Intergenic
1065932236 10:30490263-30490285 TGGGTTGAGGGGATGGAGGCAGG - Intergenic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066433186 10:35372171-35372193 CTGGAGGAGGGAAAGGATGGGGG + Intronic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067352579 10:45489980-45490002 GGGCATGAGAGGAAGGAGGCTGG - Intronic
1067448001 10:46364729-46364751 CTGTATCTGGGAAAGGAGGCTGG - Intergenic
1067589377 10:47496032-47496054 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067636503 10:48004111-48004133 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068557659 10:58477230-58477252 CTGGAGGAAGGCAAGAAGGCAGG - Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068751441 10:60597562-60597584 TTGGGGGAGGTGAAGGAGGCGGG - Intronic
1068875732 10:61994607-61994629 CTGGGGGTGGGGAAGGAGTCGGG - Intronic
1069058530 10:63869607-63869629 CTGGAAGAGGGGATGGAGACTGG - Intergenic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1070513174 10:77179447-77179469 CTGGAGGTGGGCAAGGAGGAGGG + Intronic
1070535733 10:77375927-77375949 CGGGAGGAGGGGAAGGCAGCAGG - Intronic
1070594403 10:77821908-77821930 CTGGAAGACAGGAAGGAGCCAGG - Exonic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1070877372 10:79826339-79826361 CGGGACGGGGCGAAGGAGGCCGG + Intergenic
1071397535 10:85238420-85238442 CTAGATGAGGGGCAGGAGGCAGG + Intergenic
1071527527 10:86366855-86366877 CGGGCGGAGGGGAGGGAGGCGGG - Intergenic
1071608619 10:87015939-87015961 CTGTATCCGGGAAAGGAGGCTGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073110706 10:101061634-101061656 CTGCATAAGGGGGAGGCGGCAGG - Intergenic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1074204639 10:111272217-111272239 CTGGATGAGAGGAAGAGGGGAGG + Intergenic
1074898393 10:117796212-117796234 AGGGATGAGGGGTGGGAGGCTGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075129122 10:119723713-119723735 CTGGAAGAGGGTGATGAGGCTGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075686333 10:124367614-124367636 TTGGAGGGGGGGAAGGAGGTGGG - Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076151469 10:128165490-128165512 TTGGAAGAGGGAAAGGAGGTGGG + Intergenic
1076371818 10:129960132-129960154 CTGGGGGAGGGGCGGGAGGCTGG + Intronic
1076881012 10:133239274-133239296 CTGGCTGAGGAGACGGAGCCCGG + Intronic
1076978127 11:190733-190755 TGGGATGGCGGGAAGGAGGCTGG - Intronic
1077315036 11:1915782-1915804 GTGGATGAAGGGAGGGAGGGAGG + Intergenic
1077336760 11:2008724-2008746 CTGGCTGAGGGAAAGGAGACGGG + Intergenic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077488223 11:2848742-2848764 CTGGGCGAGGGGTTGGAGGCGGG - Exonic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1078335488 11:10459787-10459809 GTGGGTGAGGGGACAGAGGCAGG + Intronic
1078423576 11:11231680-11231702 CTGGATGAGGGACAAGAGACAGG + Intergenic
1080421930 11:32118193-32118215 ATGGATGCAAGGAAGGAGGCGGG - Intergenic
1080848718 11:36048932-36048954 CTGGAAGTGGGGAAGAAGACTGG - Intronic
1081618605 11:44605208-44605230 CTGGATGAGAGGAAATGGGCAGG - Intronic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083431071 11:62613666-62613688 CTGGATGAGGCGCTGGAGGAGGG + Exonic
1083455968 11:62778787-62778809 GTGGTTGAGGGGGAGGAGGCTGG + Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083679103 11:64343092-64343114 CAGGCTGAGGGGAAGGAGTTTGG + Intronic
1083738010 11:64692741-64692763 GTGGAGGAGGGGAAGGGGACAGG + Intronic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084673919 11:70623434-70623456 CTGCATGATGGGACAGAGGCAGG - Intronic
1084709814 11:70836899-70836921 TTGGATGAGGTCAAGGAGGTGGG + Intronic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085199263 11:74691858-74691880 CAGGGTGAGGGGAAGCAGGGTGG + Intergenic
1085386877 11:76162668-76162690 GGGGCTGAGGGGAAAGAGGCAGG - Intergenic
1085502703 11:77038077-77038099 GGGGATGAGGGGGAGGAGGAGGG + Intronic
1085523301 11:77150594-77150616 CTGGGCGAGAGGGAGGAGGCAGG + Intronic
1085947067 11:81284812-81284834 CTGTAGGAGGGGGAGAAGGCAGG - Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086886456 11:92211552-92211574 GAGGATGAGGGGAGAGAGGCTGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089027529 11:115287358-115287380 GAGGGTGAGGGGACGGAGGCAGG + Intronic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089422072 11:118339425-118339447 AGCGTTGAGGGGAAGGAGGCAGG - Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1090398941 11:126436156-126436178 GTGGGTGAGAGGGAGGAGGCAGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090752775 11:129761986-129762008 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091339447 11:134799076-134799098 CTGCAGGAGAGGAAAGAGGCAGG - Intergenic
1202819744 11_KI270721v1_random:63906-63928 CTGGCTGAGGGAAAGGAGACGGG + Intergenic
1092143139 12:6197921-6197943 CTGGAGGGTGGGAAGGAGGCCGG - Intergenic
1092181784 12:6451375-6451397 CTGGCTCAGGGGGAGCAGGCAGG - Exonic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1092534776 12:9377708-9377730 GTGGATTAGGGGAAGGAGCTTGG - Intergenic
1093080393 12:14803634-14803656 CTAGATGAGCGCAATGAGGCGGG - Exonic
1093860915 12:24166127-24166149 CTGGATGTGGGGAAGGGTGGTGG + Intergenic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096148225 12:49293646-49293668 CTGGCTGGGGGTAAGGAGGGCGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096870352 12:54588692-54588714 CTGGGGGAGGGGGAGGGGGCCGG - Intergenic
1097102207 12:56597777-56597799 AAGGAGGTGGGGAAGGAGGCTGG + Exonic
1097362205 12:58670566-58670588 CTGGATGAGGAGGCAGAGGCAGG + Intronic
1097509353 12:60517671-60517693 CTGGATGTGGGAAAGGCGGGAGG - Intergenic
1097707909 12:62887098-62887120 CTGGATGTGGAGAAAGAGGGAGG + Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098290440 12:68952597-68952619 TGGGATGAGGGGAGGGAGGTGGG - Intronic
