ID: 932594553

View in Genome Browser
Species Human (GRCh38)
Location 2:73086065-73086087
Sequence CCTTGCAGGGAGGGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932594553_932594565 19 Left 932594553 2:73086065-73086087 CCAGCCTTCCCCTCCCTGCAAGG 0: 1
1: 0
2: 9
3: 74
4: 541
Right 932594565 2:73086107-73086129 GCTGATTGAGCTCAAAGGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 969
932594553_932594562 -9 Left 932594553 2:73086065-73086087 CCAGCCTTCCCCTCCCTGCAAGG 0: 1
1: 0
2: 9
3: 74
4: 541
Right 932594562 2:73086079-73086101 CCTGCAAGGCACACAAGGCCAGG 0: 1
1: 0
2: 4
3: 31
4: 186
932594553_932594564 14 Left 932594553 2:73086065-73086087 CCAGCCTTCCCCTCCCTGCAAGG 0: 1
1: 0
2: 9
3: 74
4: 541
Right 932594564 2:73086102-73086124 ATGCTGCTGATTGAGCTCAAAGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932594553 Original CRISPR CCTTGCAGGGAGGGGAAGGC TGG (reversed) Intronic
900098795 1:952257-952279 CCTTGCAGGTGGGGGAAGGGTGG - Intronic
900142495 1:1144577-1144599 CCTGGCAGGGAGGGGAGCGCTGG - Intergenic
900243982 1:1629377-1629399 CCCTGCAGGGAGCGGCAGGCGGG + Exonic
900469831 1:2848282-2848304 CTCTGCAGAGAGGGGAGGGCTGG - Intergenic
900470740 1:2853765-2853787 CCTGGCTGGGCGGGGCAGGCAGG - Intergenic
900584109 1:3424306-3424328 CCCTGCAGGCAGGGAAAGGGAGG - Intronic
900931224 1:5739118-5739140 CCTTGCAGTTAGGGGCAGCCAGG - Intergenic
901628589 1:10637524-10637546 CCTAGGAGGGAATGGAAGGCTGG - Exonic
901633019 1:10656997-10657019 CCTGGGATGGAAGGGAAGGCAGG + Intronic
902777712 1:18685212-18685234 CAATAAAGGGAGGGGAAGGCAGG - Intronic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
903767563 1:25744454-25744476 CCAAGGAGGGAGGAGAAGGCTGG - Intronic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904512734 1:31026637-31026659 CCTTGCAGTGGGAGGAAGCCAGG + Intronic
905795333 1:40812949-40812971 TCTTTCAGAGAGGGGATGGCTGG + Intronic
905871123 1:41405154-41405176 CCTACCAGAGAGGTGAAGGCTGG + Intergenic
906145485 1:43557983-43558005 CCTAGGAGGGAGGGGAGGGGTGG - Intronic
906684539 1:47755113-47755135 CACTGCTGGGAGGGGAAGGGAGG + Intergenic
906693834 1:47810929-47810951 CCTGCCAGGGAGGACAAGGCGGG + Intronic
906879482 1:49574988-49575010 CCTTGAATGAAGGGGAAGTCGGG + Intronic
906966808 1:50465676-50465698 TCTGGCAGGGTGGGGAAGGTAGG + Intronic
907305234 1:53509470-53509492 CCCTGCAGGGAGGGGAGGGCAGG + Intronic
908743293 1:67350690-67350712 AATGGCAGGGAGGGGAAGGTGGG + Intronic
908780291 1:67684975-67684997 CGGTGCCGAGAGGGGAAGGCGGG - Intergenic
910013003 1:82488507-82488529 CTTTGCAGCAAGGGGAAGCCAGG - Intergenic
910943972 1:92568262-92568284 GCTACCAGGGAGGGTAAGGCGGG + Intronic
912368537 1:109154659-109154681 CCTGGCAGGAAGAAGAAGGCTGG + Intronic
912910416 1:113753672-113753694 CCTAGCAGGGAGGCCGAGGCAGG - Intronic
912944850 1:114076396-114076418 CCTCGCAGAGGGAGGAAGGCTGG + Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG + Exonic
914884665 1:151575039-151575061 GGTTGCAGGGAGGGGAGGGCAGG + Intronic
915243590 1:154541251-154541273 CCATGCAGGGGAGGGATGGCGGG + Intronic
915597610 1:156904464-156904486 CCATACAGGGAGGAGAGGGCAGG + Intronic
916715315 1:167442638-167442660 GCTGGCATGGAGGGGTAGGCAGG - Intronic
916958523 1:169865470-169865492 CCTGGAAGAGAGGGGAATGCTGG - Intronic
918570171 1:185981193-185981215 TGTGGCAGGGAAGGGAAGGCTGG - Intronic
920017690 1:202926993-202927015 CCTTGCAGGGAGACCAAGGATGG + Intronic
920057696 1:203204920-203204942 ACTGGCAGGGAGGGGAGGTCTGG + Intergenic
920684155 1:208096322-208096344 CCCTGCAGGCAGAGGAAGTCTGG - Intronic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
923098737 1:230795627-230795649 GCTTACAGGGCGGGGAAGGGGGG - Intronic
923288610 1:232521943-232521965 GGGTGCAGGGAGGGGTAGGCAGG - Intronic
923345326 1:233046053-233046075 CCTTTCAGGGAGAGGAAGACAGG + Intronic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923791615 1:237116147-237116169 CCCTGCAGGGAGGGGAGAGCAGG + Intronic
924707353 1:246511090-246511112 GCTTGCAGGGAGGGGTGGGGGGG + Intergenic
1062934340 10:1374890-1374912 CCACTTAGGGAGGGGAAGGCAGG + Intronic
1062955532 10:1538151-1538173 CCTGACAGGGAAGGGAAGGGAGG - Intronic
1063115421 10:3068541-3068563 CATTGCAGGGCAGGGAAGCCCGG - Intronic
1063247173 10:4233620-4233642 CCCTGAAGGGAAGGGAAGCCAGG + Intergenic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065206727 10:23364112-23364134 CCTTGCAGGTAGGGGTAGCCAGG - Intergenic
1066627815 10:37427192-37427214 TATTGAAGGGAGTGGAAGGCGGG + Intergenic
1067080722 10:43210855-43210877 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067080751 10:43210983-43211005 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067709662 10:48637817-48637839 CCTTGTTGGGAGGGGAATGTAGG - Intronic
1067850365 10:49750485-49750507 TCTTCCAGGGAAGGGAGGGCAGG - Intronic
1069819411 10:71218118-71218140 GTTTGCAGGGAGGGGAGGGTGGG + Intronic
1069871319 10:71534970-71534992 CCACACAGGGAGGGGAAGACAGG - Intronic
1071598601 10:86945158-86945180 GCTTTCCGGAAGGGGAAGGCAGG - Intronic
1072518251 10:96208025-96208047 CCTTGCAGGGTGGAGAGGGATGG + Intronic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1073146478 10:101284989-101285011 CTTTGCAGGAAGAGGAAGGGAGG + Intergenic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073435731 10:103514600-103514622 CCCTGCAGAGAGGGCAGGGCTGG + Intronic
1073451137 10:103610077-103610099 CCTTGAAGGATGAGGAAGGCTGG - Intronic
1074242629 10:111654403-111654425 ACTTGGAAGGGGGGGAAGGCAGG - Intergenic
1074792754 10:116907711-116907733 CAGCGGAGGGAGGGGAAGGCAGG + Intronic
1075388512 10:122075330-122075352 CCATGAAGGATGGGGAAGGCTGG + Intronic
1075399173 10:122149354-122149376 TCTTGCAGGGAGGAGGAAGCCGG + Intronic
1075617248 10:123899643-123899665 CCTGGGAGGAAGGGGAAGGAAGG + Intronic
1075797984 10:125134798-125134820 CCAGGCTGGGAGGGAAAGGCTGG - Intronic
1076526326 10:131114692-131114714 CCTGCCCGGGAAGGGAAGGCCGG + Intronic
1076729902 10:132433089-132433111 GCTTGAAGGGAGGGGCCGGCGGG - Intergenic
1077053825 11:580367-580389 CCTTGCAGAGTGGGAAGGGCAGG + Intronic
1077065924 11:640906-640928 CCCTGCAGAGAGGGGAAGCTGGG - Intergenic
1077108878 11:853435-853457 CCTACCTGGGAGGGGAAGGGAGG + Intronic
1077144921 11:1040495-1040517 CCTTGGAGGGAGGGTGGGGCAGG - Intergenic
1077351222 11:2094075-2094097 TGTGGCAGAGAGGGGAAGGCAGG + Intergenic
1077360922 11:2139749-2139771 CCGGGCAGGCAGGGGCAGGCGGG + Intronic
1077487761 11:2846876-2846898 GCTGGCAGGGAGGTCAAGGCAGG - Intronic
1077530675 11:3093401-3093423 CCTGGCAGGGAGGGCAGGCCTGG - Intronic
1077879369 11:6336298-6336320 CCTTTCAGAGAGTGGAAGGTTGG - Intergenic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1077993913 11:7436368-7436390 CCTTGGAGGGAGGGAAAGTGGGG + Intronic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1079393312 11:20040751-20040773 CGAGGCATGGAGGGGAAGGCAGG + Intronic
1080458481 11:32435083-32435105 CCACCCAGGGAGGGGACGGCGGG + Exonic
1081170774 11:39867784-39867806 TCTTGCAGAGAGAGGCAGGCTGG - Intergenic
1081676394 11:44972481-44972503 CCTTACAGGGATGGTGAGGCTGG - Intergenic
1081752150 11:45518828-45518850 CCTAGCAGGGAGGGGCAGGAAGG - Intergenic
1084173204 11:67410368-67410390 CCCTGGAGGGAGGGGAAGGAGGG - Intronic
1084480071 11:69415027-69415049 CCCTGCAAGGAAGGGAAGCCGGG + Intergenic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1085013477 11:73157501-73157523 CCTTGCAAGGATTGGGAGGCAGG + Intergenic
1085025486 11:73234135-73234157 CCCTGCAGGGAAGGGAGGGGTGG - Exonic
1085293672 11:75418149-75418171 CATTCCAGGGATGGGCAGGCTGG + Intronic
1085305445 11:75483068-75483090 CCTGGCAGGAAGGGGAGGGGAGG - Intronic
1085809479 11:79667345-79667367 CTGTGAAGGGAAGGGAAGGCAGG + Intergenic
1088366668 11:109047135-109047157 CTTTGCAGGGAGGGTCAGGGAGG + Intergenic
1088974031 11:114798890-114798912 CCTTTGAGGGAGGGGCAGCCAGG - Intergenic
1089053382 11:115565039-115565061 CCTGGCAGGGAAAGAAAGGCAGG + Intergenic
1089338969 11:117744884-117744906 CCTGGCATGCAGGGGAAGGTTGG - Intronic
1090440998 11:126725683-126725705 CCTTGCAGCGAGGGCAGAGCGGG - Intronic
1090608844 11:128452068-128452090 CCGTCCAGGGCTGGGAAGGCGGG + Intergenic
1090809480 11:130224083-130224105 CCTTTGAGGGAGGGTAATGCTGG - Intergenic
1090888020 11:130896550-130896572 GCTTGCATGGAGGGGAAGCATGG + Intronic
1091279114 11:134371927-134371949 TCTTGCAGGGAGGTGGAGGCTGG + Intronic
1091283965 11:134397790-134397812 CCTGGCAGAGAGGAGCAGGCAGG - Intronic
1091288969 11:134426397-134426419 CTTTGCAGGGAGGACCAGGCAGG + Intergenic
1091661230 12:2385325-2385347 CGTTGCCGGGAGAGGGAGGCAGG - Intronic
1091784205 12:3232479-3232501 AATTGCAGGGAGCAGAAGGCAGG - Intronic
1092299837 12:7236882-7236904 CCTTTCAAGGATTGGAAGGCAGG - Intergenic
1092882342 12:12897478-12897500 CCTTGCACGGAGGTGGAGACGGG + Intronic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093816069 12:23548996-23549018 TCTTTCAGAGAGGGGATGGCTGG - Intronic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1094569564 12:31629736-31629758 CAATGGAGGGAGGGGAATGCTGG - Intergenic
1094636657 12:32233073-32233095 TCTTGCTGGGAGGCCAAGGCGGG + Intronic
1095431214 12:42137016-42137038 CCTAGCAGGGAGGCAAAGGTGGG - Intronic
1097520355 12:60661311-60661333 CCTTTCAGAGAGGGGAGGGAAGG - Intergenic
1100843511 12:98636893-98636915 CCTGGCAGGGAGGGACAGGAAGG - Intronic
1101263918 12:103064615-103064637 CCTTGAAGGAAGGGGAGGCCGGG + Intergenic
1101333653 12:103777626-103777648 CCCTGCATGGGGGGAAAGGCTGG + Exonic
1101446619 12:104741354-104741376 GCTTCCAGTGAGAGGAAGGCTGG - Intronic
1102505956 12:113384780-113384802 CACTGCAGGGTGGGGAAAGCTGG + Intronic
1102524248 12:113500017-113500039 CCTTGCATGGAGGCCAGGGCTGG + Intergenic
1102609137 12:114095904-114095926 GCTGGCAGGAAGGGGAAGGGGGG - Intergenic
1102853182 12:116270386-116270408 CTTTGCGGGGAGGCCAAGGCAGG - Intronic
1102924181 12:116814372-116814394 GTTTGCAGGGCGGGGAAGGGAGG + Intronic
1103733010 12:123041284-123041306 CCTAGCAGGGTCTGGAAGGCGGG + Intronic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104674920 12:130705840-130705862 CCTTGCAGGGATGGGTAGGCTGG - Intronic
1104735487 12:131133587-131133609 CCTTCCGGGGAGGTGCAGGCAGG + Intronic
1104929295 12:132329639-132329661 CCTTGAGGGGTGGGGGAGGCGGG - Intergenic
1105704381 13:22960343-22960365 CTTTGCAGGCAGGGAAGGGCTGG + Intergenic
1105857332 13:24385395-24385417 CTTTGCAGGCAGGGAAGGGCTGG + Intergenic
1106301941 13:28474656-28474678 GCTTGCGGGGAGGGGATGGAGGG + Intronic
1106530906 13:30590444-30590466 CTTTGCGGGGAGGCCAAGGCAGG - Intronic
1106811827 13:33365499-33365521 CCTGCCAGGGAAGGTAAGGCGGG + Intergenic
1107468460 13:40669020-40669042 CCTTGCAGGGAGGCCGAGGCGGG + Intergenic
1107769465 13:43774760-43774782 CCTTGCAGTGAGAGCAGGGCTGG - Intronic
1107835245 13:44407613-44407635 CCTTGCAGGGAGGTGATGACAGG + Intergenic
1108482713 13:50890980-50891002 CATTCCAGGCAAGGGAAGGCTGG - Intergenic
1110031418 13:70619247-70619269 ACTTGAAGGGAGAGGCAGGCAGG + Intergenic
1110242705 13:73286625-73286647 CTTTTCAGTGAGGGGTAGGCAGG - Intergenic
1110310760 13:74046339-74046361 CCTTGTATGGAAGGCAAGGCAGG - Intronic
1110746985 13:79065464-79065486 CCTTGGAGGCAGGAGATGGCAGG - Intergenic
1110842797 13:80161983-80162005 CCTTCCAGGGAAGGCAGGGCAGG + Intergenic
1111650694 13:91087534-91087556 CCTGGCAGGAAAGGGAAGGAAGG + Intergenic
1112194404 13:97210981-97211003 GGTAGCAGGGAGAGGAAGGCAGG + Intergenic
1112441313 13:99426797-99426819 GCCAGCAGGGAGGGGAAGGGAGG + Intergenic
1113513419 13:110873089-110873111 GTTTGCAGGGTGGGGAAGGGAGG - Intergenic
1113535989 13:111066760-111066782 CCTTGCAGGCGCGGGAAGGGAGG + Intergenic
1113641684 13:111962257-111962279 CCTTGCAGGGATGAGAATGACGG - Intergenic
1113670161 13:112170779-112170801 CCTTGTAAGAAGGGGAAGCCTGG + Intergenic
1113814912 13:113163131-113163153 CCTTGGGGGAAGGGGACGGCCGG - Intronic
1113935492 13:113992439-113992461 CTGTGCAGCGAGGGGATGGCTGG - Intronic
1113955820 13:114099529-114099551 CCAGGCAGGGAGGGAAAGGAGGG - Intronic
1114265231 14:21069750-21069772 CCTAGCAGAGAGCGGAGGGCCGG - Intronic
1114661651 14:24349925-24349947 CCTAGCAGGCAGGAGAAGACAGG + Intergenic
1115290599 14:31767722-31767744 TCTTGCAGGGAGGCGAAAGCAGG + Intronic
1115995529 14:39191859-39191881 CCCTGAAGGGAGATGAAGGCAGG + Intergenic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1117633916 14:57722893-57722915 CCTTGAATGAAGGGGAAGGCTGG + Intronic
1117722798 14:58643812-58643834 CGTTGCTGGGAGAGGAAGGATGG + Intronic
1118550532 14:66944885-66944907 CCTGGCAGGGAGAGGAGTGCAGG + Intronic
1118900763 14:69983534-69983556 CTCTGCAGGGGAGGGAAGGCAGG + Intronic
1119054708 14:71407510-71407532 CCTGGGAGGGAGGGAAAGGAGGG - Intronic
1119148004 14:72333782-72333804 TCTGGCAGGGAGGGGATGGAGGG - Intronic
1119557769 14:75566851-75566873 GCCTGAAGGGAGAGGAAGGCAGG + Intergenic
1119849094 14:77853904-77853926 AGTGGCAGGGAGGGGAAGCCAGG - Intronic
1120973453 14:90228964-90228986 CCTTGAATGAATGGGAAGGCTGG + Intergenic
1121144654 14:91573781-91573803 GCTTGCAGGGAGCAGGAGGCTGG + Intergenic
1121144672 14:91573854-91573876 ACTTGCAGGGAGGAGGAGGCTGG + Intergenic
1121335630 14:93076125-93076147 TCTTGGAGGGAGGGGAAAGGTGG - Intronic
1121492249 14:94369000-94369022 CTTTGCGGGGAGGAGAGGGCTGG + Intergenic
1121629731 14:95413496-95413518 CCTTGCAGGGGATGGGAGGCTGG - Intronic
1121717829 14:96088807-96088829 CGGTGAAGGGAGGAGAAGGCAGG + Exonic
1122254079 14:100463986-100464008 CCATGCAGGGAGGAGAATGAAGG - Intronic
1122292573 14:100687549-100687571 GCGTGCAGGGAGGGCGAGGCGGG + Intergenic
1122632040 14:103111605-103111627 CCTGGCAGGGTGGGGCAGGTGGG + Intergenic
1122783241 14:104152563-104152585 CCCTGAAGGGAGGGGACGGCGGG + Intronic
1122854709 14:104554538-104554560 CCTTTCAGAGGGAGGAAGGCAGG - Intronic
1122854902 14:104555274-104555296 CCAGGCTGGGAGGGGGAGGCAGG + Intronic
1122875844 14:104664524-104664546 CCTAGCAGGGAGGTGAAGATGGG - Intergenic
1122961127 14:105093982-105094004 CCCGGCAGGGCGGGGAAGGCTGG + Intergenic
1123087517 14:105723659-105723681 CCATGCAGGGAAGGGACGTCTGG + Intergenic
1124066833 15:26352869-26352891 CCTTGTAGGAGTGGGAAGGCTGG - Intergenic
1124125827 15:26937519-26937541 AGCTGCAGGGAGGGGCAGGCTGG - Intronic
1124811363 15:32942163-32942185 CCTTCCAGAGTGGGAAAGGCAGG + Intronic
1125336416 15:38630815-38630837 CCTTGGAGGAAGGGCAAGCCAGG - Intergenic
1125521891 15:40352713-40352735 CAGTGCAGGGACGGGAAGGATGG - Intronic
1125731528 15:41895031-41895053 CCTGGCAGGGAGAGGACAGCAGG - Intergenic
1127582388 15:60349966-60349988 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582403 15:60350002-60350024 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582418 15:60350038-60350060 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582433 15:60350074-60350096 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582441 15:60350092-60350114 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582449 15:60350110-60350132 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582457 15:60350128-60350150 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1128301349 15:66567992-66568014 GCGAGCAGGGAGGGGAAGGGGGG + Intergenic
1128434975 15:67637768-67637790 CAGTGCAGGGAGGGGAAACCAGG - Intronic
1128495842 15:68198076-68198098 GACTGCAGTGAGGGGAAGGCAGG - Intronic
1128813811 15:70591012-70591034 CCTTTCAGAGAGTGGAGGGCGGG + Intergenic
1128999376 15:72319922-72319944 CGGTCCAGGGAGGGGACGGCGGG - Exonic
1129115826 15:73364838-73364860 CATTGCTGGGGGAGGAAGGCTGG - Intronic
1129699043 15:77757119-77757141 ACTGGTGGGGAGGGGAAGGCAGG - Intronic
1130953533 15:88610971-88610993 GCCTGCAGGGAGGGGATGACTGG + Intergenic
1131098621 15:89671411-89671433 CCTCTCAGGGAGGAGAGGGCAGG - Intronic
1131273039 15:90958236-90958258 CCATGCAGAGAGGGTGAGGCTGG + Intronic
1132205938 15:99986144-99986166 CCTTGCAGGGTGGGGCAGGGGGG + Intronic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1133380102 16:5322634-5322656 CCTTGAAGGATGGGGAAGACTGG - Intergenic
1133613577 16:7455390-7455412 TCTTGCATGGAGAGTAAGGCTGG - Intronic
1133802137 16:9092407-9092429 TCTTGCGGGGAGGGGGCGGCAGG - Intronic
1133831870 16:9330718-9330740 CAGTGCAGAGAGGGGAATGCAGG + Intergenic
1134656355 16:15950492-15950514 TGTTGCAGGGAAGGGAGGGCAGG - Intronic
1136393393 16:29979187-29979209 TCTGGCAGGGATGTGAAGGCTGG + Exonic
1136712683 16:32253225-32253247 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136755233 16:32676204-32676226 CCGTGCAGGGAGGGGGAGGGCGG + Exonic
1136812880 16:33194165-33194187 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136819356 16:33304245-33304267 CCGTGCAGGGAGGGGGAGGGCGG - Intronic
1136825919 16:33360780-33360802 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136830985 16:33459551-33459573 CCGTGCAGGGAGGGGGAGGGCGG - Intergenic
1137029339 16:35507093-35507115 CCGTGCAGGGAGGGGCAGGGCGG + Intergenic
1137274998 16:46927524-46927546 CCCTGCATGGATGGGAATGCCGG + Intronic
1137713505 16:50583492-50583514 GGTTGCAGGGGGAGGAAGGCTGG - Intronic
1137860530 16:51842017-51842039 CCTGGGTGGGAGGGGAAGGGTGG - Intergenic
1137943055 16:52707842-52707864 ACTTGGGGGGAGGGGAAGGAAGG - Intergenic
1138148941 16:54637451-54637473 CATTGCAAGGAGGGGATGGTAGG - Intergenic
1139325067 16:66146131-66146153 CCTCCCAGGATGGGGAAGGCAGG - Intergenic
1139706308 16:68743055-68743077 CCTGGCAGAGAGGGGCAGGCAGG - Intronic
1139839692 16:69868357-69868379 CCTTTCTGGGAAGGGAGGGCAGG + Intronic
1139923990 16:70475684-70475706 CCTTGCAGCGAGCCGCAGGCCGG + Exonic
1140315546 16:73893113-73893135 CCTTGCAGGGAAAGGAAGAAAGG + Intergenic
1140477352 16:75245520-75245542 CCCTGCAGGGAGGGAAAGCCCGG + Intronic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141656938 16:85421571-85421593 CCAGGCGGGGAGGAGAAGGCAGG + Intergenic
1141950344 16:87335537-87335559 CTTTGCAGGGCGGGGTAGGGCGG + Intronic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142189387 16:88710841-88710863 CCGCGCAGGGAGGTGGAGGCGGG + Intronic
1142190757 16:88716276-88716298 CCCTGCAGGGAGGTGCTGGCAGG + Exonic
1142333839 16:89473798-89473820 CCTTGCCCGGAGTGCAAGGCGGG + Intronic
1142351702 16:89583658-89583680 TCAGGCAGGGAGGGGCAGGCGGG - Intronic
1202991457 16_KI270728v1_random:17135-17157 CCGTGCAGGGAGGGGGAGGGCGG - Intergenic
1203057375 16_KI270728v1_random:936543-936565 CCGTGCAGGGAGGGGGAGGGCGG + Intergenic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142874549 17:2843650-2843672 CCTTGCAGGGTGGGGCGGGGTGG + Intronic
1143023572 17:3928780-3928802 GCTGGCGGGGAGGGGAAGGGAGG + Exonic
1143364425 17:6396591-6396613 CCTTGCAGGGAGGGCAAGCGAGG - Intronic
1143649752 17:8256234-8256256 CGATGCAGGGAGGGGAAGGCAGG - Intronic
1144560242 17:16315361-16315383 CATTGCAGTGAGGGACAGGCAGG - Intronic
1144578909 17:16447007-16447029 CCCTGCAGGCTGGGGAAGGAAGG - Intronic
1144581394 17:16461445-16461467 CCTGGCGGGAAGGGGAGGGCCGG - Intronic
1144740582 17:17580076-17580098 CCCTGAAGGGAGGGGAAGGGAGG + Intronic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1144956530 17:19021524-19021546 CTTTTGAGGGAGGGGCAGGCAGG + Exonic
1145238647 17:21226580-21226602 CCTAGCAGGGAGGCGAGGGCTGG - Intergenic
1145901926 17:28495245-28495267 CCTGGCAGGGAGGGAAAGTTGGG - Intronic
1145943646 17:28757838-28757860 TCCTGGAGGGAGGGGAAGGGGGG + Exonic
1145984539 17:29036484-29036506 CCTGGAAGTGAGGGGCAGGCAGG - Intronic
1146655023 17:34629987-34630009 TCCTGCAGGGAGGAGAAGGGGGG - Exonic
1147193508 17:38750055-38750077 CTCTGCAGGGAGGGGAACGCGGG + Exonic
1147314422 17:39612740-39612762 CGTTGCCGGGAGGTGAGGGCTGG + Intergenic
1147428382 17:40356990-40357012 AGTGGGAGGGAGGGGAAGGCAGG - Intronic
1147441080 17:40447562-40447584 CCTTGTGGGGAGGGGGAGGGAGG + Intronic
1147726953 17:42571833-42571855 CCATGGAGTGGGGGGAAGGCTGG - Exonic
1147948917 17:44096146-44096168 CCAGCCAGGAAGGGGAAGGCAGG + Intronic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148443783 17:47725731-47725753 CCCTGCGGGGAGGGGCTGGCTGG - Intergenic
1148845863 17:50529447-50529469 ATTTGAAGGGAGGGGAAGGGTGG + Intronic
1150615104 17:66764370-66764392 CCTGGTAGAGAGTGGAAGGCTGG + Intronic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1150785891 17:68162406-68162428 CCCTGCTGGGAGGAGAAGCCCGG - Intergenic
1151482842 17:74380300-74380322 CTTCGGAGGGAGGGGCAGGCAGG + Intergenic
1151844267 17:76640266-76640288 CCTGGGAGGGAGGGGCAGGGTGG + Intronic
1151883890 17:76912081-76912103 CCTTATAGGGAGGGGAAATCTGG - Intronic
1152095278 17:78268716-78268738 CCTTGCAGGGAGGGCTGTGCAGG + Intergenic
1152113345 17:78369650-78369672 CCTGGCAGGGAAGGGAAGGAAGG - Intergenic
1152141989 17:78541901-78541923 CGTGGCAGGGAGGGGAGGGATGG + Intronic
1152275138 17:79352095-79352117 CCTTGAAAGGAGGAAAAGGCAGG - Intronic
1152352848 17:79793008-79793030 CCTTTAAGGGCGGGGAGGGCAGG + Exonic
1152489325 17:80618972-80618994 CCTCGCAGGGAAGGGGAGGCGGG - Intronic
1152689406 17:81711250-81711272 CCCTGGAGGGTGGGGGAGGCCGG + Intergenic
1152799050 17:82322657-82322679 GCTTGCAGGAAGGGCAGGGCGGG + Intronic
1152916156 17:83037221-83037243 CACTACAAGGAGGGGAAGGCAGG + Intronic
1153816398 18:8793997-8794019 CCTTGCAGCTTAGGGAAGGCAGG + Intronic
1154129814 18:11727159-11727181 CCTTGCAGGGCTGGGCAGGGTGG - Intronic
1155039169 18:22050473-22050495 CCTAGTAGGGAGGCCAAGGCAGG + Intergenic
1155531740 18:26774223-26774245 CCTTGTAGGAAAGGGAAAGCAGG + Intergenic
1157191433 18:45585590-45585612 CCTTGCAGGGTGGGTAATTCAGG - Intronic
1159241580 18:65750115-65750137 CCTTGCAAGGTGTGGAAGGAAGG - Intergenic
1159545991 18:69839714-69839736 CCTGGGAGAGAGGGGAAGGAGGG + Intronic
1160191112 18:76714586-76714608 CTTTTCAGGTAAGGGAAGGCTGG + Intergenic
1160503250 18:79412538-79412560 GCCTGCAGGGTGAGGAAGGCAGG + Intronic
1160535588 18:79589802-79589824 ACATGCAGGGTGGGGAGGGCAGG - Intergenic
1161079263 19:2302549-2302571 CCTTGCTGGGGAGGGGAGGCAGG - Intronic
1161441609 19:4294848-4294870 CCTTGGAGGGTGGAGAAGCCTGG - Intronic
1161471221 19:4457565-4457587 CCCTGCGGGGCGGGGACGGCCGG - Intronic
1161513042 19:4682466-4682488 CCTTGCAGGAAGGGGCACCCAGG - Intronic
1162330745 19:10027744-10027766 GATCCCAGGGAGGGGAAGGCGGG + Intergenic
1162337644 19:10071462-10071484 CTTTGGAGGATGGGGAAGGCAGG + Intergenic
1162505269 19:11080139-11080161 CTTTGGAGGGATGGGAAGTCTGG - Intergenic
1162637477 19:11981323-11981345 CCTTCAAGGGAGGATAAGGCAGG - Intergenic
1162745012 19:12793169-12793191 CGGTGCAGAGAGGGGAGGGCAGG - Exonic
1163255419 19:16153197-16153219 CCCTGCAGGCAGGTGAGGGCGGG + Exonic
1164188597 19:22895002-22895024 ACTTGCAGGGAGGCTAAGCCGGG - Intergenic
1164201369 19:23021672-23021694 CCTTGTAGGCAGGGCCAGGCAGG + Intergenic
1164260534 19:23565211-23565233 CCTTGCAGGAAGGGTCAGGAAGG + Intronic
1164388186 19:27794467-27794489 CCCCGCAGGGAGGGGCAGGGCGG + Intergenic
1165109501 19:33493628-33493650 CCTTGGAGGGTGGGTAGGGCTGG - Intronic
1165309746 19:35022932-35022954 GGGTGCAGGGAGGGGAGGGCAGG - Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1167200391 19:48061272-48061294 CCATGAGGGGAGGGGAAGGGAGG + Intronic
1168244565 19:55105278-55105300 CAATTCAGGGAGGGGAAGGGAGG + Intronic
1168343041 19:55636622-55636644 CCTTGGAGAGTGGGGAAGGCAGG + Intronic
1168724263 19:58572211-58572233 CCAAGCAGGGAGGGGAATGATGG - Intronic
926155807 2:10453383-10453405 AGTTGCGGGGAGGGGAAGGCAGG - Intergenic
926425119 2:12732945-12732967 CCTGGCAGGGATGGGAAGTCCGG - Intronic
927152414 2:20203665-20203687 CCCTGGGGGTAGGGGAAGGCGGG + Intronic
927558711 2:24053792-24053814 CATGGCATGGAGGGGAATGCAGG + Intronic
927674046 2:25091482-25091504 TCCTGCCGGGTGGGGAAGGCAGG + Intronic
927696234 2:25241515-25241537 GTGTGCAGGGAGGGGAAGACGGG + Intronic
929209131 2:39334707-39334729 CCTCTCAGGGAGGGAAAGGAGGG - Intronic
929508301 2:42546089-42546111 CCTGGTAGGGAAGGGAAGGAGGG + Intronic
929919188 2:46160565-46160587 GCTTGCTGGGAGGTGAAGGGGGG + Intronic
930362008 2:50392870-50392892 GCTACCAGGGAGGGTAAGGCAGG + Intronic
930448985 2:51510670-51510692 ACTTGCTGTGAGGGGAAGGAGGG + Intergenic
930716212 2:54596228-54596250 CCTTGCTGGGTGGGGAGTGCAGG + Intronic
930852370 2:55974620-55974642 CCTTGAATGAAGGGGAAGCCAGG - Intergenic
931624752 2:64247148-64247170 CCTGGCAGGGAGGAAAAAGCAGG - Intergenic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
933724503 2:85418909-85418931 CCTCGTAGGGAGGGCAGGGCGGG - Intronic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
934770279 2:96903388-96903410 CTCTGCAGGGTGGGGGAGGCTGG + Intronic
935165612 2:100566313-100566335 CCATTCAGGGAGGGGTAGACAGG + Intronic
935179869 2:100679722-100679744 CTTTGCAGGTAGGGGTGGGCAGG - Intergenic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935437363 2:103049051-103049073 CTTTGCAGGGAGGCCGAGGCGGG - Intergenic
936112765 2:109678352-109678374 CCCTGCAGGGAGCAGAAGGCAGG - Intergenic
936472481 2:112811490-112811512 CCTGGCAGGGAAGAGAAGGGAGG + Intergenic
936551305 2:113443212-113443234 ACTTACAGGGAGGCCAAGGCGGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937368195 2:121280367-121280389 CCTGGCAGTGATGGGATGGCTGG - Intronic
942452710 2:176118181-176118203 CCTTGCAGGGAGGGCAATGCGGG - Intronic
943100108 2:183477963-183477985 TTTTGCAGGGAGGAGAAGGTGGG - Intergenic
943938614 2:193959946-193959968 GCTTGCAGGGAGCGGAGGTCGGG + Intergenic
944534224 2:200693992-200694014 CGTTGCAGGGAGGTGAAGTAGGG - Intergenic
945197712 2:207252684-207252706 TCTTGCAAGGTGTGGAAGGCTGG - Intergenic
946015857 2:216603261-216603283 GCTTCCAGGGAGAGAAAGGCTGG + Intergenic
946301703 2:218828061-218828083 CCCTGCAGGGAGGGGCGGGGAGG + Exonic
946305526 2:218855043-218855065 TCCTGCAGGGAGGAGGAGGCGGG - Intergenic
947541812 2:230985137-230985159 CCTTGCAGGGAGAGGATCCCTGG + Intergenic
947709987 2:232307948-232307970 CCTGGCATGGAGAGAAAGGCAGG - Intronic
947745771 2:232506594-232506616 CCCTCCAGGGAGGGCCAGGCTGG + Intergenic
947963284 2:234258015-234258037 CCTGCCAAGGATGGGAAGGCCGG + Intergenic
948135628 2:235633979-235634001 CTTTGCAGGGAGGGGCTTGCTGG - Intronic
948272858 2:236687561-236687583 CCATGCAGGCTGAGGAAGGCAGG - Intergenic
948616645 2:239203483-239203505 TCCTGGAGGGAGGGAAAGGCAGG - Intronic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
948970197 2:241419639-241419661 CTTTGCAGAGTAGGGAAGGCTGG + Intronic
1168887034 20:1266934-1266956 CATTTCAGGGAGGGGGAGGGAGG - Intronic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1168952071 20:1809402-1809424 ACATGCAGGGACTGGAAGGCAGG - Intergenic
1169019773 20:2320964-2320986 CCTGCCAGGGAGGTGAAGTCAGG + Intronic
1169908913 20:10631160-10631182 CCTTGCATGGAGGGCAAGGCAGG - Intronic
1170209089 20:13829825-13829847 GCTTGGAGGTAGGGGAAGGATGG + Intergenic
1170859530 20:20089864-20089886 CTTGCCATGGAGGGGAAGGCTGG - Intronic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1172028048 20:31962877-31962899 GCTGGCAGGGAGGGGTGGGCAGG - Intergenic
1172146454 20:32761830-32761852 TCTTGAAGGGAGGGGAGGGCAGG - Intergenic
1172446185 20:34994642-34994664 GATTGCAGGGAGGGGAGAGCTGG - Intronic
1172681205 20:36716730-36716752 CCTAGTAGGTAGAGGAAGGCAGG + Intronic
1173868833 20:46329497-46329519 CCTTGGAGGGAAGGGCTGGCTGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174352527 20:49979091-49979113 CTTTTCAGGGAGGTGAAGGCTGG - Intergenic
1174846670 20:53949536-53949558 CCTTCCTGGGAGGGGAATGCTGG - Intronic
1175350255 20:58312947-58312969 CCATGCAGGTAGGGACAGGCAGG - Intronic
1175895528 20:62334110-62334132 GCTGGCAGGGAGGGGTGGGCAGG - Intronic
1175916414 20:62428100-62428122 CCAGGCAGGGCGGGGCAGGCTGG - Intergenic
1176030085 20:63007536-63007558 CGTTGCAGGCCGGGGAGGGCGGG + Intergenic
1176088407 20:63308345-63308367 CCTTGCAGGTAGGGTCTGGCTGG + Intronic
1176232479 20:64039289-64039311 AATTGAGGGGAGGGGAAGGCTGG + Intronic
1176860200 21:14007789-14007811 CCCTGCAGGGAGGGTCGGGCGGG - Intergenic
1178426406 21:32482501-32482523 CTGGGCAGGTAGGGGAAGGCAGG - Intronic
1179056969 21:37945136-37945158 CCTTGCCTGGGAGGGAAGGCAGG + Intergenic
1179496709 21:41776450-41776472 CCTTGTAAAGAGGGGAAGTCTGG + Intergenic
1179585957 21:42374230-42374252 CCTTGCTGGGAGAGGCAGCCTGG - Intronic
1179722964 21:43325756-43325778 GCATGCAGTGAGTGGAAGGCTGG + Intergenic
1180122275 21:45761800-45761822 GCTGGCAGAGAGGGGAAGGGAGG - Intronic
1181097857 22:20518301-20518323 CCTTGCAGGGATGGAAAGGATGG - Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1182652799 22:31865833-31865855 CCTTGCAGAGAGGGAAAGCTTGG - Intronic
1182768199 22:32774070-32774092 GCTTGGAGGGAGAGGAAGGGAGG + Intronic
1183617724 22:38955398-38955420 CCCTGCAGCCAGGGCAAGGCAGG - Intronic
1184108822 22:42383636-42383658 CCCTGCAGGGAAGGGAAAGCTGG - Exonic
1184514451 22:44953360-44953382 ACTTGCAGGGAGGGGTAGGGAGG - Intronic
1184723573 22:46329978-46330000 CTGTGCAGGGAGGGGAAGGGAGG + Intronic
1185022580 22:48387970-48387992 CCTAGCAGGGAAGGGAGGGAGGG + Intergenic
1185322905 22:50210096-50210118 GGTTTCAGGGAGGGGAAGGATGG + Intronic
1185405017 22:50642702-50642724 ACTGGCAGGGAGAGGAAGGCAGG + Intergenic
950105864 3:10388027-10388049 CCTGGCCCGGAGGGGAAGGAGGG + Intronic
950397461 3:12744602-12744624 CCTTGCAGGGTGGAGAACCCAGG - Intronic
950427210 3:12930961-12930983 CCTGGCAGTGTGGGAAAGGCTGG - Intronic
950457599 3:13101934-13101956 CCTTGCAGGGGTGGGAGGGAGGG + Intergenic
950576055 3:13832746-13832768 CCTGACATGGAGGGGATGGCAGG + Intronic
952278086 3:31896842-31896864 CCTTGGAGGGAGGGGAGGAAAGG + Intronic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
953702937 3:45210708-45210730 CCTTGCTGGGAGGTGCAGGCTGG - Intergenic
953886162 3:46715458-46715480 GCTGGCAGGGAGGGGATGACTGG + Intronic
954375691 3:50193076-50193098 CCTTGCTGGAGGGGGCAGGCTGG + Intronic
954665188 3:52247805-52247827 CCTTGGAGGGTGGGCAAGGGTGG + Intronic
955415808 3:58689874-58689896 TCTAGCAAGGAAGGGAAGGCAGG - Intergenic
955507080 3:59643011-59643033 GCTTGCAGGGAGGTGAAGACAGG + Intergenic
955547881 3:60051138-60051160 CCTTTGAGGTAGGGGAAGGTTGG + Intronic
956790294 3:72674918-72674940 TCTTGGAGGGTTGGGAAGGCTGG - Intergenic
956920566 3:73924269-73924291 CATTCCAGGGAGTGGAAGTCAGG + Intergenic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
958547882 3:95578828-95578850 CATTGCTGGGAGGGGAGGGAAGG + Intergenic
958594020 3:96199255-96199277 CTTTGCTGGGAGGGGAAAGCAGG + Intergenic
958916470 3:100056110-100056132 GCCTGAAGGGAAGGGAAGGCAGG + Intronic
959236006 3:103722464-103722486 TTTTGTAGGGAGGTGAAGGCTGG + Intergenic
960256757 3:115518775-115518797 CCTTGATGTGAGGGGAAGGAGGG + Intergenic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961468854 3:127098848-127098870 CCAGGCAGGGAGGGGAGGCCAGG - Intergenic
961471286 3:127114797-127114819 CCATGCAGGCAGGGAGAGGCAGG - Intergenic
961488314 3:127233103-127233125 CCCTGTAGGGAGGGCAGGGCCGG - Intergenic
961640360 3:128361040-128361062 ACATGCAGGGTGGGGAAGCCTGG + Intronic
961721635 3:128900741-128900763 CCTAGCAGGCAGGGAAAGGGAGG + Intronic
961745154 3:129059764-129059786 CCATGCAGGAGGAGGAAGGCTGG + Intergenic
962178848 3:133183919-133183941 CATTGCAGGAAGGGAAAGACAGG + Intronic
962272258 3:133986501-133986523 TCTTGCAGGGCAGGGAGGGCAGG + Intronic
963598660 3:147358786-147358808 CCTTGCTGGGAGGGGAATGTGGG + Intergenic
963865072 3:150351435-150351457 CATTGCTGGGTGGGGATGGCAGG + Intergenic
964549882 3:157874288-157874310 CCTTGCAGGGAGGCTAAGTCTGG - Intergenic
965394291 3:168143339-168143361 CATTGGAGGCTGGGGAAGGCTGG - Intergenic
966667359 3:182486948-182486970 CCTGGCAGGGATAGGAATGCTGG + Intergenic
966946581 3:184781136-184781158 CCTTGCAGGCTGGGCCAGGCTGG + Intergenic
967259031 3:187623765-187623787 CCCTGGAGGGTGGGTAAGGCAGG - Intergenic
968278069 3:197456106-197456128 GCTTGCAGGAAGGGGGAGGGAGG + Intergenic
968562021 4:1289271-1289293 CCTTGCAGGGCGGGCAGCGCTGG - Intergenic
968904624 4:3445623-3445645 CCTTTCAGGGAGGTGCAGGGAGG + Intronic
968905660 4:3449520-3449542 CATGGCCTGGAGGGGAAGGCGGG - Intergenic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969376876 4:6768814-6768836 CCTTGCACCGAGGAGCAGGCAGG - Intergenic
969665758 4:8556699-8556721 GCTGGCAGGGAGGGGCAGTCTGG - Intergenic
969867397 4:10084754-10084776 CCTTGGAGGGAGGGGAATGAAGG - Intronic
970034953 4:11722792-11722814 CCTGGCATGGAAGGAAAGGCTGG - Intergenic
972397951 4:38673264-38673286 CCCTGCAGGGAGTGGGAGGTTGG - Intronic
972418472 4:38865517-38865539 CACAGCAGGGAAGGGAAGGCAGG + Intergenic
972739782 4:41878701-41878723 CTTGGATGGGAGGGGAAGGCCGG - Intergenic
973607279 4:52600315-52600337 CCTGGCATGGAAGGGAAGGCAGG + Intronic
975581849 4:75914142-75914164 CCATGAAGGGAAGGGAATGCAGG + Exonic
975856401 4:78629505-78629527 ACATACAGGGTGGGGAAGGCTGG + Intergenic
976249991 4:83040585-83040607 TCTTGTAGGGAGGAGAAGGTGGG - Intronic
976845916 4:89489604-89489626 GTTTGCAGGGAGGAGAAGCCTGG - Intergenic
978127456 4:105151586-105151608 TCATTCTGGGAGGGGAAGGCAGG + Intronic
978744253 4:112174200-112174222 GAGTGCAGGGAGGGGAAGGTGGG - Intronic
979268518 4:118732032-118732054 TCTAGAAGGGAGGGGAGGGCGGG + Intronic
979677992 4:123430391-123430413 TCTTCCAGGGAGGGGAAGTCTGG + Intergenic
979733423 4:124052579-124052601 CCTTGAGGGGAGGGGAAGAGGGG + Intergenic
980175570 4:129340264-129340286 CCTTTCAGAGAGTGGAAGGTGGG - Intergenic
980983161 4:139671188-139671210 CCCTGCCGTGAGGGGAAGGGAGG - Intronic
981089832 4:140721076-140721098 CCTAGAAGGGTGGGGAAGACTGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982096768 4:151930542-151930564 CCTAACAGGAAGGGGAAGGAAGG - Intergenic
982358287 4:154491966-154491988 CACGGCAGGGAGGGGAAGGCAGG - Intergenic
982716505 4:158814479-158814501 GCATGTAGGCAGGGGAAGGCTGG - Intronic
983118051 4:163844126-163844148 CCTTTCAGAGAGTGGAAGGTTGG - Intronic
983321809 4:166204276-166204298 CTTGGCAGGTAGGGGAGGGCTGG + Intergenic
983546529 4:168970635-168970657 CCTTGCAGGGAAGGGTGGGAGGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984858620 4:184217537-184217559 CTGGGCAGGGAGGGGAGGGCTGG - Intronic
985069010 4:186150242-186150264 CCTTGGAGGGAGGGGGAGGGAGG - Intronic
985782547 5:1878678-1878700 CCGTCCAGGGAGTGGAAGGGCGG + Exonic
985925361 5:3011771-3011793 GCTTGCAGTGAGGAGCAGGCAGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
986243216 5:5980289-5980311 ACTTGGAGGAAGGGGCAGGCAGG - Intergenic
986588924 5:9348465-9348487 AGTTGAAGGGAGGGGCAGGCTGG - Intronic
988561920 5:32289380-32289402 CCTTGAAGGAAGGGGAGGCCGGG + Intronic
989039524 5:37212960-37212982 CCCAGCAGGGAGGCCAAGGCAGG + Intronic
989701417 5:44269707-44269729 CCTTGCAAGGAAGTGAAGTCTGG + Intergenic
991014025 5:61912408-61912430 CCTTGAATGAAGGGGAAGCCGGG - Intergenic
991952141 5:71956689-71956711 CCCTGCCGGGAGGGGCACGCGGG - Intergenic
992791789 5:80220573-80220595 CCTTGCAGGGGAAGGAAGGAGGG - Intronic
992895268 5:81240039-81240061 CATTGGAGGGAGGGGAAAGAGGG - Intronic
993701473 5:91123868-91123890 CCTAGCAGGGAGTGGAGGGTGGG + Intronic
994122748 5:96135043-96135065 ACTTGCAGGGACCAGAAGGCCGG + Intergenic
994645520 5:102464032-102464054 ACTTGCAGGGAAGGGTAGGATGG + Intronic
996143523 5:119944947-119944969 CCTTTCAGAGAGTGGAAGGTGGG - Intergenic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
997634964 5:135398517-135398539 ATCTGCAGGGAGGGGAAGGCGGG - Intronic
998912915 5:146980410-146980432 ACTAGCAGGGAGGGGAGGGATGG - Intronic
1000172942 5:158721748-158721770 CCTTGCAGGAAAGGGAAGCTTGG - Intronic
1000295149 5:159906987-159907009 CCTAGAAGGGCAGGGAAGGCAGG - Intergenic
1001397279 5:171426418-171426440 CAGTGCATGGAGGGGAGGGCTGG + Intronic
1001705078 5:173735649-173735671 CCCGGCAGGGAGGGCAAGGAAGG + Intergenic
1002212506 5:177607279-177607301 CTGTGCAGGGTGGGCAAGGCTGG - Intronic
1002536044 5:179876111-179876133 CCTTGCAGGGAGGGGTGGCTGGG - Intronic
1002589878 5:180283148-180283170 TCTAGCAGGAAGGGGAAGGAAGG - Intronic
1003098888 6:3162537-3162559 CCAGGGAGGGAGGGGAAGGAGGG - Intergenic
1003133934 6:3418570-3418592 CCTGGTAGGGAGAGGAAGCCTGG + Intronic
1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG + Exonic
1003146219 6:3512710-3512732 CCTTGGCTGGAGGGGAAGGCAGG + Intergenic
1006110929 6:31744698-31744720 CCTTGAAGGAAAGGGAAGGGGGG + Intronic
1006340530 6:33443953-33443975 CCAAGCAGGTAGGTGAAGGCAGG + Exonic
1006398515 6:33802290-33802312 CCAAGCAGGGAGGGGAGGCCGGG + Intronic
1006670819 6:35728743-35728765 CCTCGGAGGGAGGGAGAGGCAGG + Intergenic
1006781861 6:36637529-36637551 TCAGGCAGGGAGGGGAAGCCTGG - Intergenic
1006830187 6:36963748-36963770 CCTTGCATGGTGGGGTGGGCGGG + Intronic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007628906 6:43261993-43262015 CCTTGTAGGATGGGAAAGGCAGG + Intronic
1010165712 6:72912897-72912919 CCTTTCAGAGAGTGGAAGGTGGG + Intronic
1010331742 6:74630823-74630845 CCCTGGAAGAAGGGGAAGGCGGG - Intergenic
1010960577 6:82141341-82141363 GCTGGCAGGAAGGGGAAGGCTGG - Intergenic
1012437871 6:99234353-99234375 CTTTGCATGGAAGGGAAGTCAGG - Intergenic
1012671321 6:102051304-102051326 GCTTGCAGAGAGTGGAAGGAAGG - Intronic
1013558588 6:111282595-111282617 ACCTGCAGGGAAGGGAAGTCAGG - Intergenic
1014935782 6:127383165-127383187 CTTTGCAGGGAGGCTGAGGCAGG + Intergenic
1016162498 6:140898437-140898459 CTTTGCAGGGAGGAGGAGCCTGG - Intergenic
1016456484 6:144236087-144236109 CCATGCAGCAAGGTGAAGGCTGG - Intergenic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1018370781 6:163165755-163165777 CCTGGCAGAAAGGGGAAAGCTGG + Intronic
1019218208 6:170457105-170457127 CCCAGCAGGCAGGGAAAGGCAGG - Intergenic
1019295535 7:272122-272144 CCCTGCAGGGAGGAGCAGGGAGG + Intergenic
1019429219 7:991027-991049 CCCTGCAGGGCCGGGAGGGCGGG - Intergenic
1019733140 7:2638345-2638367 CCTTGCACGAGGGGGAGGGCGGG + Intronic
1021808440 7:24379289-24379311 CCTCACAGGAAGGGGAATGCTGG - Intergenic
1024565956 7:50681227-50681249 CCTGGCAGGGTGCAGAAGGCTGG + Intronic
1024624084 7:51189271-51189293 CTTGGCGGGGAGAGGAAGGCTGG + Intronic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024955094 7:54910326-54910348 CCTTGCAGGAGGGGAAAGGCAGG - Intergenic
1025027901 7:55533333-55533355 CCTTCCTGAGTGGGGAAGGCAGG - Intronic
1025145206 7:56495814-56495836 GCTTGCAGGGATGGGCAGGAGGG + Intergenic
1025260814 7:57416310-57416332 CCTTGCAGGGATGGGCAGAAGGG + Intergenic
1027960418 7:84939618-84939640 CATTACAGGGATGGGCAGGCTGG - Intergenic
1029336609 7:99905565-99905587 CTTTGCTGGGAGCTGAAGGCAGG + Intronic
1029367730 7:100127364-100127386 CCTGGCAGGGAGGGACGGGCTGG - Exonic
1029423561 7:100483820-100483842 CCTTGGAGGGTGTGGAAGGGTGG + Intergenic
1031077468 7:117226696-117226718 CCTTGCAGGTATGGGATGGAAGG + Intronic
1031121411 7:117726714-117726736 CCTTGGAGGGATGGGAAGGGGGG + Intronic
1032011632 7:128351413-128351435 CGCTGCAGGGAGAGGAAGCCGGG + Exonic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032083794 7:128873196-128873218 CTTTGCATGGAGGGGAAGCAGGG - Intronic
1032268581 7:130384713-130384735 CCCTGCAGTGAGGGGAGGGTTGG + Intronic
1032745578 7:134783131-134783153 CCTTGTAGGAAGGGCAAGGAAGG + Intronic
1033784712 7:144716968-144716990 CCTGGCCGGGAGGTCAAGGCGGG - Intronic
1034401323 7:150863527-150863549 TCTTGGAGGGAGAGAAAGGCTGG - Intergenic
1034529972 7:151689604-151689626 CCTGGCGGGAAGGGGAAAGCCGG - Intronic
1035469979 7:159103531-159103553 TTTTGCAGGCAGGGAAAGGCCGG - Intronic
1035889927 8:3332316-3332338 CCTAGCAGAGAAGGGAAGGTGGG + Intronic
1036492769 8:9243195-9243217 CCATGCATGAAAGGGAAGGCTGG + Intergenic
1037315535 8:17595874-17595896 CTTTTGAGGGAGGGGCAGGCAGG + Intronic
1037319589 8:17630639-17630661 CCCAGCAGGGAGGGGAGGGGAGG - Intronic
1037635409 8:20697530-20697552 CTTTTCAAGGAGGAGAAGGCTGG - Intergenic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038584681 8:28778104-28778126 CCGTGGAAGGAGGGGCAGGCTGG + Intronic
1038611375 8:29062664-29062686 CCTGACAGAGAAGGGAAGGCAGG + Intronic
1038696054 8:29807334-29807356 ACAGGCAGGGCGGGGAAGGCAGG - Intergenic
1039373625 8:37011844-37011866 GCTTGGAGGGAGGGGAAAGGAGG - Intergenic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1040944957 8:52874397-52874419 CCTTGCAGGGCTGGGTGGGCTGG + Intergenic
1042001262 8:64125486-64125508 CCTTGAATGAAGGGGAAGCCAGG - Intergenic
1042176624 8:66043553-66043575 CCCTGCATGGGGGGGAAGGATGG + Exonic
1042232198 8:66569104-66569126 CCTTTCAGAGAGTGGAAGGTGGG - Intronic
1042376267 8:68056242-68056264 CCAGGCAGGGAGTGGCAGGCAGG + Intronic
1042824152 8:72963297-72963319 CCTGGCAGGGAGGCCAAGGTGGG + Intergenic
1044832875 8:96267452-96267474 CACTGGAGGGAGGGGAAGCCAGG - Intronic
1046103872 8:109644589-109644611 CACTGGAGGGCGGGGAAGGCGGG - Intronic
1047439879 8:124868159-124868181 CCTGGCAGGGAGTGGAAATCAGG - Intergenic
1048097062 8:131308436-131308458 TCTTGCAGGCAGGGGCAGGGGGG - Intergenic
1048176191 8:132154656-132154678 GCTTGCAGGGAGGAGGAGCCTGG + Intronic
1048178348 8:132172692-132172714 CCCTGGAGGGAGAGGCAGGCAGG + Exonic
1048305848 8:133284315-133284337 CCTTGCAGGCAGGTGACAGCAGG - Exonic
1048407949 8:134142180-134142202 CCTTGCAGAGAAGAAAAGGCAGG - Intergenic
1048496773 8:134942166-134942188 CCTTCCATGGAGGTGAGGGCTGG + Intergenic
1049237156 8:141518168-141518190 CCCGGCAGGGCGGGGAGGGCCGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049988378 9:972013-972035 CCGGGCTGGGAGGGGAAAGCGGG + Intergenic
1051206521 9:14694052-14694074 TTTTGCAGGGATGGGAAAGCAGG - Intergenic
1053200621 9:36149463-36149485 CCTTGGAGGGAGGGGTGGGTAGG - Intronic
1056580678 9:87886533-87886555 CTTTGCAGGGAAGGGCAGGAAGG + Exonic
1056798471 9:89675177-89675199 GCCTGCTGGGCGGGGAAGGCAGG - Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057700375 9:97359817-97359839 CCTTGGGGAGTGGGGAAGGCTGG - Intronic
1059191772 9:112333665-112333687 GCTCGCGGGGTGGGGAAGGCGGG - Intronic
1059438592 9:114290302-114290324 CCTGGCAGGGACGGGCAAGCAGG + Exonic
1059718374 9:116934607-116934629 CCTTTCAGGGAGTGGAAGGTGGG + Intronic
1059745248 9:117193936-117193958 CCATGCAGGGAGCAGAGGGCAGG + Intronic
1060105895 9:120873342-120873364 CCTTGCAGAGATGGCAAGTCAGG - Intronic
1060557239 9:124514295-124514317 GCATGCAGGGAGGGCAAGGATGG + Intergenic
1060729447 9:126027828-126027850 TCTTGCAGGGAGGGGAGAGGAGG + Intergenic
1060771831 9:126337595-126337617 CCTTCCAGGAATGGGACGGCTGG - Intronic
1061782445 9:133004032-133004054 GCCAGCAGGGATGGGAAGGCAGG - Intergenic
1061847855 9:133397951-133397973 CTCTGCAGGGACAGGAAGGCAGG - Exonic
1061945221 9:133904947-133904969 CCTGGCAGGGAGGGGATGCAGGG + Intronic
1062023565 9:134330257-134330279 CCTGGCAGAGAAGGGAAGGAGGG - Intronic
1062091562 9:134681153-134681175 CCTTGCAGGGAGGGCTGGGGTGG + Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062218748 9:135403217-135403239 CGTGGCCGGGAGGGGAAGGAGGG - Intergenic
1062276607 9:135734289-135734311 CCAGGCACGGAGGGGAAGGTGGG - Intronic
1062378685 9:136276420-136276442 CCTGGCAGGGAGAGAAAGTCGGG - Intergenic
1062475514 9:136724925-136724947 CATTACAGGGATGGGCAGGCTGG - Intergenic
1185512746 X:675708-675730 TCCAGGAGGGAGGGGAAGGCAGG - Intergenic
1185731918 X:2468350-2468372 ACTTGCAGAGAGGAGCAGGCTGG + Intronic
1190145969 X:47891934-47891956 CCTTGAATGAAGGGGAAGCCAGG - Intronic
1190569603 X:51768202-51768224 GGGTGCAGGGAGGGGAAGGGTGG - Intergenic
1192965502 X:76172996-76173018 CTGTGCGGGGAGGGTAAGGCGGG + Exonic
1195721243 X:107871328-107871350 CCTTGCAGGAGGGGGAGCGCAGG + Intronic
1198728341 X:139700693-139700715 CATTGAAGGGAAGGGAAGGAAGG - Intronic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1200064594 X:153498365-153498387 CCCTGGAGGCAGGGGAAGTCTGG + Intronic
1201723349 Y:17128516-17128538 ATTTGCAGGGAGGAGAAGCCTGG + Intergenic