ID: 932591245

View in Genome Browser
Species Human (GRCh38)
Location 2:73069205-73069227
Sequence TCTGACTTGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932591240_932591245 5 Left 932591240 2:73069177-73069199 CCCTTGATCAGATCTGCACTGTT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 333
932591241_932591245 4 Left 932591241 2:73069178-73069200 CCTTGATCAGATCTGCACTGTTG 0: 1
1: 0
2: 1
3: 9
4: 122
Right 932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932591245 Original CRISPR TCTGACTTGCAGAAAGAGGA AGG Intronic
900507732 1:3038126-3038148 GGTGACTTGGAGAAAGGGGAGGG + Intergenic
903375585 1:22863753-22863775 TCTGAATGGCAGAAAGAGCCAGG - Intronic
903513221 1:23892108-23892130 CCAGACTTGCAGAAAGAGGTTGG + Intronic
904370848 1:30046512-30046534 TGTGACTGGGAGGAAGAGGATGG + Intergenic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
909454754 1:75837741-75837763 TCTAGCTTGCATAAAGAGGGTGG - Intronic
910029110 1:82694757-82694779 TATGTGTTGCAGAATGAGGAGGG - Intergenic
911272054 1:95814238-95814260 TCAGACTATCAGAAAGAGTATGG - Intergenic
912168744 1:107071566-107071588 TCTGGCTTGAACAAAGAGGTAGG - Intergenic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
912635207 1:111285572-111285594 TGTGACTTGAAGGATGAGGAAGG + Intergenic
913098299 1:115540349-115540371 TCTGTACTGCAGACAGAGGATGG - Intergenic
915412517 1:155713257-155713279 CCTCCCTTGCAGAAACAGGAGGG - Intronic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
917231860 1:172846128-172846150 TCTGACTTGCACAAATTGGGAGG + Intergenic
918586234 1:186192177-186192199 GATGACTAGCAGAAAGGGGAAGG + Intergenic
918703741 1:187636759-187636781 TCTGAACAGCAGAAAGAGGGTGG + Intergenic
919814976 1:201431493-201431515 TCTTTCTTGCACAGAGAGGAGGG - Intergenic
919818745 1:201459443-201459465 TCTGACCATCAGAGAGAGGAGGG - Intergenic
920022827 1:202968066-202968088 GCTGAATTGCAGCAAGAGAATGG + Intergenic
920414672 1:205790934-205790956 TCCCACTCGCAGAAAGAGTAAGG - Exonic
921294483 1:213689166-213689188 TCTAACATCCAGAAAGAGGGAGG - Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
923220882 1:231891882-231891904 TCTGCATTGTAGAAAGGGGAAGG - Intronic
923753626 1:236770355-236770377 ACTGACATCCAGCAAGAGGAGGG - Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1063843318 10:10096558-10096580 TCTGACTAGTAGAAATATGAAGG + Intergenic
1063969102 10:11368844-11368866 TCTGAATTGGGGGAAGAGGAGGG + Intergenic
1064691486 10:17923177-17923199 TCTGACTTTCAGAAAATTGAGGG - Intergenic
1066270311 10:33816080-33816102 TCTGCCTTGCAGAAAAAGGTCGG + Intergenic
1066586618 10:36943517-36943539 TCTGATTTCCTGAATGAGGAAGG + Intergenic
1067241840 10:44503116-44503138 ATTGACTTGCAGGAACAGGAAGG + Intergenic
1068121223 10:52783906-52783928 TATGACTAACAGAAAGAGGTGGG + Intergenic
1070192078 10:74120521-74120543 TCTGTCTTGCAGCAGGGGGAAGG - Intergenic
1070827483 10:79399633-79399655 TCTGACTTCCAGAGTGAGGCTGG + Intronic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1072825492 10:98601999-98602021 CATGACTTTCTGAAAGAGGAAGG + Intronic
1073737738 10:106368760-106368782 TGTGACTTGAGGAAAGAGGATGG - Intergenic
1076032726 10:127173236-127173258 TCTGTCCTGCAGACAGGGGATGG - Intronic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1081170775 11:39867788-39867810 TCAGTCTTGCAGAGAGAGGCAGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1083830030 11:65225642-65225664 TCTCCCTCGCGGAAAGAGGAAGG - Intergenic
1084919879 11:72460332-72460354 TCAGCCTTGCTGAGAGAGGAGGG + Intergenic
1086116256 11:83254269-83254291 TATGACTTCCAGAAACAGGCAGG - Intronic
1087231599 11:95672241-95672263 TCTGCCGTGCAGAAAGGAGAAGG - Intergenic
1087296668 11:96385287-96385309 TCTGGCTTTAAGAAAGAAGATGG + Intronic
1087706243 11:101495881-101495903 GCTGACTGTGAGAAAGAGGAAGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1091964315 12:4725027-4725049 TCTAACTTGTAGAAAGATGCTGG + Intronic
1093490138 12:19696494-19696516 TCTGATTATCAGAAAGAGGCAGG - Intronic
1094605509 12:31945608-31945630 ACTGCCATGCAGAAAAAGGAGGG + Intergenic
1095121734 12:38426939-38426961 TATGAATTTCTGAAAGAGGAAGG + Intergenic
1095661344 12:44740786-44740808 TCTGAATTTTAGAAAGAGGCAGG + Intronic
1097178463 12:57157005-57157027 TCTGACATGCAGGGAGATGAAGG + Intronic
1098064240 12:66595326-66595348 TATGACTTTAAGAAAAAGGAAGG + Intronic
1098190273 12:67940747-67940769 ACTGACTGGCACAAAGTGGATGG - Intergenic
1100627225 12:96347550-96347572 TCTGTCTCACAGAAAGGGGAAGG + Intronic
1101372319 12:104140605-104140627 GATGACTTGGTGAAAGAGGAAGG + Intergenic
1101533487 12:105595956-105595978 TCTGAATTGCTGAAAGAGCTTGG + Intergenic
1102585300 12:113918767-113918789 TCTGGCTTGCAGAGAGAGTTGGG + Intronic
1102899678 12:116626585-116626607 GCCCACTTACAGAAAGAGGATGG + Intergenic
1103913529 12:124364524-124364546 TCTCAGTAGCAGACAGAGGAAGG - Intronic
1104188477 12:126455206-126455228 ACTGACTTGCAGGAAGCTGAGGG + Intergenic
1104365037 12:128168921-128168943 ACTGACTCCCAGAAAGAGGAGGG + Intergenic
1104896704 12:132168386-132168408 TGTGACTTGCAGAAAGCCCATGG - Intergenic
1106321913 13:28647972-28647994 TCTGACTGGTAGAGAAAGGAAGG + Intergenic
1106644542 13:31617924-31617946 TCTGACTGCCAGAAAGAACAGGG + Intergenic
1106749691 13:32749258-32749280 ACTGACTTGCAGAAAGGGTTAGG - Intronic
1107970208 13:45634051-45634073 TCTGACTGGCAGGGAGAGAAAGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110692667 13:78449903-78449925 TTTGAATTGCAGAAAAAGCATGG - Intergenic
1112520284 13:100088986-100089008 CCTAACTTGCGGAAAGGGGAGGG - Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1114146062 14:19979652-19979674 GCTGAATAGCAGAAAAAGGATGG + Intergenic
1116304132 14:43228814-43228836 TCTGTCTTACAGAAAAAGTATGG - Intergenic
1117033305 14:51698708-51698730 TCTGACTGGAAAAAAGAGAAGGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118006659 14:61569496-61569518 TCAGCCTTCAAGAAAGAGGAGGG - Intronic
1118518414 14:66552757-66552779 TCTGACTTCCAGTGAGAGGCTGG + Intronic
1119699459 14:76743287-76743309 TCAGACTGGTGGAAAGAGGAAGG - Intergenic
1119936679 14:78598407-78598429 TCTGACTTCCAGAAATAGGAAGG - Intronic
1120625806 14:86824710-86824732 CCTGATTTTCAGAAAGATGAAGG + Intergenic
1121835703 14:97090188-97090210 TCTGACTAGCACAAAGTGTAAGG - Intergenic
1122401460 14:101469824-101469846 TCTGACCTGAAGCAAGAGCAAGG + Intergenic
1122416731 14:101553414-101553436 TCTGGCTTGCACAATGGGGAGGG - Intergenic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1126376454 15:48001718-48001740 TCAGACATGCAGAAAGAAGGAGG + Intergenic
1126940858 15:53763514-53763536 AGTGACTTGCAGTAGGAGGAAGG - Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1130108451 15:80946187-80946209 TCTGAGCTGCAGGAAGAGCATGG - Intronic
1130513192 15:84605835-84605857 CCTGGCTTGCAGAAAGAGCTTGG - Intronic
1131071520 15:89469475-89469497 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
1132220705 15:100103021-100103043 TCTGTCATCCAGAAAGAGGTGGG + Intronic
1133532812 16:6671547-6671569 TCTGAGATGCAGAAAGACTAAGG - Intronic
1133874715 16:9722988-9723010 TTAGAATTGGAGAAAGAGGATGG - Intergenic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134319147 16:13147058-13147080 TCTTATTTGCAGAAAGAATAAGG - Intronic
1134530105 16:14975868-14975890 TCTGAGTTCCAGAAAGGGGTGGG + Intronic
1135485072 16:22857319-22857341 TCTAGCTTGAAGAAAGAAGACGG - Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139866242 16:70065086-70065108 TCTGAGTTCCAGAAAGGGGTGGG - Intergenic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1140518083 16:75558941-75558963 TCTGAATTCCAAAAAGAGGAGGG + Intergenic
1141617699 16:85219746-85219768 TGTGGCTTGCAGAAGGGGGAAGG - Intergenic
1146581017 17:34039175-34039197 TCTGACTTAGAGAAGAAGGAGGG - Intronic
1146715197 17:35080114-35080136 TCTAATTTGGAGAGAGAGGAAGG - Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1149561246 17:57609345-57609367 TCTGGCTAACAGAAAGGGGAGGG - Intronic
1150116339 17:62553711-62553733 TCTGACTTAGAGAAGAAGGAGGG + Exonic
1151717695 17:75839874-75839896 TGTGGCGTGCAGAAAGAGGACGG + Exonic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157500622 18:48188088-48188110 TCTGACTTCCAAAATGAAGATGG - Intronic
1158207011 18:55004543-55004565 TCTGATTTGCAGAAATACTAAGG - Intergenic
1159182691 18:64929217-64929239 TGTGGCTTCCAGAAAGATGACGG + Intergenic
1162273110 19:9632381-9632403 TCTGAATGGCTGAAAAAGGATGG + Exonic
1163785041 19:19270609-19270631 TCAGACATGCAGAATGAGGCAGG - Intronic
1164598733 19:29547226-29547248 TCTGAATTGCAGAAAAACAATGG - Intronic
1164767011 19:30780022-30780044 TATGCCTTGCAGAGAGTGGATGG - Intergenic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167767416 19:51492690-51492712 CTTGACTTGCAGACAGAGGGAGG + Intronic
924961056 2:35036-35058 TCTGACATGAAGTAAGTGGATGG - Intergenic
925345570 2:3169900-3169922 TCTTCCTTACAGAAAGAGAAAGG + Intergenic
926071629 2:9898603-9898625 AATGACTTACAGAGAGAGGAAGG - Intronic
926398591 2:12471139-12471161 TGTGCTTTGAAGAAAGAGGAAGG + Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927178026 2:20424050-20424072 ACTGACTTGCAGAGAGATGCAGG + Intergenic
928455263 2:31415009-31415031 TCTGTCTTGCAGCAAGTGGGAGG - Intergenic
928478453 2:31655444-31655466 ACTGACTTCCAGGCAGAGGATGG + Intergenic
930303011 2:49640601-49640623 TCTGAGTTGCTTAAAGAGAAGGG + Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933587582 2:84196068-84196090 GCTGACTACCACAAAGAGGAGGG + Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
935316610 2:101841165-101841187 TGTGACTTGAAGAGAAAGGAAGG - Intronic
936292059 2:111233786-111233808 TCCAACTTGAAGAAAGAGCAAGG - Intergenic
936578619 2:113676110-113676132 TCTGAATCCCAGGAAGAGGAGGG - Intergenic
937028789 2:118720966-118720988 TCTGACCTAGAGATAGAGGAAGG - Intergenic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937268632 2:120633130-120633152 GCTGACATCCAGAAAAAGGAGGG + Intergenic
937306891 2:120877139-120877161 TCTGACCTGCTGGAGGAGGAGGG - Intronic
937335864 2:121062108-121062130 TCTGACCTCCAGAAAGAGCGGGG - Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
938408630 2:131046272-131046294 GCTCACTTGCAGGCAGAGGAAGG - Exonic
938635128 2:133216339-133216361 TCTGGACTGCAGCAAGAGGATGG + Intronic
939714156 2:145562098-145562120 TCTGACTCTCAGAAATAGGACGG - Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
942737900 2:179137376-179137398 TCTAACCTGGAGAAAGAGTATGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
947330532 2:229025113-229025135 GCTGATTTGCATACAGAGGAGGG + Exonic
947814671 2:233028416-233028438 TCTGAATTCCAAAAGGAGGAAGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948087576 2:235264404-235264426 TTTGCTTTGAAGAAAGAGGAAGG + Intergenic
948154911 2:235773480-235773502 TCTGCCTTGCAGAAAAGGCAGGG + Intronic
948444106 2:238018896-238018918 TGTGACTTCAAGAAATAGGAAGG + Intronic
1169215126 20:3789109-3789131 TGGGACTTACAGAAAGAGGTGGG - Intronic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1169417416 20:5429383-5429405 CCTGACTGGGAGAAAGAGGCAGG - Intergenic
1169469441 20:5871566-5871588 TCTGAATGGCAGAAAGAAGATGG + Intergenic
1169597665 20:7218946-7218968 TCTGACTAGCATCTAGAGGATGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171090508 20:22281675-22281697 TCTGCCTTGCACAAGGAGGAAGG - Intergenic
1172259747 20:33552805-33552827 TATGACTAGCAGAAAGAAGCAGG - Intronic
1172573838 20:35991665-35991687 TCTGACTGGCAGAAAGCGGGGGG + Intronic
1173032943 20:39379101-39379123 TCTGCCTGCCAGGAAGAGGAAGG + Intergenic
1173216104 20:41085944-41085966 TCTGACCTCTAGAAAGAGGCAGG - Intronic
1174387380 20:50195148-50195170 TCCGACATCCAGAAACAGGAGGG + Intergenic
1174765207 20:53247103-53247125 TCTGACTTTCAGACAGAGGAGGG + Intronic
1175138821 20:56844449-56844471 TCTGAGTTGAAGACACAGGAAGG - Intergenic
1175332253 20:58173346-58173368 TCTGATTTGCCCAAAGAAGATGG + Intergenic
1175572173 20:60031944-60031966 ACTGACTTAAAGAAAGAGGCAGG - Intronic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1176964251 21:15193992-15194014 TCTGGCTACCAGAAAGTGGAAGG + Intergenic
1177242452 21:18477060-18477082 TCTGACTTGCAGAGTAATGAGGG + Intronic
1178062239 21:28864793-28864815 TCTGTCTTTCAGAGAGAGGTAGG - Intergenic
1178083750 21:29092591-29092613 TGAGACTTCCAGAAAGTGGACGG - Intronic
1178309463 21:31517722-31517744 TCTGGCTTGCAGGAAGAAAAAGG - Intronic
1178438425 21:32579537-32579559 CCTGATTTGAAGAAACAGGATGG - Intronic
1179600531 21:42474654-42474676 TCTGACTTGCACAGGGAGGGTGG - Intronic
1182309573 22:29395029-29395051 TCTGAGTATCAGAAAGGGGAAGG - Intronic
1183734965 22:39639726-39639748 TCAGACCTGCAGAGAAAGGAGGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184517357 22:44970862-44970884 TCTGACTAGCAGAAAATGGGGGG + Intronic
1184518262 22:44976572-44976594 TATAACTTGCAGAAACAAGACGG - Intronic
1184800941 22:46758885-46758907 TCTGCTTTCCAGACAGAGGAAGG + Intergenic
949159413 3:861640-861662 TCTGTCTTGCAGAAAGACCTGGG + Intergenic
949233407 3:1778023-1778045 TCTCTCTTGCAGAAAGAGAGGGG - Intergenic
950080190 3:10216447-10216469 TCCAGCTGGCAGAAAGAGGAAGG + Intronic
950573830 3:13818907-13818929 TCTGACTTGCAGCGGGAGGGTGG + Exonic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
952888852 3:38028238-38028260 TCTGGCCTGAAGAAAGAAGAGGG + Intronic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
955219479 3:57011874-57011896 TCTGATTTGCACTATGAGGAAGG + Intronic
956045146 3:65188201-65188223 TCTGACTTGCTGGTAGAGCACGG - Intergenic
956186205 3:66564741-66564763 TCAGACCTGCGGAAAGAGGGGGG - Intergenic
956340096 3:68212773-68212795 TCAGAGTTGGAGAAAGGGGATGG + Intronic
957406640 3:79780445-79780467 TCTGTCTTGCAGAAAGACATGGG + Intergenic
957607800 3:82426122-82426144 TCTGAATGGTGGAAAGAGGAGGG - Intergenic
959839534 3:110958686-110958708 TCTGCCTTGCAGAAAGACAGAGG - Intergenic
961327998 3:126121696-126121718 TCTGACTCTCAGTAAGAGCAGGG + Intronic
961938958 3:130617438-130617460 GCAGGCATGCAGAAAGAGGATGG + Intronic
962248432 3:133818949-133818971 TCTGGATAGCAGAAAGGGGAAGG + Intronic
962347626 3:134630159-134630181 TCTGGCTTGCAGAGTGAGAAAGG + Intronic
962426982 3:135278879-135278901 TGTGACTTTCTGGAAGAGGAAGG - Intergenic
962842651 3:139249924-139249946 ACTGAATTCCAGAAAGAGAAAGG - Intronic
963834664 3:150046057-150046079 TCTGGTTGGCACAAAGAGGATGG + Intronic
964069151 3:152610957-152610979 TCTCTCTTGCAGAGAGAGAAGGG - Intergenic
965436166 3:168654743-168654765 TCTATCTTGCAGAATGAGAAAGG + Intergenic
966491778 3:180535632-180535654 TCTGACTTGGAGAAATAAAAAGG - Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967703659 3:192623574-192623596 TTTGTTTTGCAGAAAGAGCAAGG + Intronic
968799463 4:2732722-2732744 TCTGCCTGGCACACAGAGGATGG - Intergenic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969681997 4:8648347-8648369 TCTGAGTTGCCCAAAAAGGAGGG - Intergenic
970316219 4:14830712-14830734 TCTGACTTAAAAAAAAAGGATGG - Intergenic
971138104 4:23892290-23892312 TCTCACTATCACAAAGAGGATGG + Intronic
971960085 4:33474676-33474698 TGGGACCTGGAGAAAGAGGATGG - Intergenic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
973164355 4:47058258-47058280 ACTGACCTGTAGAAAGAGGCAGG + Intronic
973309514 4:48693397-48693419 TGGGACCTGCAGAAAGAGGGTGG + Intronic
974335940 4:60544416-60544438 TCTGATTTGTAGAGATAGGAAGG - Intergenic
974989024 4:69062200-69062222 CCTGACTTGGAGAAAGACCATGG - Intronic
975279852 4:72548786-72548808 TGTGACTCGCAGAAAGAGTATGG + Exonic
975639488 4:76485083-76485105 TCTGAATTGTTGAAACAGGATGG - Intronic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
975858047 4:78645879-78645901 TGTGACTAGAAGAGAGAGGAAGG + Intergenic
975859194 4:78658240-78658262 TCTGAGTGACAGAAACAGGAAGG - Intergenic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
977004690 4:91550202-91550224 TCTTGCTTCCAGCAAGAGGAGGG - Intronic
978106389 4:104906685-104906707 TTTGACTTGCAAAAAAAGGAGGG - Intergenic
978859423 4:113430804-113430826 GCTGACTGGAAGAAAGCGGAAGG - Intergenic
981010622 4:139921476-139921498 TGGGGCTTGCAGAAAGAGGGAGG + Intronic
982614650 4:157625262-157625284 TCTGAATTCCAAAGAGAGGAGGG + Intergenic
983090075 4:163493085-163493107 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
983330671 4:166323899-166323921 TATGACTTGCCAAAAGAGAAAGG + Intergenic
984210260 4:176838828-176838850 TGTGACTTGCACAGACAGGAAGG + Intergenic
985332613 4:188856436-188856458 TCTGGCCTGGATAAAGAGGATGG + Intergenic
986185540 5:5433069-5433091 TCTGTCTTCCAGGAAGAAGAAGG - Intronic
986924108 5:12724951-12724973 TCTGCCTAGCAGAAAGACTATGG + Intergenic
987244842 5:16038147-16038169 TCTTAGTGGGAGAAAGAGGAGGG + Intergenic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
989106888 5:37871298-37871320 TCTGTGTTGCAGAACCAGGAAGG - Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990776599 5:59311586-59311608 TCTGTCTTGCAGATAGATAACGG + Intronic
992145166 5:73839644-73839666 TCTGAATGGCAGAGAAAGGACGG - Intronic
993316369 5:86411356-86411378 TCTGATGTGGAGAAATAGGAAGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
993899355 5:93573783-93573805 GCTGTCTTTCAGGAAGAGGAAGG - Intergenic
993949243 5:94153330-94153352 TGTGACTTGAACCAAGAGGATGG + Intronic
994371749 5:98975631-98975653 ACTGACTAGCACCAAGAGGATGG + Intergenic
994879301 5:105466725-105466747 TATGAGTTTCAGGAAGAGGAAGG + Intergenic
995111412 5:108432805-108432827 TCAGGCTTGCAGAAAGAACAGGG + Intergenic
995737739 5:115320588-115320610 CTTGACTTGCAGAAATAGCAGGG + Intergenic
998167860 5:139854762-139854784 TCTGATGTGCTGAAAGATGACGG - Intronic
998821563 5:146062412-146062434 TTTGACTTGCTGCAAGAGAAAGG - Exonic
999127589 5:149257968-149257990 TCAGGCATGCAGAAAGCGGAGGG + Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
1001919300 5:175587858-175587880 TCTGACTTGCAGGCAGTGGCAGG + Intergenic
1002529009 5:179832698-179832720 ACTGAATTGGAGAAAGAGAAAGG + Intronic
1002566766 5:180116515-180116537 TCTAACTTCCAGAGAGAGGCGGG - Intronic
1002859081 6:1064192-1064214 CCTGACTTGGAAAAGGAGGAAGG - Intergenic
1004089146 6:12482033-12482055 TGTGACATGCAGAAAGCTGATGG + Intergenic
1005575260 6:27184101-27184123 TCTGAATGGCCGAAAAAGGATGG + Intergenic
1005614269 6:27557707-27557729 TCTGACGTGAAGGAAGAGGTAGG - Intergenic
1007043083 6:38743367-38743389 TCAGACTTGCAAAAAAAGAAAGG - Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1009459444 6:63894531-63894553 TCTGACTTCCAGAACTGGGAGGG + Intronic
1011763336 6:90592163-90592185 TCTAGCTTGCAGAAAGCAGATGG + Intergenic
1013078299 6:106790283-106790305 TAGCACTTGAAGAAAGAGGATGG + Intergenic
1014705596 6:124742527-124742549 TCTGACTTGCAGACAGCCAATGG + Intronic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1017212936 6:151876753-151876775 TTTGACTGGCAGGAAGTGGAGGG - Intronic
1017214314 6:151892672-151892694 TCTGCCTTGTGGAAAGAGAAAGG + Intronic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1018630442 6:165817349-165817371 CCTGGCTTGCAGCAAGGGGAGGG + Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019798465 7:3070037-3070059 TCTGGCCTCCAGAACGAGGAGGG - Intergenic
1019867603 7:3727469-3727491 TCTCCCTGGCAAAAAGAGGATGG - Intronic
1020927825 7:14355093-14355115 GGTGAATGGCAGAAAGAGGATGG - Intronic
1021236911 7:18153566-18153588 TCTGCCCTGCAGAAAAAGGTGGG + Intronic
1021931522 7:25585810-25585832 TCTGAATTGCAGAAAAGGGGTGG - Intergenic
1022115641 7:27258145-27258167 TTAGACTTGCAGGATGAGGAGGG + Intergenic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1022500390 7:30878887-30878909 TCTGACCTGGTGAAAGTGGATGG - Intronic
1023068031 7:36398910-36398932 TCTAAGTTGCTGAAAGAGAATGG + Intronic
1023722987 7:43113875-43113897 TCTGTCTTGCACACAGAGGCTGG + Intronic
1023799237 7:43819079-43819101 TGATATTTGCAGAAAGAGGAGGG + Intergenic
1024151407 7:46575597-46575619 TCTTACTTGAAGAGGGAGGATGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1026235577 7:68524030-68524052 TCAGACTTGCAGAAACTGTAAGG + Intergenic
1026995080 7:74610471-74610493 TCTGAGGTTCAGAAAGATGAAGG + Intergenic
1027639365 7:80714127-80714149 TTTGACGAGCAGAAAGAAGAAGG + Intergenic
1027753350 7:82180081-82180103 TGTGACATGCAGAAACATGAGGG - Intronic
1027775905 7:82463829-82463851 TCTGCCATGCAGAAAGGAGAGGG + Intergenic
1030399184 7:109027187-109027209 TCTGACTTCTGGAAAGAGAAGGG + Intergenic
1031622959 7:123957847-123957869 GCTGACTTTAAGAAAGAAGAGGG - Intronic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1033332702 7:140429375-140429397 TCTGCCTTTCAGTGAGAGGAAGG + Intergenic
1033354378 7:140587596-140587618 TCTGTCTGGGAGAAAGGGGAGGG - Intronic
1033451820 7:141468782-141468804 TCTCTCTTGCAGAGAGAGAAGGG + Intronic
1034433707 7:151053291-151053313 CCTTACTGGCAGGAAGAGGAAGG - Intergenic
1035917850 8:3644494-3644516 TCTGATTAGCAAAAAGAAGATGG + Intronic
1036298491 8:7554629-7554651 TCAGACATCCAGAAAGAAGACGG + Intergenic
1036299796 8:7562279-7562301 TCAGACATCCAGAAAGAAGACGG + Intergenic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1042319216 8:67457478-67457500 ACTGACTGGAGGAAAGAGGAAGG - Intronic
1042395457 8:68286420-68286442 TCTGAAAGGCAGTAAGAGGAAGG - Intergenic
1045065460 8:98439997-98440019 TAGGACTTGCAGGGAGAGGAGGG + Intronic
1045480708 8:102589819-102589841 TGTGGCTCGCAGAAAGAGCACGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045724431 8:105155606-105155628 TCTGACTTGGAAAAAGAGGGTGG - Intronic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1045911313 8:107413852-107413874 TTAGTCTTGCAGAAGGAGGATGG + Intronic
1048441618 8:134463339-134463361 GCTGGCTTGGAGATAGAGGAAGG + Intergenic
1049584811 8:143427988-143428010 CCTGAATTGAAGGAAGAGGAGGG - Intronic
1050010823 9:1184411-1184433 TCTGAGGTGCAGAGAGAGAAGGG - Intergenic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1051701357 9:19827648-19827670 TTTGATTTGCAGAATGAGGGAGG - Intergenic
1052388368 9:27849169-27849191 ACTGACTTGCTCAAAGAGTAGGG - Intergenic
1052985981 9:34488348-34488370 TCTGAGTTACTGAAAGAAGAAGG + Intronic
1052987685 9:34500159-34500181 TCTAACTTAAAGAAAGTGGAAGG + Intronic
1055844461 9:80544680-80544702 TTTGACTTGAAGATTGAGGAAGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1056803968 9:89713619-89713641 CCTGACTTGCAGAAACTGGGTGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059467356 9:114477508-114477530 TCTAACTTGCAGAAGGGGGCAGG - Intronic
1060325728 9:122613038-122613060 TCTGTCTCGCAGAATGAGGTTGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1185768232 X:2743742-2743764 TCTGATTTGGGGAAAGAGGTTGG - Intergenic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1189120617 X:38390508-38390530 GCTGACTGGGAGATAGAGGAAGG - Intronic
1189221177 X:39373564-39373586 GCTGCCTTGCAGCAAGGGGAAGG - Intergenic
1189516356 X:41716835-41716857 TCTGACATTCAGATAGAGTAAGG - Intronic
1189622205 X:42853859-42853881 TCAGGCTTGCAGAAATTGGAAGG + Intergenic
1189761716 X:44328585-44328607 TCTGCCATGCAGAAAAAGGTGGG - Intronic
1191865865 X:65703375-65703397 ACTGAATTTTAGAAAGAGGAAGG + Intronic
1192201644 X:69070027-69070049 TCCTACTTGTAGAAAGAGGCTGG - Intergenic
1192613679 X:72594449-72594471 TCTGACCTTCAGAAAGAAAAAGG + Intronic
1193655603 X:84193344-84193366 TCTGACTTGCAGCAACATGATGG - Intergenic
1194613237 X:96070025-96070047 TGTGACTTGCAGAAGGAGAAAGG - Intergenic
1194900334 X:99501863-99501885 GCTGACTTGAAGGCAGAGGATGG + Intergenic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1196205327 X:112933059-112933081 GCTGACTTCCAGAAAGATGGAGG - Intergenic
1198107957 X:133478945-133478967 TCCCACTTACAGAAAGAGCAAGG + Intergenic
1198703085 X:139418041-139418063 TCTTACTTCCAGAAACAGGTAGG + Intergenic
1199902961 X:152195615-152195637 TCGGATTTGAAGAAAGAGGAAGG - Intronic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1200791350 Y:7302410-7302432 ACTGACTTTCAGAGAAAGGATGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic