ID: 932579262

View in Genome Browser
Species Human (GRCh38)
Location 2:72982998-72983020
Sequence CACCTGTGGCAGCTTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932579262_932579272 16 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579272 2:72983037-72983059 GCTCACAGGGGATGAGGCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 297
932579262_932579265 2 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579265 2:72983023-72983045 CACTGCTGCCTCCTGCTCACAGG 0: 1
1: 0
2: 13
3: 374
4: 9874
932579262_932579266 3 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579266 2:72983024-72983046 ACTGCTGCCTCCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 30
4: 430
932579262_932579273 17 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579273 2:72983038-72983060 CTCACAGGGGATGAGGCCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 352
932579262_932579269 10 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579269 2:72983031-72983053 CCTCCTGCTCACAGGGGATGAGG 0: 1
1: 0
2: 0
3: 29
4: 293
932579262_932579267 4 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579267 2:72983025-72983047 CTGCTGCCTCCTGCTCACAGGGG 0: 1
1: 0
2: 4
3: 48
4: 494
932579262_932579271 15 Left 932579262 2:72982998-72983020 CCCAGGACAAGCTGCCACAGGTG 0: 1
1: 0
2: 3
3: 22
4: 222
Right 932579271 2:72983036-72983058 TGCTCACAGGGGATGAGGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932579262 Original CRISPR CACCTGTGGCAGCTTGTCCT GGG (reversed) Intronic
900605380 1:3521422-3521444 CTCCTGCGGCAGCTCGGCCTGGG - Intronic
901031554 1:6310107-6310129 AGCCTGTGGCAGCTTCACCTTGG - Intronic
902477484 1:16695979-16696001 CACCCCCAGCAGCTTGTCCTTGG - Intergenic
903089126 1:20893775-20893797 CATCCATGGCAGCTTCTCCTGGG + Intronic
903773286 1:25777508-25777530 GAGGTGTGGCAGCTTGTCCCAGG - Intronic
904567984 1:31439443-31439465 CACCTGTGGCAGCAAGTCAGTGG - Intergenic
905128352 1:35732295-35732317 CTCTTGTGGCATCCTGTCCTGGG - Intronic
905769556 1:40628807-40628829 CACCTGCAGCACCTTGCCCTGGG + Exonic
907048221 1:51312985-51313007 CCCCAGAGGCAGCTGGTCCTGGG + Intronic
907220590 1:52904643-52904665 CACCTGGGGCAGGATCTCCTGGG + Exonic
907332439 1:53679905-53679927 CACCTGAGGCAGCCTGACCTTGG + Intronic
907833221 1:58085209-58085231 CCCTTGTGGGATCTTGTCCTAGG + Intronic
909839951 1:80307887-80307909 CAAATGTGGCAGCTTATCATAGG - Intergenic
910291896 1:85607433-85607455 AACCTGAGGCAGAATGTCCTTGG - Intergenic
917706693 1:177641919-177641941 CTACTGAGGCAGCCTGTCCTAGG + Intergenic
919672881 1:200353903-200353925 GCCCTGTGGCTCCTTGTCCTTGG - Intergenic
920379801 1:205528903-205528925 CGCCTGTGGCAGGTCGTCATTGG + Intronic
1063160019 10:3412346-3412368 CACCTGTGCCTGCCTCTCCTTGG - Intergenic
1069553687 10:69382660-69382682 CACCTCCAGCAGCATGTCCTTGG - Exonic
1069858698 10:71456636-71456658 CACCTGTGCCAGCCTGTGCTGGG + Intronic
1073770312 10:106728472-106728494 TACATGTGGCAGCTTTGCCTGGG + Intronic
1073845463 10:107548790-107548812 CACCTATGGCCACTTTTCCTTGG + Intergenic
1075446724 10:122518459-122518481 CACCTGTCCCAGCTGGTCCAGGG - Intergenic
1075636057 10:124031090-124031112 CACCTGTGGAGGCTTAACCTTGG - Intronic
1076401456 10:130188257-130188279 CACCTGTGACCCCTTGTTCTAGG + Intergenic
1077079790 11:720162-720184 CACCTGCAGCAGCATCTCCTGGG - Exonic
1077131923 11:977316-977338 CCCCTGTGACAGCCTCTCCTGGG - Intronic
1077538878 11:3137334-3137356 CAGCTGTGGCAGCTGGGCCCTGG + Intronic
1077584579 11:3440830-3440852 CTCCTGTGTCAGCTGGTCCCTGG - Intergenic
1080980391 11:37396746-37396768 GATCTGTGGCAGTTTGGCCTGGG - Intergenic
1083214506 11:61210049-61210071 CCCCTGTGCCAGCTGTTCCTGGG - Intronic
1083217390 11:61228878-61228900 CCCCTGTGCCAGCTGTTCCTGGG - Intronic
1083220381 11:61248626-61248648 CCCCTGTGCCAGCTGTTCCTGGG - Intronic
1083229904 11:61310189-61310211 CAGATGTGGCAGACTGTCCTAGG - Intronic
1083414878 11:62518973-62518995 CACATCTGGCATCTTGACCTTGG + Exonic
1086996343 11:93360469-93360491 AACATGTGGCATCTTGGCCTTGG - Intronic
1087138359 11:94741930-94741952 CAGCTGTGGCACCCTGTCCCTGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089737108 11:120557093-120557115 CACAGCAGGCAGCTTGTCCTTGG + Intronic
1091288891 11:134425832-134425854 CACCTGTTGCAGCCTGGCCACGG - Intergenic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1101366814 12:104079632-104079654 GACCTATGGCAGCTTGACTTAGG + Exonic
1102402757 12:112644519-112644541 CACCTGTGACTGCCTGTCCGAGG - Intronic
1103133589 12:118488913-118488935 GGGCAGTGGCAGCTTGTCCTGGG - Intergenic
1104212470 12:126702465-126702487 CACGTGTGGGAGATTGTTCTTGG - Intergenic
1104505766 12:129330716-129330738 CACCTGTGGCCTCTTGCTCTTGG + Intronic
1105920242 13:24956569-24956591 CACCTGTGGGTGTTTCTCCTTGG + Intergenic
1108661816 13:52594797-52594819 TACCTGTGGCAGCTCTACCTTGG + Intergenic
1112314439 13:98348990-98349012 CGCATGTGGCTGCCTGTCCTTGG + Intronic
1112346678 13:98596029-98596051 CACCTGTTGCATCCTGCCCTTGG + Intergenic
1112437019 13:99397866-99397888 CATCTATGGCAGCCTGCCCTGGG - Intergenic
1112729718 13:102347385-102347407 CCAGTGTGGCAGCTTGTCATCGG + Intronic
1113426319 13:110211295-110211317 AACCTGGGGCAGCTTTTCCCAGG - Intronic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1114578346 14:23733569-23733591 TACCTGTGGCAACTTGACCAAGG + Intergenic
1117791574 14:59347604-59347626 CACCTGTTCCAACATGTCCTTGG - Exonic
1119293408 14:73514161-73514183 CACCTGCAGCAGCATATCCTTGG + Exonic
1119848105 14:77846073-77846095 CCCATGTGGCAGCTGGTTCTTGG - Intronic
1121045408 14:90784234-90784256 CACCTGTGTCATCATGTCATCGG + Intronic
1121965411 14:98299073-98299095 CACCTGAGGCACCTCTTCCTGGG - Intergenic
1122071046 14:99205523-99205545 CTCCTGTGTCACCCTGTCCTGGG + Intronic
1123092165 14:105746666-105746688 CACCTGTGGCTGCTTGGTCCTGG + Intergenic
1123097456 14:105773249-105773271 CACCTGTGGCTGCTCTTCCCTGG + Intergenic
1123097737 14:105774365-105774387 CACCTGTGGCTGCTTGGTCCTGG + Intergenic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1123762245 15:23441976-23441998 CACCTGTGGCAGCAGGAACTTGG + Exonic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1125796120 15:42405139-42405161 CAGCTGTGGCAGGCTGCCCTGGG - Intronic
1128515566 15:68339741-68339763 CACCTCGGGCACCTTCTCCTGGG + Intronic
1130691973 15:86089552-86089574 CATCTGAGGAAGCTTTTCCTAGG + Intergenic
1131110594 15:89762093-89762115 CACCTGGGGCACCTTGGCCAAGG - Intronic
1131206495 15:90452853-90452875 CACCTGGGGCAGCTGGGCTTCGG - Exonic
1132945174 16:2528375-2528397 CACCTGCCGCAGCTTACCCTGGG - Exonic
1133358723 16:5156607-5156629 CACATGTGTCAGGCTGTCCTGGG + Intergenic
1133644792 16:7754168-7754190 CACCTGTGGCAGGTTTGCCTGGG + Intergenic
1136352337 16:29719133-29719155 CACATGTGGGGGCATGTCCTTGG - Intergenic
1136750144 16:32628289-32628311 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1140983555 16:80135968-80135990 TACCTGTGCCATCTTGTCATTGG + Intergenic
1141280997 16:82629211-82629233 CACCTGTGCCAGCCTGGCCCTGG - Intronic
1141503519 16:84460551-84460573 CCCCTGTGCCAACTTGGCCTGGG + Intronic
1141649425 16:85385213-85385235 AGCCTGTGGCTGCTTGTCCGGGG + Intergenic
1141826815 16:86486417-86486439 CACCTGTTGCTGCGTGACCTGGG + Intergenic
1142013237 16:87727866-87727888 CAGATGTGGCAGCTGGTGCTGGG - Intronic
1203052274 16_KI270728v1_random:887488-887510 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1143303585 17:5928776-5928798 CACCTATGGCATCAAGTCCTAGG + Intronic
1143578221 17:7807567-7807589 CACCTCCCGCAGCTTCTCCTGGG - Exonic
1145814808 17:27787951-27787973 CCCCTGTGGCACCTCCTCCTTGG + Intronic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148665553 17:49371792-49371814 ATGCTGTGGCAGCTTTTCCTAGG + Intronic
1149661685 17:58337477-58337499 CACCTTTTCCAGCTGGTCCTGGG - Intergenic
1149998029 17:61415124-61415146 GCCCTGTGGCAGGCTGTCCTGGG + Intergenic
1150222973 17:63507703-63507725 CACCTCCCGCAGCTCGTCCTTGG - Intronic
1151415632 17:73960883-73960905 CCCCTGTGGCAGCTTCTGCCAGG - Intergenic
1151732732 17:75920852-75920874 CACCTGTGACACCTGGGCCTGGG - Intronic
1152342153 17:79731225-79731247 CACCAGGAGCAGCTTGTTCTGGG - Exonic
1158247887 18:55452469-55452491 CACTTGTAGCAGCATGTCCCAGG + Intronic
1159983775 18:74818275-74818297 AACCTGTGACTGCTTGTCCATGG + Intronic
1161574062 19:5046185-5046207 CACCTGTGGCAGGTCGGCCTGGG - Intronic
1162100126 19:8334282-8334304 CTCCTGTGGCAGCTTCTGCCGGG - Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1165090023 19:33381408-33381430 CTCCTGGGACAGCTTCTCCTGGG - Exonic
1166838457 19:45681857-45681879 CACCAGCCGCGGCTTGTCCTCGG + Exonic
1168101055 19:54141190-54141212 CCACTGTGGCACCTTCTCCTGGG + Intronic
1168393952 19:56032678-56032700 CACCTGCGGCAGCTGGACCTGGG + Exonic
1168461101 19:56559355-56559377 CACCTGTGGGCGTTTTTCCTTGG + Intergenic
1168524677 19:57079274-57079296 CACCTGCGGCAGCTGCTCCATGG - Intergenic
1202711504 1_KI270714v1_random:21805-21827 CACCCCCAGCAGCTTGTCCTTGG - Intergenic
927096422 2:19750828-19750850 CACCTGTGGCAGCTGAGCCCTGG + Intergenic
928275475 2:29896581-29896603 CACCTGTGGCACCTTAACCTTGG + Intronic
932579262 2:72982998-72983020 CACCTGTGGCAGCTTGTCCTGGG - Intronic
932800218 2:74735165-74735187 CACAAGTGGCAGCTTTACCTGGG - Intergenic
932895174 2:75632395-75632417 CACCTGTGTCCAATTGTCCTGGG + Intergenic
937142652 2:119615178-119615200 CACATGTGCCTGCATGTCCTGGG - Intronic
938685091 2:133730401-133730423 CACTGGTTGCAGCTTGTTCTTGG - Intergenic
939241191 2:139561970-139561992 CTCTTGTGGCACCTTGTCTTGGG - Intergenic
942885003 2:180912431-180912453 CTCCTGTGTCAGATTCTCCTTGG - Intergenic
948387063 2:237587331-237587353 CATCAGGGGCAGCTGGTCCTGGG + Intronic
948585199 2:239014962-239014984 CACCTGTGGCAGTGTGGCCAGGG + Intergenic
948685996 2:239670092-239670114 CACCTGTGGCAGCTTTGCAGCGG - Intergenic
1168842290 20:917128-917150 GTCCTGGGGCAGATTGTCCTGGG + Intergenic
1171533969 20:25869794-25869816 CTACTGTGGCATTTTGTCCTGGG + Intergenic
1173802043 20:45899939-45899961 CACCTCTGGCAGGTAGGCCTGGG - Intronic
1174773457 20:53322670-53322692 CCCCAGTGGCAGCTTGGGCTTGG - Intronic
1175117124 20:56690566-56690588 CACCTGTGCCACCTTCTCCTAGG + Intergenic
1175258551 20:57661413-57661435 CACCTTGGGCAGGGTGTCCTGGG - Intronic
1175537580 20:59725624-59725646 CACTGGTGCCAGCTTCTCCTGGG - Intronic
1177026844 21:15931522-15931544 CATCTGTGCCAGTTTGTTCTTGG + Intergenic
1177300979 21:19245304-19245326 CTCCTGAGGCAGCTGGTCCGAGG + Intergenic
1179171882 21:38979577-38979599 CACCTGTGACAGCTCCTTCTGGG + Intergenic
1179770556 21:43612294-43612316 CACCTGTGTCATCCTGGCCTCGG - Intronic
1181478569 22:23183045-23183067 CACCTGTGGGTGCTTATCCTTGG - Intronic
1181762331 22:25067096-25067118 CACTGGGGGCAGCTTCTCCTGGG + Intronic
1182350864 22:29698732-29698754 CACCTCTGGCCCCTTGTCTTTGG + Intergenic
1183947679 22:41335972-41335994 GTCCTGTGGCTGCTGGTCCTGGG + Intronic
1185088760 22:48754700-48754722 CAGCTGAGGCAGGCTGTCCTGGG + Intronic
949950915 3:9228133-9228155 CACCTGCTGCTGCTTGTCATTGG - Intronic
950888894 3:16385753-16385775 CACCTCTGGCAGATTTTCCTTGG + Intronic
957593186 3:82226067-82226089 GATCTGTGGCAGCTGGTGCTGGG + Intergenic
957769225 3:84667384-84667406 TAAATGTGGCACCTTGTCCTTGG + Intergenic
960162994 3:114370785-114370807 CACCTGTGGTAGCTCATACTCGG + Intronic
962967201 3:140366042-140366064 CTCCTGTGTCAGCTTGTCCTTGG - Intronic
963344290 3:144075332-144075354 CACATGTGGCCCCTTGACCTTGG + Intergenic
963905164 3:150767566-150767588 CACCTGTGGCACCTTGACCTTGG - Intergenic
965148698 3:164942013-164942035 CACCTGTGGTACCTTGACCTCGG + Intergenic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
967336721 3:188352331-188352353 CACCTTTGGCAGCTTGTGAGCGG + Intronic
969547247 4:7838668-7838690 CATCTGAGGCTGCTGGTCCTTGG + Exonic
972420076 4:38878771-38878793 CAGAGGTGGTAGCTTGTCCTGGG + Intronic
973784753 4:54324331-54324353 TACCAGTGACGGCTTGTCCTGGG + Intergenic
974926932 4:68310907-68310929 CAGGTGTGGCATCTTGCCCTTGG - Exonic
978352163 4:107831399-107831421 CACCTGTGGAAGCTGCTCCAGGG - Intronic
985592600 5:773420-773442 CACGCCTGGGAGCTTGTCCTTGG - Intergenic
986648525 5:9941707-9941729 CCTCTGTGGCTGCTTCTCCTTGG + Intergenic
989049127 5:37301296-37301318 CATCTTTGGCAGCTTGTCACTGG - Intronic
989554314 5:42774488-42774510 CCCCTAAGGCAGCTTATCCTCGG - Intronic
991457246 5:66817053-66817075 CACCTGGAGTATCTTGTCCTGGG + Intronic
994509309 5:100684032-100684054 GCCCTGTGGCAGATTGTCCGGGG + Intergenic
996602921 5:125287790-125287812 CACCAGAGGCACCTTTTCCTTGG - Intergenic
997672837 5:135690573-135690595 CACCTGTCCCTGCTTTTCCTTGG + Intergenic
998580433 5:143368847-143368869 CAGCTGTGGCCCCTTGACCTTGG - Intronic
998589789 5:143464869-143464891 CACCTGGGGCCACTTGACCTGGG + Intergenic
998617967 5:143761694-143761716 CACCTTTGGCAGCTCCTTCTGGG - Intergenic
1004207930 6:13609748-13609770 GACATTTTGCAGCTTGTCCTAGG + Intronic
1007211629 6:40197237-40197259 CCCCTGTGTCAGCTTGTCCTTGG - Intergenic
1007414573 6:41684199-41684221 CATCTGAGGCAACTGGTCCTGGG - Exonic
1010836110 6:80588949-80588971 GGACTGTGGCAGCTGGTCCTGGG + Intergenic
1013471558 6:110471026-110471048 CGCCTGTGACAGCATCTCCTAGG + Intronic
1016067099 6:139695382-139695404 CATCTGTGGGAGCTTGTACACGG + Intergenic
1018911645 6:168104267-168104289 CACCTGTGTCAGTTTCTCCTCGG + Intergenic
1019393789 7:805510-805532 CACCTTTGCCCTCTTGTCCTGGG - Intergenic
1020258943 7:6519932-6519954 CACCTGTGGGCACTTGTCATGGG - Intronic
1025871721 7:65440605-65440627 CACCTGTGGCAGCATCTTCATGG + Intergenic
1026671707 7:72396579-72396601 CACATGTGGCAAGTGGTCCTTGG + Intronic
1028502926 7:91538948-91538970 CACCTCTGGGAGCATGTCATGGG - Intergenic
1029949691 7:104570314-104570336 CTCATGTGTCAGCTTTTCCTTGG + Intronic
1031126144 7:117775340-117775362 CACCTCTGGCATATTGTCCAAGG - Intronic
1031815778 7:126433395-126433417 CAACTGTGACAGCTTCTCCTGGG + Intergenic
1032206000 7:129866048-129866070 CACCTGAGGCAGCCTGTGCCCGG + Intronic
1033359033 7:140624631-140624653 CTCCTGTGACAGCTTCTCCATGG - Intronic
1033806256 7:144957361-144957383 CAGCTGTGGCATCTGGTGCTGGG + Intergenic
1035227414 7:157441397-157441419 GACCTGTGGCAGGCTGTTCTGGG + Intergenic
1035566152 8:642863-642885 CACCTGTGGCAGGCAGTTCTGGG + Intronic
1035840820 8:2810454-2810476 CCCATTTGGCAGCATGTCCTGGG - Intergenic
1036377461 8:8213283-8213305 CCCCTGTGTCAGCCGGTCCTTGG + Intergenic
1036852095 8:12209865-12209887 CTCCTGTGTCAGCCGGTCCTTGG - Intergenic
1036873462 8:12452387-12452409 CTCCTGTGTCAGCCGGTCCTTGG - Intergenic
1036968753 8:13330323-13330345 CACCTCTGCCAGGTTGTGCTGGG - Intronic
1037417175 8:18664557-18664579 CACCGGTTGCAGCTTTACCTTGG - Intronic
1037819512 8:22128943-22128965 CACAAGTGGGAGCATGTCCTTGG + Exonic
1038707156 8:29905252-29905274 GAGCTGTGGCTGCTTTTCCTCGG - Intergenic
1039615322 8:38950914-38950936 CACCTGTGGCTTCTTCTCCAGGG - Exonic
1042191754 8:66194234-66194256 CACCTGTGTCAGGTTGACTTTGG - Intergenic
1043360707 8:79468689-79468711 CGCCTGTGGGAACTTGACCTAGG + Intergenic
1044183718 8:89226349-89226371 CACCTTTTACAGCTTGTCCTTGG - Intergenic
1045238311 8:100375575-100375597 CACCTGTGGGACCTTGACCTTGG + Intronic
1048162562 8:132034604-132034626 CAAATGTGGCAGCTGGTCCAGGG - Intronic
1048287049 8:133150092-133150114 CAGCTATGGCAGGTTGTCCAGGG + Intergenic
1049717526 8:144099954-144099976 CACCTGAGGCAGATCTTCCTAGG - Exonic
1056145462 9:83724372-83724394 CAACTCTGGCAGCTAGGCCTTGG - Intergenic
1056896605 9:90556656-90556678 CACTTCTGGAAGCTTGTACTTGG + Intergenic
1056935500 9:90912598-90912620 AGCTTGTGGCAGCTGGTCCTGGG - Intergenic
1058529344 9:105890307-105890329 CTCTTGTGGCTGCTTGTTCTTGG + Intergenic
1060584848 9:124779569-124779591 CACCAGCCCCAGCTTGTCCTGGG - Intronic
1060588495 9:124801499-124801521 CACCTGAAGCAGCTTCTCCTTGG - Exonic
1060941610 9:127545916-127545938 CCACAGTGGCAGCTTGTTCTGGG + Intronic
1061482192 9:130902800-130902822 CCCTTGTGGCTGCTGGTCCTGGG + Exonic
1062376360 9:136263619-136263641 CACCTGCTGCAGCTTGGCCTGGG + Intergenic
1189229620 X:39442125-39442147 AATCTGTGGCATCTTGTTCTTGG - Intergenic
1190341798 X:49303026-49303048 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190344007 X:49321414-49321436 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190345101 X:49330959-49330981 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190346195 X:49340525-49340547 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190347447 X:49531554-49531576 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190348548 X:49541110-49541132 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190349649 X:49550666-49550688 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190350753 X:49560219-49560241 CTGCTGTGGGAGCATGTCCTTGG + Intronic
1190351854 X:49569777-49569799 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190352955 X:49579326-49579348 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190354056 X:49588873-49588895 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190355158 X:49598397-49598419 CTGCTGTGGGAGCATGTCCTTGG + Intronic
1190444418 X:50508819-50508841 CATCTGTGCCATCTTGTCTTTGG - Intergenic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1196442431 X:115728723-115728745 CACCTGCGGGACCCTGTCCTTGG + Intergenic
1196443126 X:115732181-115732203 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196445447 X:115844096-115844118 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196446118 X:115847077-115847099 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196446789 X:115850058-115850080 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196447457 X:115853041-115853063 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196448128 X:115856020-115856042 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196448797 X:115859011-115859033 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196449468 X:115862002-115862024 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196450137 X:115864985-115865007 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196450807 X:115867970-115867992 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196451478 X:115870949-115870971 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196452149 X:115873936-115873958 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196452819 X:115876905-115876927 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196453489 X:115879898-115879920 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196454158 X:115882907-115882929 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196454825 X:115885896-115885918 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196455239 X:115887978-115888000 CACCTGCGGGACCCTGTCCTTGG - Intergenic
1196463825 X:115953232-115953254 CACCTGTGGGACCCTGTCCTTGG + Intergenic
1196464465 X:115958451-115958473 CACCTGCGGGACCCTGTCCTGGG + Intergenic