1098337626 12:69420247-69420269 TTGGATGAGAGGGAGGAGGCAGG + Intergenic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1098751348 12:74297025-74297047 CTGGAGGGAGGGAAGGGGGCTGG - Intergenic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1099970228 12:89492758-89492780 CTGGATGTGGGAGAGGAAGCAGG - Intronic
1100354848 12:93819221-93819243 CTGGATGAAGGGCAGGAACCAGG - Intronic
1100879858 12:99004617-99004639 TGGGGTGCGGGGAAGGAGGCAGG + Intronic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101334164 12:103781564-103781586 ATGGCTGATGGGAAGGATGCAGG - Intronic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101572585 12:105967384-105967406 TTGGATGAGGGCAAAGAGGGAGG + Intergenic
1101948377 12:109155129-109155151 CGGGAGGGGAGGAAGGAGGCTGG + Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102567342 12:113805270-113805292 GTGGGTGGGGGGAAGGAGGGGGG + Intergenic
1102646871 12:114409313-114409335 CTGGCTGAGAGAAAGGACGCGGG - Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102992049 12:117322504-117322526 AAGGAGGAGGGGAAGGAGGGAGG - Intronic
1102996107 12:117351852-117351874 CTGGATGATGGAGAAGAGGCAGG - Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103084628 12:118052919-118052941 CTTGATGATGGGGAGGATGCAGG - Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103190942 12:119001503-119001525 CTGTATGAGTGGAAGAGGGCAGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103580140 12:121908792-121908814 CTGGTCGAGGGGAAGCTGGCAGG + Intronic
1103721351 12:122977189-122977211 CTGGATGAGGGCACGAAGGAAGG - Intronic
1104273653 12:127305259-127305281 CTGGATGTGAGGGAGGAGCCAGG + Intergenic
1104850679 12:131872056-131872078 CTGGATGTTGGGGAGGAGGGAGG + Intergenic
1105545281 13:21346605-21346627 GAGGATGAGGGGAATGAAGCGGG - Intergenic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1108240017 13:48454532-48454554 CTCTATGAGGGGAAGGACCCAGG - Intronic
1108820426 13:54342695-54342717 ATGGATGGGGGCAGGGAGGCGGG - Intergenic
1110014784 13:70386862-70386884 CTGGAGGGGGGCAAGGTGGCAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1110906367 13:80895673-80895695 ATGGATGAGGGGTAAGAGACAGG + Intergenic
1112182281 13:97095368-97095390 CAGGATGAGGGGCAGGAAACGGG + Intergenic
1112228843 13:97567848-97567870 CTGGATAAGAGAAAGGATGCTGG + Intergenic
1112428531 13:99327995-99328017 CTGGATGTGGGGAAAGAGCATGG - Intronic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1113040608 13:106100561-106100583 CTGGCTTAGGGGGAGAAGGCAGG + Intergenic
1113185519 13:107682358-107682380 CAGGATGAGTGCAAGGAGGGTGG - Intronic
1113366443 13:109681080-109681102 CAGGATGAGGGACAGGTGGCTGG - Intergenic
1113424468 13:110196537-110196559 CTGGTTGAGCTGAAGCAGGCAGG - Intronic
1113673971 13:112195793-112195815 AAGGAAGAGGGGAAGGAGGGGGG - Intergenic
1113844242 13:113377002-113377024 CTGGATCAGGGGAAAGATTCTGG - Intergenic
1113955595 13:114098626-114098648 CGGGATGAGGGGAGGCAGGAAGG + Intronic
1114302664 14:21392463-21392485 TGGGAAGTGGGGAAGGAGGCTGG - Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1115143433 14:30199643-30199665 CAGGCTGTGGGGAAGAAGGCAGG - Intergenic
1115399402 14:32939773-32939795 CTCGAGGAAGGGAATGAGGCTGG + Intronic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1115761604 14:36582391-36582413 GCCGAGGAGGGGAAGGAGGCGGG + Exonic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117313449 14:54551152-54551174 CTGGGTGGGGGTGAGGAGGCAGG - Intergenic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1118568791 14:67172254-67172276 CTGGCTGAGGGGGATGCGGCGGG - Intronic
1118808508 14:69257795-69257817 CTCCATGGGGGGAAGGAGGGAGG - Intergenic
1118899447 14:69974267-69974289 GAGGATCAGAGGAAGGAGGCAGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119420195 14:74503708-74503730 TGGGTTGAGGGGAGGGAGGCAGG - Intronic
1119686610 14:76637630-76637652 CTGGGTGAGAGGAAGAAGACTGG + Intergenic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121617638 14:95323425-95323447 CTTCATGAGGCCAAGGAGGCAGG + Intergenic
1121624613 14:95374973-95374995 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624644 14:95375076-95375098 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624673 14:95375190-95375212 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624683 14:95375225-95375247 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624699 14:95375280-95375302 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624711 14:95375315-95375337 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1122029333 14:98901198-98901220 AGGGAAGAGGGAAAGGAGGCAGG - Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1123931475 15:25173695-25173717 CTCCATGCGGGAAAGGAGGCAGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124367998 15:29087728-29087750 CTGGAGTGGGGAAAGGAGGCAGG - Intronic
1124610146 15:31202496-31202518 ATGGGTGAGGGGAAGTAGCCTGG + Intergenic
1124619237 15:31264684-31264706 GGGGATGAGGGGCAGGGGGCAGG + Intergenic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124856129 15:33391117-33391139 AGGGATGAGGGGAAAGAGGCAGG - Intronic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125808481 15:42515624-42515646 CTGGATGATGGAAAGCAGGATGG + Intronic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1126443872 15:48720216-48720238 CTGGAGGAAGGGAAGGAGTGAGG + Intronic
1127490031 15:59453787-59453809 CTGGAAGAGGGTAGGGAGGGAGG + Intronic
1127887034 15:63210629-63210651 TTGGATGTGGGGAACGTGGCAGG + Intronic
1128109220 15:65066157-65066179 AGGGATGAAGGGAAGGAGGGAGG + Intronic
1128157848 15:65402947-65402969 GTGGATGAGGGAATGGAGGAAGG + Intronic
1128213281 15:65916911-65916933 CTGCATGCGTGGAAGCAGGCGGG + Exonic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128755621 15:70181764-70181786 GTGGACGAGGGGAAGGAGTTGGG - Intergenic
1129043735 15:72714129-72714151 CAGGATGAGGGGAAGAAGCCTGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129188787 15:73926069-73926091 CGGGAGTACGGGAAGGAGGCTGG + Intronic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1129772608 15:78212501-78212523 CTGGCTGCGGGGCAGGAGGCGGG + Intronic
1130517819 15:84639698-84639720 CTGGAGGATGAGAAGGTGGCAGG + Exonic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1130978025 15:88792184-88792206 GGAGATGAGGGGAGGGAGGCAGG + Intergenic
1131144234 15:90001374-90001396 CTGGAAGAAGGGAATGAGGCAGG - Exonic
1131329420 15:91482922-91482944 GTGGAGGAGGGCAAGCAGGCAGG + Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131669789 15:94607618-94607640 CAGGATGAGAGGAGGGCGGCGGG - Intergenic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132483441 16:177642-177664 CGGGAGGAGGGGATGGAGGAGGG + Intergenic
1132490116 16:223916-223938 CGGGAGGAGGAGGAGGAGGCGGG - Intronic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1132874522 16:2130431-2130453 ATGGATGATGGGGAGGGGGCTGG - Intronic
1133229862 16:4361348-4361370 CTCGCTGTGGGTAAGGAGGCTGG - Exonic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1133738544 16:8633699-8633721 TTGGATGAGGAAAAGGTGGCTGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133839407 16:9394452-9394474 AGGGAGGAAGGGAAGGAGGCAGG - Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134553467 16:15149264-15149286 ATGGATGATGGGGAGGGGGCTGG - Intergenic
1134811601 16:17171902-17171924 CTTTAGGAGAGGAAGGAGGCTGG + Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135234393 16:20741936-20741958 CGGGAGGCGGGGCAGGAGGCGGG - Exonic
1135427702 16:22353529-22353551 CTGGTAGAGAGGGAGGAGGCAGG - Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1136778292 16:32882959-32882981 CTGGAGGAGAGGAGAGAGGCTGG - Intergenic
1136892328 16:33978555-33978577 CTGGAGGAGAGGAGAGAGGCTGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137650341 16:50114640-50114662 CAGGATGAGGGCAGGAAGGCGGG - Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137745535 16:50817490-50817512 CTGGATTAGCGGCAGGAGGTGGG + Intergenic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138272684 16:55707295-55707317 TGGGAGGAGGGGAGGGAGGCTGG + Intergenic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1140194421 16:72845030-72845052 GTGCATGAGGGGAACGAGGGAGG + Intronic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141775767 16:86121772-86121794 TAGGAGGAGGTGAAGGAGGCAGG - Intergenic
1141854789 16:86673665-86673687 GTGCATGAAGGGAAGGAGGGAGG - Intergenic
1141854827 16:86673844-86673866 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854853 16:86673963-86673985 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854867 16:86674014-86674036 ATGGATGAAGGGATGGAGGGGGG - Intergenic
1142262002 16:89047425-89047447 CTGGATGGCAGGAAGGAAGCAGG - Intergenic
1203080714 16_KI270728v1_random:1145068-1145090 CTGGAGGAGAGGAGAGAGGCTGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1143250688 17:5521127-5521149 GTGCATGGGGGGAGGGAGGCAGG - Intronic
1143485760 17:7252643-7252665 CTGGCTGAGGGGACGGAAGTGGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143647766 17:8242707-8242729 CTCGAAGTGGGGAAAGAGGCTGG - Intronic
1144701361 17:17343041-17343063 CTGGATGGGGGGCAAGAGCCTGG - Intronic
1144826900 17:18110214-18110236 CAGGATGAGGTGAAACAGGCTGG - Intronic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146475664 17:33160704-33160726 CTGGTTGATGGGAAGATGGCTGG + Intronic
1146912697 17:36658504-36658526 CTGGAAGGGGTGGAGGAGGCTGG + Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147187236 17:38719601-38719623 CTGGAGGAGGGGCTGGGGGCAGG + Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147402857 17:40191512-40191534 CGGGATGGGGGGCCGGAGGCCGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148079631 17:44960511-44960533 CTGTATGATTGGAAGGGGGCGGG - Intronic
1148166563 17:45488197-45488219 CTGGATGGAAGGAAGGAGGGAGG - Intronic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148396381 17:47311173-47311195 ATGGATGAGGGACAGGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1149389369 17:56173986-56174008 CTGTATCAGAGAAAGGAGGCAGG - Intronic
1149556712 17:57578555-57578577 GGGGATGAGGGGAAGGGGACGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149998364 17:61416732-61416754 CTCCAGGAGGGGAAGGGGGCAGG - Intergenic
1150397735 17:64834598-64834620 CTGGATGGAAGGAAGGAGGGAGG - Intergenic
1150561904 17:66302289-66302311 GGGGATGCGGGGGAGGAGGCCGG - Intergenic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1151301970 17:73233017-73233039 CGGGAGGAGGGAAAGGCGGCTGG + Intronic
1151512997 17:74573092-74573114 CTGGATGTGAGGGAGGAGGGAGG + Intergenic
1151926747 17:77203289-77203311 CGGGATGAGGGGAATCCGGCTGG - Intronic
1152266274 17:79296834-79296856 CAGGAGGAGGGGGAGGAGGGGGG - Intronic
1152641557 17:81451540-81451562 CGGGATGAGGGTCAGGAGACCGG - Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1153990738 18:10397210-10397232 CTGGATGAGGAAAGAGAGGCGGG + Intergenic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157328949 18:46689211-46689233 CTGAATGAGTGGCAGAAGGCAGG - Intronic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158691805 18:59667643-59667665 GGGGATGAGGGGAGAGAGGCTGG - Intronic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1159914120 18:74173548-74173570 CTCCATGAGGAAAAGGAGGCAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160151249 18:76395954-76395976 GTGGATGCTGGGAAGAAGGCAGG - Intronic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160440690 18:78889203-78889225 CTACTTGAGGGGAAGGAGGGAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160694879 19:478723-478745 CCGGATGAGAGGCCGGAGGCCGG + Intergenic
1160816004 19:1036107-1036129 CTGGGTGAGGGAAAGGGGCCGGG - Intronic
1160970653 19:1766419-1766441 CTGGATGAAGGGGAGGATGAAGG + Intronic
1160997188 19:1888245-1888267 ATGGGAGGGGGGAAGGAGGCTGG - Intergenic
1161283515 19:3457781-3457803 CTGGCTGAGCGGATGGGGGCGGG + Intronic
1161455157 19:4366247-4366269 CTGGAAGAGGGGTTGAAGGCTGG + Intronic
1161577878 19:5064858-5064880 CTGGATGAGGGGTGTGATGCTGG - Intronic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161934619 19:7364016-7364038 GTGGATGAAAGGAAGGAGGATGG + Intronic
1161984478 19:7646198-7646220 GGGATTGAGGGGAAGGAGGCTGG - Intronic
1162378531 19:10318722-10318744 CTGGAGGAGGAAGAGGAGGCGGG - Intronic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162811098 19:13164618-13164640 CTGGACGAGGGGGAGGGGACAGG + Intergenic
1162982728 19:14249371-14249393 ATGGAAGAGGGGAAGGAAACAGG - Intergenic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163242652 19:16073755-16073777 CTGGAGGATGGGGTGGAGGCTGG - Intronic
1163577462 19:18118992-18119014 AGGGATGAGGTGCAGGAGGCTGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163633911 19:18429802-18429824 CTGGGGGAGGGGCTGGAGGCGGG - Intronic
1163735467 19:18977664-18977686 CCCGGTGATGGGAAGGAGGCGGG + Intergenic
1163827843 19:19533547-19533569 CAGGAGGAGGGGGAGGAGGAGGG - Intronic
1164629884 19:29755041-29755063 CTGGATGTGGGGGATGAGGGTGG + Intergenic
1164715403 19:30387213-30387235 CTGGATGTGGGGAGAAAGGCAGG + Intronic
1164816921 19:31211486-31211508 CTGGACCCGGGGAAGAAGGCAGG + Intergenic
1165175391 19:33925740-33925762 CTGGGTGAGGGATAGGAGGAAGG + Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165495394 19:36149744-36149766 CTGGGTGAGGGCAAAGGGGCTGG + Intronic
1165731730 19:38150223-38150245 CTGGTTGAGGGCAGGGAGGATGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165903261 19:39178583-39178605 TTGGTTGAGGGGAAGGGCGCTGG - Exonic
1166061378 19:40327820-40327842 CCCCATGATGGGAAGGAGGCTGG + Intronic
1166303647 19:41925875-41925897 ATGGGTGAGGGCCAGGAGGCTGG + Intronic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166892246 19:46000698-46000720 CTAGAGGAGGGGAAGGGGCCGGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167052966 19:47090883-47090905 CTGGAGGCAGGGAAGGGGGCAGG + Intronic
1167148957 19:47698227-47698249 CGGGAAGAAGGGAGGGAGGCTGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167276663 19:48543964-48543986 CTGGATCTGAGGGAGGAGGCTGG - Intergenic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
1167612216 19:50513012-50513034 CTGGGAGAGGGGAAAGAGGGCGG + Intronic
1167819095 19:51909760-51909782 CTCGATGAGGGGGATGTGGCAGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168164235 19:54535729-54535751 CTTGACCAGGGGATGGAGGCTGG + Exonic
1168230783 19:55029903-55029925 AGGGAAGAGGGGAGGGAGGCAGG + Intronic
1168318597 19:55495030-55495052 CTGGATAAGAGAAAGGATGCTGG + Intronic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168532093 19:57138093-57138115 AGGGAGGAAGGGAAGGAGGCAGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925202843 2:1982791-1982813 CTGGATAAGGGTAAGCAAGCTGG - Intronic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925293742 2:2764641-2764663 CTGGAAGGAGGGAAGGAGGGAGG + Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925361002 2:3280356-3280378 CTGGAGGATGGGAACGAGGCCGG - Intronic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
926109370 2:10172262-10172284 TCGGATGAGATGAAGGAGGCTGG + Intronic
926142150 2:10374064-10374086 CTGCCTGTGGGGAAGCAGGCGGG - Intronic
926370327 2:12172244-12172266 GTGGATGGTGGGAAGGAGACAGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927154935 2:20216050-20216072 CGGGAGGTGGGGAGGGAGGCAGG + Intronic
927161528 2:20267365-20267387 GTGGATGAGGGGAAGAAGAGAGG + Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927695689 2:25238248-25238270 CTTGTTGAGGGGAAGGAGATGGG - Intronic
927870009 2:26617374-26617396 CTGGATGAAGGCAAGTTGGCAGG + Intronic
928241162 2:29587872-29587894 CTGGTTCAGGGGAAAGAGGTGGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
929437740 2:41940980-41941002 CCAGAGGAGGGGGAGGAGGCCGG + Intronic
929922141 2:46180230-46180252 ATGGATGTGGGGCAGAAGGCAGG + Intronic
929989918 2:46778237-46778259 TTGGATGAGGGCACAGAGGCAGG + Intergenic
930873876 2:56192714-56192736 CTAGATGAGGAGAAGGGTGCAGG + Exonic
931214176 2:60226058-60226080 CTGGATGTCAGAAAGGAGGCAGG + Intergenic
931683478 2:64771814-64771836 CTGGAAGAAGGGAAGGATGATGG - Intergenic
931746581 2:65296404-65296426 CTGGGTGATGGGAATCAGGCAGG + Intergenic
931847797 2:66222498-66222520 CTGCACGAGGGTAAGGAGGGGGG - Intergenic
931882236 2:66579177-66579199 GGGGATGAGGGGAAAAAGGCAGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932596981 2:73100096-73100118 CTAGGTGAGGGGAGTGAGGCTGG - Intronic
932598929 2:73111274-73111296 CTGGAGGAGGGGGATGAGCCTGG - Intronic
933312523 2:80678321-80678343 CTGGATGGGGTGAAGGAAGCTGG + Intergenic
933314845 2:80703695-80703717 CTGGAAGAGAGGAAGGAGGTTGG + Intergenic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934166539 2:89299181-89299203 CTGGATGTGAGACAGGAGGCTGG - Intergenic
934200738 2:89883275-89883297 CTGGATGTGAGACAGGAGGCTGG + Intergenic
934893354 2:98089483-98089505 CTGGAGGTGGGAAAGCAGGCGGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935854958 2:107263759-107263781 GTGGATGTGGGGGAGGAGGGTGG + Intergenic
936495678 2:113018775-113018797 CTGGAAGAGGGGTTGGAGGCAGG + Intergenic
936568082 2:113595562-113595584 CTGGATGCTGGGGAGGAGCCGGG + Intergenic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
936946910 2:117939369-117939391 CTGGATGAGGTAAGGGTGGCTGG - Intronic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937157968 2:119734647-119734669 TTGGATGGTGGGAAGGACGCTGG + Intergenic
937216696 2:120317669-120317691 ATATATGAGGGGAAGGGGGCAGG - Intergenic
937377231 2:121345710-121345732 CTGGAAGAGGTGTATGAGGCAGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938131192 2:128716739-128716761 TTGGATGAGGGGTGGGAGGATGG + Intergenic
938757897 2:134397491-134397513 CTGGAGGAGAGAAAGGAGGTGGG + Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940703546 2:157076099-157076121 CTGGAGGTGGGGAAGGGTGCTGG - Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
941658377 2:168169089-168169111 ATGGATGAGGGGAATGATGAAGG - Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942321681 2:174741715-174741737 CTGGATGGGGAAGAGGAGGCAGG - Intergenic
946119399 2:217496399-217496421 AAGGATGAGGGGATAGAGGCAGG - Intronic
946284814 2:218694927-218694949 CTGGAGGAGGAGAACGAAGCAGG - Intronic
946412359 2:219521685-219521707 CTGCAGGAGGGGACAGAGGCCGG + Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947386932 2:229599893-229599915 CTGGAGGATGGAAAGGAGGGAGG + Intronic
947446753 2:230169978-230170000 ATGGAAGAAGGGAAGGAAGCTGG + Intronic
947458044 2:230274437-230274459 CTGGATGTGGAGATGGATGCAGG + Intronic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947742806 2:232492583-232492605 ATGGAGGAAGGGCAGGAGGCAGG - Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948091870 2:235302004-235302026 GAGGAGGAGGGGGAGGAGGCAGG - Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948593688 2:239066511-239066533 CTGGAAGAGGTGCAGGGGGCAGG - Intronic
948815350 2:240507541-240507563 CCTGGTGAGGGGCAGGAGGCTGG - Exonic
1168754894 20:309664-309686 TTGGCTGTGGGTAAGGAGGCAGG - Intergenic
1168756642 20:323114-323136 ATGGAAGAAGGAAAGGAGGCAGG + Intergenic
1168857168 20:1016787-1016809 GGGGAAGTGGGGAAGGAGGCTGG - Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168965104 20:1894277-1894299 CTGGAGGCGGCGAAGGAGTCGGG - Exonic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169425845 20:5496887-5496909 GTGGATGGGGGGAGGGAGGCAGG - Intergenic
1169800455 20:9507595-9507617 CTGGACCAGGGGAGAGAGGCCGG + Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170259837 20:14391815-14391837 CTAGATGGGGGAAAGGAGGGAGG + Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171018666 20:21564302-21564324 CTGGATGGGTGGGAGGTGGCGGG + Intergenic
1171330400 20:24332415-24332437 ATAAATGAGGGGAAGGAGACAGG - Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173208900 20:41016558-41016580 TTGGATAAGGGGGAGTAGGCAGG + Intergenic
1173270029 20:41525387-41525409 CTGGAGGAGGGATTGGAGGCAGG - Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174397524 20:50257009-50257031 CTGGAGGAGGTGGAAGAGGCTGG - Intergenic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175322185 20:58096980-58097002 ATGAATGAGGGGCAGAAGGCAGG - Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175844102 20:62049641-62049663 GTGGATGAGGGGCAGGGTGCGGG - Intronic
1175953618 20:62596760-62596782 GTGCATGGCGGGAAGGAGGCCGG - Intergenic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176218189 20:63957983-63958005 CCTGATGAGAGGATGGAGGCTGG - Exonic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176277973 20:64285133-64285155 TGGGATGGCGGGAAGGAGGCTGG + Intronic
1176292171 21:5052258-5052280 ATAGATGAAGGGAAGGAGGGAGG - Intergenic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177059633 21:16354682-16354704 GTGGAAGTGGGGAAGGAGGTTGG - Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1178138076 21:29650800-29650822 GTGGCTGTGGGGAAGGTGGCTGG - Intronic
1178255861 21:31052019-31052041 CTGGATGAGGGTGGGGAGACAGG + Intergenic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1178829215 21:36041201-36041223 ATGGATGAGGGGCCGGAGGCAGG + Intronic
1179025106 21:37673371-37673393 CTGGAAGAGGGGGAGGGGACAGG - Intronic
1179371925 21:40813979-40814001 CTTTATGAGGGGTATGAGGCAGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179812037 21:43877953-43877975 CTGGTGGTGGGGCAGGAGGCGGG - Intronic
1179865088 21:44211396-44211418 ATAGATGAAGGGAAGGAGGGAGG + Intergenic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180183036 21:46126480-46126502 CTGGAAGAGAGGAGAGAGGCCGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180954636 22:19736217-19736239 CTGGAAGGGGGCATGGAGGCTGG - Intergenic
1181034804 22:20164783-20164805 CTGGAGCAGAGGAAGCAGGCAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182117123 22:27763265-27763287 ATGGATGGGGGGGATGAGGCAGG - Intronic
1182429369 22:30290957-30290979 GGGGCTGAGGGGAAGGAGGCAGG + Intronic
1182469931 22:30542324-30542346 CTGGAGGCGGCGAAGGAGTCGGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182738381 22:32547494-32547516 GACCATGAGGGGAAGGAGGCAGG - Intronic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183227313 22:36559289-36559311 CTGGAAGTGGGAAAGGAGGAGGG + Intergenic
1183334043 22:37236638-37236660 GTGGAGGAGGGGAATGGGGCAGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183575288 22:38684312-38684334 ATGTATGAGAGGAGGGAGGCAGG + Exonic
1183641001 22:39092332-39092354 CAGGATGGGAGGAAGGAGACTGG - Intergenic
1183816781 22:40308541-40308563 ATGGTTGGTGGGAAGGAGGCTGG + Exonic
1183945793 22:41325060-41325082 TTACATGAGGGGAAGGAGGGAGG - Intronic
1183984760 22:41563279-41563301 CTGGGGGAGGGGGAGGAGCCAGG + Intronic
1184092345 22:42299312-42299334 CTGGATGTGGGGAGAGGGGCTGG - Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184302256 22:43568580-43568602 CGGGTTCAGGGGAATGAGGCGGG + Intronic
1184561858 22:45268396-45268418 CTGGAGGAGGGGACAGAGGGAGG - Intergenic
1184694321 22:46131261-46131283 CTGGATGTGGGCTAGGAGGGGGG - Intergenic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184785445 22:46669373-46669395 CTGGCGGCGGGGAAGGAGGGTGG + Intronic
1184869071 22:47222121-47222143 GTGGAGGAGGGGAAGGAGCTAGG - Intergenic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1185275774 22:49949702-49949724 CTGGCTGCGGGGACGCAGGCAGG - Intergenic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950252233 3:11475407-11475429 CTGCATGATGGGCAGGGGGCTGG + Intronic
950266675 3:11578413-11578435 CTGGACCATGGGAAGGCGGCTGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951126107 3:18985467-18985489 TTGGATGTGGGGCAGGAGGGAGG - Intergenic
952334185 3:32391067-32391089 CCGGAAGGAGGGAAGGAGGCAGG + Intergenic
952405159 3:32998694-32998716 ATGGAAGAAGGGAGGGAGGCAGG + Intronic
953471349 3:43169378-43169400 GTGGATGAGGCAAAGTAGGCTGG - Intergenic
953704983 3:45224825-45224847 GTGGGTGCGGGGAAGGAGTCGGG + Exonic
953904377 3:46861152-46861174 GTGGAGGGGGGCAAGGAGGCAGG - Intronic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954435976 3:50496550-50496572 ATGGATGAGGGGATAGTGGCTGG + Intronic
954611083 3:51944907-51944929 CTGGGTGAGGGGTGAGAGGCAGG + Exonic
954619297 3:51986495-51986517 CTGGATGAGGGTGAGCAGGTTGG + Exonic
954625536 3:52020123-52020145 CCGGATGGGGGCAAGGAGCCAGG - Intergenic
954745079 3:52783116-52783138 CTGGATGAGGGTAAGGGTGGGGG + Exonic
954753945 3:52828915-52828937 CTGGATGGAGGGAAGGACGGGGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
955621866 3:60873102-60873124 TTGGAGGAGGGGAACAAGGCAGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956572167 3:70709000-70709022 GTGGAAGAGGGGGAGGAGGTGGG + Intergenic
956970230 3:74515037-74515059 CTGGATGTGGGGAGGGAGTTGGG + Intronic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
959099903 3:101998576-101998598 CTGAATGAGGGAATGGTGGCTGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
959510560 3:107206878-107206900 AGGGTTGAGGGGAAGGAGACTGG - Intergenic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962089724 3:132230495-132230517 GTGGATGTGGGGGTGGAGGCCGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
962829620 3:139128576-139128598 GAGGAGGAGGGGAAGGAGGGTGG + Intronic
963231382 3:142911586-142911608 CTGGAGGAAGGGAAGGGGACTGG + Intergenic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
964796297 3:160501321-160501343 TTGGGTGGGGGGAAGGAGGTGGG + Exonic
966351576 3:179037382-179037404 CTAGATGAGGGGAATGTGGGTGG - Intronic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967277374 3:187789905-187789927 AAGGAAGAGGGGAAGGAGGGAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968103622 3:195985527-195985549 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968301924 3:197623120-197623142 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
968373097 4:12864-12886 TGGGATGGGGGGAAGGAGCCTGG - Intergenic
968440908 4:623993-624015 CTGGATGTGAGGATGGCGGCCGG - Intergenic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
968947828 4:3674921-3674943 AGGGATGATGGGAAGGAGGGAGG - Intergenic
969161367 4:5262067-5262089 AAAGATGAGGGGAAGGAGGGAGG - Intronic
969172675 4:5376641-5376663 CAGGATGATGGAAATGAGGCTGG + Intronic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969416174 4:7060950-7060972 CCGGTTGAGGGGAAGGAGCCAGG - Exonic
969428282 4:7138495-7138517 CTGGATGGGGGCAAGGACTCCGG + Intergenic
969459795 4:7322897-7322919 CTGGATGGGGGTGGGGAGGCAGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969515901 4:7648148-7648170 GTGGATGGTGGGAAGGAGGGAGG + Intronic
969551269 4:7869211-7869233 ATGGATGGAGGGAAGGAGGAAGG + Intronic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
972614018 4:40680887-40680909 ATGGATGAGTGGAAGAAGGCTGG + Intergenic
973319434 4:48794982-48795004 ATGGGAGAGGGGAAGGAAGCAGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974735543 4:65927088-65927110 TGGGATGAGGGGAAGCAGGAGGG - Intergenic
975610457 4:76197487-76197509 CTGGCTCAGTGGAACGAGGCTGG - Intronic
975779155 4:77820293-77820315 TGGGGTGAGGGGAAGGAGGCGGG + Intergenic
975848877 4:78551719-78551741 CCGGAGGAGGGGCAGGAGGAAGG + Exonic
976130227 4:81876332-81876354 CTTGATGAGGGGAAGGGGAGGGG - Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
978413798 4:108454615-108454637 TTGGATGAGGGGCAGGAGGGCGG + Intergenic
980022135 4:127722782-127722804 CTGGAAGTGGGGAAGGAGAGGGG - Exonic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981550462 4:145937232-145937254 GTGGAGGAGGGGAAGGGGACCGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982961948 4:161850503-161850525 CTGGGTGAGGGCAAAGAGGGTGG + Intronic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983192399 4:164768469-164768491 CCAGAGGAAGGGAAGGAGGCAGG + Intergenic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983846877 4:172531684-172531706 CTGGCTGAGGGGAGAGAGGGTGG + Intronic
984265104 4:177488747-177488769 CTTTATGAGGGAGAGGAGGCAGG + Intergenic
984888531 4:184472879-184472901 GCGGGGGAGGGGAAGGAGGCGGG - Intronic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
985462297 4:190119700-190119722 TGGGATGGGGGGAAGGAGCCTGG + Intergenic
985487543 5:159895-159917 CTGGAGGCCGGGAAGGAAGCGGG - Intronic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985660870 5:1155942-1155964 CGGGAGGAAGGGAGGGAGGCCGG + Intergenic
986299664 5:6467988-6468010 CTGGATGAGAGCAAGGAGAGAGG - Intronic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987012653 5:13782969-13782991 CTGGAACAGGGGACAGAGGCTGG + Intronic
987885476 5:23806768-23806790 CAGGATGAGGGAGAGAAGGCAGG - Intergenic
990295475 5:54397653-54397675 ATGGAGGAAGGGAAGGAGGGAGG - Intergenic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
991110069 5:62889663-62889685 CTAGATTTGGGGAAGGAGGGTGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992483274 5:77171920-77171942 CAGGATGAGGGGAGGAAGGATGG + Intergenic
992636622 5:78730952-78730974 GGAGGTGAGGGGAAGGAGGCAGG + Intronic
992779605 5:80116072-80116094 ATGGATGAGGGGTGTGAGGCAGG + Intronic
992791872 5:80220941-80220963 GTGGATGAGGGAAAAGAGCCAGG + Intronic
993044630 5:82853474-82853496 ATGGGTGATTGGAAGGAGGCAGG - Intergenic
995571771 5:113488627-113488649 AGGGAGGAGGGGAAGGTGGCTGG + Exonic
995716104 5:115083145-115083167 CTGGATGAGGGGCACTAGGAGGG + Intergenic
997425707 5:133801334-133801356 CTGGCTGAGGTGCAGAAGGCTGG - Intergenic
997690323 5:135823694-135823716 CTGAATGAGGGGTATGAGGGTGG + Intergenic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998161092 5:139813470-139813492 CTGGATGAGGGGTGTGAGGGGGG - Exonic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
998378491 5:141707548-141707570 ATGGAAGAGGGGCAGGAGGCAGG + Intergenic
998471329 5:142386232-142386254 GGGGATGAAGGGAAGGAGGTTGG + Intergenic
999188223 5:149728637-149728659 CTGGATGAAGGCAAGAAGGCGGG - Intergenic
999519799 5:152339545-152339567 CTTAATGGGGGGATGGAGGCAGG + Intergenic
999840847 5:155424966-155424988 CGTGAGGAGAGGAAGGAGGCTGG + Intergenic
999857313 5:155608789-155608811 CTGGAGGAGGGAATGGAAGCAGG + Intergenic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001674751 5:173502556-173502578 CTAGGGGAGGGCAAGGAGGCGGG + Intergenic
1001791052 5:174458480-174458502 AAGGATGTGGGGAAGGAGGTGGG - Intergenic
1002060311 5:176621729-176621751 AGGGATGAGTGGAAGGTGGCGGG - Intronic
1002174375 5:177393280-177393302 TTGGAGGAGAGGAAGGAGCCAGG + Intronic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1002754922 6:149409-149431 TGGGATGGCGGGAAGGAGGCTGG - Intergenic
1002808747 6:604730-604752 GTGGCTGAGTGGAGGGAGGCAGG - Intronic
1003169216 6:3708011-3708033 CTGGATGATGGAATGGAGGTTGG + Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1005114672 6:22322430-22322452 CTAGAAGAGGGGATGGGGGCTGG - Intergenic
1005594665 6:27368040-27368062 CTGGAGGGGGGAAAGGTGGCAGG - Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006364880 6:33609560-33609582 CTGGATGAGGGTCAGAAGGGAGG + Intergenic
1006425575 6:33960883-33960905 GTGGATGTGGGGAGGGAGACAGG - Intergenic
1006442358 6:34060438-34060460 CGGGAAGTGGGGTAGGAGGCGGG - Intronic
1006626274 6:35400271-35400293 CTAGGTGAGGGGACGAAGGCTGG - Intronic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006934418 6:37707418-37707440 TAGGATGAGGGGACAGAGGCTGG + Intergenic
1007053566 6:38858594-38858616 TTGGATGGGAGGAGGGAGGCTGG - Intronic
1007378398 6:41471317-41471339 GTGGGGGAGGGGCAGGAGGCAGG - Intergenic
1007879423 6:45146425-45146447 CAGGAAGAAGGGATGGAGGCGGG + Intronic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1008465766 6:51829154-51829176 CTGGGTGGGGGAAAGGAGGTGGG - Intronic
1011404723 6:87006919-87006941 CGGGGGGAGTGGAAGGAGGCAGG + Intronic
1012717969 6:102701263-102701285 CTGGATGAGGGGAATGCAGTGGG + Intergenic
1013360827 6:109392528-109392550 CTGGATGAAGGGGAAGGGGCAGG + Intronic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015903305 6:138089900-138089922 ATTGAGGAGGGGAAGAAGGCTGG + Exonic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017031747 6:150230041-150230063 CTGGATGAGGGCAAACAGGCAGG - Intronic
1018083528 6:160278958-160278980 CTGGACGACAGGAAAGAGGCGGG - Intergenic
1018847463 6:167565576-167565598 CAGGATGAGGGGCAGGCGGGTGG - Intergenic
1019184376 6:170212603-170212625 CTGGAGGTGCGGGAGGAGGCAGG - Intergenic
1019298348 7:290589-290611 CGGGATGGGGGGAAGGACGGGGG + Intergenic
1019320796 7:414419-414441 GAGGATGAGGGGAAGGAAGGAGG - Intergenic
1019324060 7:429419-429441 CTGGATCACGGAGAGGAGGCAGG + Intergenic
1019641770 7:2107120-2107142 CGGGAGGCGTGGAAGGAGGCAGG + Intronic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020162137 7:5781137-5781159 CTGGAGGAGCGGCGGGAGGCGGG - Intronic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021589724 7:22247970-22247992 CTGGATGAGGGAAAGAGGGAGGG + Intronic
1021628748 7:22622909-22622931 GTGGATGAGGTGAAGCAAGCAGG - Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1021826766 7:24561237-24561259 CTGGATGTGAGGAATGAGGAAGG - Intergenic
1022098038 7:27152953-27152975 CTGGATGCGGGGAAGGGGCGAGG - Intergenic
1022517371 7:30984453-30984475 CTGGATGAGGGGACTCAGGCAGG + Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023613045 7:41990955-41990977 CTGGAAGAAAGGAAGGAGGCAGG + Intronic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1024570211 7:50716923-50716945 CCAGATGAGGGGAGGGAGGAAGG + Intronic
1024627756 7:51222956-51222978 CTGGACGTGGGGAGGGAGGGTGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026909280 7:74083337-74083359 CTTGGGGAGGGGAGGGAGGCGGG - Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027630881 7:80604128-80604150 CTAGAGGAGGGGAATGAGGTTGG + Intronic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029127285 7:98303370-98303392 GTGGGTGAAGGGGAGGAGGCTGG - Intronic
1029600015 7:101558038-101558060 CTCGAAGAGGGGAAGCTGGCAGG - Exonic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031604096 7:123748527-123748549 GTGGGAGTGGGGAAGGAGGCGGG - Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1032200837 7:129821644-129821666 TTGGATGAGGTGAGGGAGGCAGG + Intergenic
1032530440 7:132615401-132615423 CTGGCGGAGGGGACGGGGGCTGG + Intronic
1032679674 7:134168774-134168796 CTCGATGACAGTAAGGAGGCTGG - Intronic
1034198347 7:149264955-149264977 CTGGAAGTGGGGGAGAAGGCTGG + Intronic
1034198353 7:149264974-149264996 CTGGAAGTGGGGGAGAAGGCTGG + Intronic
1034198359 7:149264993-149265015 CTGGAAGTGGGGGAGAAGGCTGG + Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1034264258 7:149773528-149773550 GTGGAGGAGGGCGAGGAGGCTGG + Intergenic
1035264894 7:157685178-157685200 CGGGATGAGGGGTGGGAGGGCGG - Intronic
1035265954 7:157690475-157690497 CTGGAAGAGGCGAGAGAGGCTGG - Intronic
1035583875 8:757299-757321 CTGGATGAGGGCAGGTTGGCTGG - Intergenic
1035709700 8:1703071-1703093 TGGGATGTGGGGAATGAGGCAGG - Exonic
1036087953 8:5634069-5634091 TGGGAGGAGGGAAAGGAGGCTGG + Intergenic
1036496762 8:9277171-9277193 CTGCCAGAGGGGAAGGAGCCTGG - Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036753333 8:11456767-11456789 CTGGATTAGGGGAGTGCGGCTGG + Intronic
1036765290 8:11546094-11546116 CTGGATGAAGGTAAGAAGGGTGG + Exonic
1037053684 8:14408677-14408699 CTAGATGAGGGGAAAGTGGCAGG - Intronic
1037128838 8:15383671-15383693 ATGCATGAGGGGGAGGAGGGAGG - Intergenic
1037675053 8:21044061-21044083 GTGGATGATGGGAAGGAGATGGG - Intergenic
1037715559 8:21394586-21394608 CTGGAAGAGGGACAGGAGGCAGG - Intergenic
1037783230 8:21885740-21885762 GTGGACGAGAGGAAAGAGGCAGG - Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037829068 8:22177544-22177566 CTGGGAGAGAGGGAGGAGGCGGG - Intronic
1037880061 8:22568954-22568976 CTGGAGGATGGGGAGGAGTCTGG - Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038489280 8:27958290-27958312 CCGGAAGAGGGGGAGGAGGAGGG - Intronic
1038577283 8:28716219-28716241 CTGGATGAGGCTGATGAGGCAGG + Exonic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1041340986 8:56845119-56845141 ATGGGAGAGGGGCAGGAGGCAGG + Intergenic
1041536016 8:58926239-58926261 CTGGGTGAGAGGAAGATGGCTGG + Intronic
1042017552 8:64332111-64332133 TTTGAGGAGGTGAAGGAGGCTGG + Intergenic
1042560507 8:70069954-70069976 CTGGCTGGGGTGGAGGAGGCTGG - Intronic
1042561280 8:70073496-70073518 CTAGTTGAGGGGAAGGGGCCGGG - Intergenic
1042988057 8:74605150-74605172 TTTGATGAGGGGAGGAAGGCGGG - Intronic
1043147532 8:76676831-76676853 CTGGAGGAGGGGAGGGATTCAGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1046687042 8:117239287-117239309 TGTGATGAGGGGAAGGGGGCTGG - Intergenic
1047469166 8:125150818-125150840 ATGGATGAGGGAACTGAGGCTGG + Intronic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049521806 8:143095229-143095251 CTGGGGGAGGGGACGGGGGCTGG - Intergenic
1049653482 8:143787661-143787683 CAGGATGAGGGGAAAGAGCGGGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049684628 8:143934375-143934397 CTGGATGTGGAGAAGGAGTGGGG - Exonic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050058011 9:1676082-1676104 CTTGCAGAGGGGAAGGAGTCAGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050495274 9:6234421-6234443 GGGGATGAGGGGAAGCAGGGTGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052305684 9:27006675-27006697 GAGGAGGAAGGGAAGGAGGCAGG + Intronic
1052503731 9:29325966-29325988 CTGGATGAGAGGAAGGTTGGAGG - Intergenic
1052894332 9:33733245-33733267 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1052900655 9:33791944-33791966 CAAGAGGAGGGGCAGGAGGCAGG + Intronic
1053102667 9:35384140-35384162 CTGGATGAGTAGAAAGAGTCGGG - Intronic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055295177 9:74826619-74826641 CTGGAGGAGGGCAAGGAGAAGGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056760130 9:89408663-89408685 CTAGAGGAGGAGGAGGAGGCAGG + Intronic
1056808509 9:89746383-89746405 TTGGATGAGGGGCCTGAGGCTGG - Intergenic
1057042161 9:91855708-91855730 ATGGATGAGGGGAATGGGGGTGG + Intronic
1057608666 9:96520903-96520925 CTGGATGTGGTGGAGGAGGCAGG - Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058745529 9:107986812-107986834 GAGGATGAGGCGGAGGAGGCTGG + Intergenic
1059123700 9:111663674-111663696 CTGTTTGAGGGGAAGAAGTCAGG + Intronic
1059300669 9:113310393-113310415 AAGGCTGAGGGGAAGGGGGCAGG - Intergenic
1059450720 9:114370191-114370213 CTGAAAGAGGGGGAGGCGGCGGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060521795 9:124298231-124298253 CCTGCTGAGGGGAAGGAGGTGGG - Intronic
1060776217 9:126376746-126376768 CGGCAGGTGGGGAAGGAGGCTGG - Intronic
1060827453 9:126695173-126695195 CTGGAGGAGGAGACCGAGGCTGG - Intronic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061597555 9:131641779-131641801 GTTGGTGACGGGAAGGAGGCAGG - Intronic
1061757128 9:132823138-132823160 GGGGAGGAGGGGCAGGAGGCAGG + Intronic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1061911816 9:133729036-133729058 ATGGATGAAGGGAAGGGGGATGG + Intronic
1061978791 9:134087918-134087940 CTGGATGTGGGGAGTGGGGCTGG - Intergenic
1061981017 9:134103679-134103701 CTGGATGAATGGACGGATGCTGG - Intergenic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062113334 9:134794742-134794764 GAGGAGGAGGGGAAGGAGGGAGG + Intronic
1062362319 9:136193777-136193799 CTGGGGGAGGGGCCGGAGGCCGG + Intergenic
1062544132 9:137054102-137054124 CGGGACGAGGGGCGGGAGGCCGG + Intergenic
1062643586 9:137534493-137534515 TTGGAGGAGGGGGAGGAGTCTGG - Intronic
1185463147 X:341515-341537 CAGGAGGAGGGGCAGGAGGGGGG - Intronic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188574924 X:31636475-31636497 CTTGATGAGGCTAATGAGGCAGG + Intronic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1188923967 X:36016281-36016303 GTGGATGAGGGGCAGGATGAGGG - Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189534423 X:41922816-41922838 GGGGAAGAGGGGAAGGAGGGAGG + Intronic
1189859927 X:45261773-45261795 GTTGATCAGGGGAAGGAGGTAGG + Intergenic
1190096494 X:47485359-47485381 CTTGTAGAGGGTAAGGAGGCAGG + Intergenic
1190161658 X:48036029-48036051 CTTGTAGAGGGTAAGGAGGCAGG + Intronic
1193669227 X:84363864-84363886 GTGGCTGAGGTGAAGGAGGGAGG + Intronic
1194179563 X:90695673-90695695 CAGGCTGAGGGAAAGAAGGCAGG + Intergenic
1194801310 X:98276838-98276860 CTGGATGGGGGGAGGAAGGAGGG + Intergenic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195821342 X:108948098-108948120 GAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1198234821 X:134726967-134726989 CTGGATGGGGGTAAAGAGGAGGG - Intronic
1198887274 X:141353351-141353373 CTTGATCAGGGCCAGGAGGCTGG + Intergenic
1199453229 X:147996999-147997021 ATGGAGGAGGGGAAAAAGGCTGG + Intronic
1200052292 X:153440736-153440758 CTTGATGAGGGGCAGGCAGCTGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1200932193 Y:8707102-8707124 CTGTAGGATGCGAAGGAGGCAGG - Intergenic
1200967425 Y:9109959-9109981 CTGGATGGGGGAAAGAAGACTGG + Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic