ID: 932594612

View in Genome Browser
Species Human (GRCh38)
Location 2:73086352-73086374
Sequence AATGGCCTCTTGGAATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932594612_932594622 10 Left 932594612 2:73086352-73086374 CCTCCAGATTCCAAGAGGCCATT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 932594622 2:73086385-73086407 GGGAAGCAGGAGAAAGAGGATGG 0: 1
1: 0
2: 57
3: 391
4: 2889
932594612_932594621 6 Left 932594612 2:73086352-73086374 CCTCCAGATTCCAAGAGGCCATT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 932594621 2:73086381-73086403 TATGGGGAAGCAGGAGAAAGAGG 0: 1
1: 0
2: 2
3: 80
4: 790
932594612_932594620 -3 Left 932594612 2:73086352-73086374 CCTCCAGATTCCAAGAGGCCATT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 932594620 2:73086372-73086394 ATTAGGAGATATGGGGAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 222
932594612_932594618 -10 Left 932594612 2:73086352-73086374 CCTCCAGATTCCAAGAGGCCATT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 932594618 2:73086365-73086387 AGAGGCCATTAGGAGATATGGGG 0: 1
1: 0
2: 2
3: 9
4: 221
932594612_932594623 29 Left 932594612 2:73086352-73086374 CCTCCAGATTCCAAGAGGCCATT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 932594623 2:73086404-73086426 ATGGAGACTGTAAGTGCCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932594612 Original CRISPR AATGGCCTCTTGGAATCTGG AGG (reversed) Intronic
900189067 1:1345695-1345717 TGTGGCCTCTGGGAGTCTGGAGG - Intronic
900780473 1:4614537-4614559 AATTGCCTCATAGAATCTAGGGG - Intergenic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
904130925 1:28274563-28274585 ACTGCCCTCGTGGAATCTTGAGG - Intronic
906785973 1:48616294-48616316 AGAGGCCTCCTGGAATCTGAGGG - Intronic
906864746 1:49405578-49405600 AAAGCCCTCTAGGAAGCTGGAGG - Intronic
907247921 1:53119976-53119998 AAGAGCCTCTGGGAGTCTGGAGG + Intronic
908742206 1:67340855-67340877 AATGAGGTCTTGGAATTTGGAGG + Intronic
908883924 1:68765930-68765952 AATGGACTCTGGGGACCTGGGGG + Intergenic
910495186 1:87818726-87818748 ATTGGCCTCTTTGAAGCAGGAGG - Intergenic
910510628 1:88000311-88000333 AACAGCTTCTTGGAATCAGGAGG + Intergenic
913343778 1:117787311-117787333 CATGGTAGCTTGGAATCTGGTGG - Intergenic
922337268 1:224627891-224627913 AATGGCCTCTGAGACTCAGGTGG - Intronic
1063045663 10:2390024-2390046 AATGGCATCTTATAATCTTGAGG - Intergenic
1063558536 10:7104202-7104224 AGTGGTCCCTTGGTATCTGGGGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067495087 10:46754403-46754425 AATGCCCTCCTGGAAGCTGGTGG - Intergenic
1067599568 10:47585993-47586015 AATGCCCTCCTGGAAGCTGGTGG + Intergenic
1068399142 10:56506424-56506446 TAAGGCCTCTAGGAATCTTGAGG - Intergenic
1068674792 10:59759803-59759825 AACGACCTCTTGGAATCTGCTGG + Intergenic
1069168316 10:65192282-65192304 ACTGGCCTCTTGGCAACTAGTGG - Intergenic
1071651098 10:87393877-87393899 AATGCCCTCCTGGAAGCTGGTGG + Intergenic
1074036923 10:109748695-109748717 AATGGACTCTGGGGACCTGGGGG - Intergenic
1074598507 10:114889566-114889588 TATGGCCTCCTGGCTTCTGGTGG + Intronic
1075492704 10:122886446-122886468 AATGGGTTTTTGGAATGTGGAGG + Intergenic
1077400336 11:2352702-2352724 AATATCTTATTGGAATCTGGAGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079717915 11:23771423-23771445 AATTCCCTCTTGGAGTCTGTTGG - Intergenic
1080266941 11:30411438-30411460 AATGCCCTATTGGAATGTGAGGG - Exonic
1080670041 11:34367514-34367536 AATGGACTCTGGGGATTTGGGGG - Intergenic
1083637589 11:64128827-64128849 AGTGCCCTCTGGGGATCTGGAGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086822436 11:91450538-91450560 AATGCCATTTTAGAATCTGGAGG - Intergenic
1088352312 11:108903754-108903776 AATTGTCTCTTGGTATCTGTGGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1096954572 12:55512752-55512774 AATGTCCTTTTGGAATTTGGAGG - Intergenic
1099013007 12:77313813-77313835 AATGACATATTGGAAACTGGAGG - Intergenic
1100421827 12:94442344-94442366 AATGGACTCTGGGGACCTGGGGG + Intronic
1102218835 12:111180639-111180661 AAGGGCCTCTGAGGATCTGGTGG + Intronic
1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG + Intronic
1102734872 12:115150449-115150471 TATGGCCTTTTGTAATCTGGGGG + Intergenic
1103977157 12:124710575-124710597 AATGGCCTCCTGGGCTGTGGCGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1105580654 13:21692810-21692832 AATGTCATGTTGGGATCTGGAGG - Intronic
1105774341 13:23643573-23643595 AATGTCCTCTGTGAAACTGGGGG - Intronic
1106102759 13:26708706-26708728 AGTGGACTCTGGGAACCTGGGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109992351 13:70074502-70074524 AATGCCCTCTTGGAATCTCTTGG - Intronic
1111805785 13:93039374-93039396 AAGAGCCTCTGGGAATCTGTTGG + Intergenic
1115479597 14:33848554-33848576 AAAGGCCTAATGGAAACTGGAGG - Intergenic
1115522747 14:34249134-34249156 AATGACCTGTGGGAACCTGGAGG + Intronic
1116695437 14:48169445-48169467 CATGGCCTCCTGGATACTGGTGG - Intergenic
1118760876 14:68879561-68879583 AGTGGCCTCTGGGACTCTGCTGG - Intronic
1119278131 14:73379053-73379075 AGCCGCCTCTTTGAATCTGGTGG - Intronic
1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG + Intronic
1121905346 14:97736708-97736730 CAGGGCCTGTTGGAATGTGGGGG - Intergenic
1122283061 14:100635644-100635666 ATTGGCCTCTTGGCTTCTGAAGG + Intergenic
1122632831 14:103115040-103115062 AATGGGCTCTTAGAATCTTGGGG + Intergenic
1124835846 15:33195158-33195180 AACGGCCTCTCCGGATCTGGAGG - Intergenic
1125741715 15:41969870-41969892 AGTGACCTCTTGGAATGTGCAGG + Intronic
1127353819 15:58179192-58179214 AATGGGCTCTAGGCCTCTGGGGG - Exonic
1130015966 15:80186619-80186641 ATTGGCTTCTGGGATTCTGGAGG + Exonic
1130960764 15:88657354-88657376 ACTGACCTCTGGGAAGCTGGAGG + Intergenic
1131148693 15:90033451-90033473 ACTGGCCTGTTGGGATCTCGAGG - Intronic
1132667449 16:1088743-1088765 CAAGGTCTCTTGGAAGCTGGCGG - Intergenic
1133039918 16:3055193-3055215 ACTGCCCTCTGGGAATCTTGTGG + Intronic
1137562761 16:49513525-49513547 AATGGGCTCCCGGAATCTGTGGG + Intronic
1138507550 16:57485877-57485899 AATCATCTCTTGGAATTTGGAGG + Intronic
1138624547 16:58238716-58238738 AATGGCTGCTTGGGATATGGAGG - Intronic
1140145860 16:72307920-72307942 GATGGCTTCTTGGAAGCTGCTGG + Intergenic
1141151955 16:81570489-81570511 AATGGCCTCCTGGCAGGTGGTGG + Intronic
1142347858 16:89565513-89565535 AAGGGCCCCTTTGCATCTGGTGG - Exonic
1144719952 17:17462293-17462315 GATGGCCTCTTGCACTGTGGGGG + Intergenic
1151281851 17:73081936-73081958 AATGGACTCTGGGAATCTGGTGG + Intronic
1151356634 17:73562497-73562519 AACAGCCACGTGGAATCTGGGGG + Intronic
1151502497 17:74500337-74500359 AATGGCACCTTGGAATGGGGTGG + Intergenic
1152368364 17:79870340-79870362 AAGGGCCTGGTGGCATCTGGAGG + Intergenic
1153175837 18:2371921-2371943 AATGGACTCTGGGAATTTAGAGG - Intergenic
1154273281 18:12938122-12938144 AATGCCCTTTTGGATTTTGGAGG - Intergenic
1154961669 18:21315809-21315831 AATTCCCTGTTGGAATGTGGTGG + Intronic
1157798357 18:50597253-50597275 AAAGGTCTCTTGGAATTGGGTGG + Intronic
1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG + Intergenic
1158492008 18:57918527-57918549 CATGGCCGCTTTGAATATGGAGG - Intergenic
1160580364 18:79880590-79880612 ATTGGCCTCTTGGAATGAGTTGG - Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1164863310 19:31581083-31581105 ACTTGCCTCTTTGTATCTGGTGG - Intergenic
1166806149 19:45488588-45488610 AATGGGGACTTGGAGTCTGGTGG - Intronic
925336313 2:3101601-3101623 AATGTCCTTTGGGAATCTGACGG - Intergenic
926327124 2:11795076-11795098 AAGGGCTGCTTGGATTCTGGGGG - Intronic
928095439 2:28402047-28402069 AATGGGTTCTGGGATTCTGGAGG - Intronic
928095452 2:28402123-28402145 AATGGGTTCTGGGATTCTGGAGG - Intronic
928095481 2:28402275-28402297 AATGGATTCTGGGATTCTGGAGG - Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930995080 2:57707128-57707150 ACTGGTCTCCTGGAAGCTGGAGG + Intergenic
931124423 2:59258222-59258244 AATGGACTCTGGGGATTTGGGGG + Intergenic
931851412 2:66254958-66254980 AGTAGCCTCTTGGAATCTTTTGG + Intergenic
932068626 2:68592936-68592958 ACTGGCATCTTGGATCCTGGTGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932561876 2:72880134-72880156 ACTGGCATCTTCTAATCTGGGGG + Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
934104828 2:88685979-88686001 ATTGGGGTCTTGGAATCTTGAGG + Intergenic
937062014 2:118987860-118987882 AATGGCCTCAGGGAGGCTGGAGG + Intronic
937840433 2:126519273-126519295 CATGCCCTCTGGGACTCTGGGGG + Intergenic
938259981 2:129888620-129888642 AATTGTCTCTGGGAATCAGGAGG - Intergenic
938765014 2:134455146-134455168 CATGGCCTCTCTGAAGCTGGCGG + Intergenic
939148004 2:138439625-138439647 AATGGATTCTTGGAAACTGTAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941207719 2:162594876-162594898 AATTGTCTCTTGGTATCTGTGGG - Intronic
941401553 2:165037472-165037494 AATGGACTCTGGGAACTTGGCGG - Intergenic
946345692 2:219108683-219108705 AATAGCATCTTGGAATCAGAAGG - Intronic
946520207 2:220456377-220456399 AATGGGCTCTTGCAATTTGAGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948953462 2:241270360-241270382 AACTGCCACTTGGAATCTGGAGG - Intronic
1169525581 20:6421528-6421550 AATGCCCTCTTTGAACGTGGTGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173179937 20:40798458-40798480 TATGGCCTCTAGAATTCTGGAGG - Intergenic
1177892894 21:26827586-26827608 AATGGCCATTTGGAAGCAGGAGG + Intergenic
1178219882 21:30644312-30644334 AATGGACTTTGGGAATGTGGGGG + Intergenic
1179127951 21:38608797-38608819 GATGGGCTGTGGGAATCTGGAGG - Intronic
1180976282 22:19850622-19850644 AGTGGCCACTTTGATTCTGGGGG - Exonic
1181108034 22:20586149-20586171 AGTGGCCTCTGGGAAGCTAGTGG - Intronic
1183275364 22:36893254-36893276 AAAGGCCAGCTGGAATCTGGAGG + Intergenic
1183294302 22:37020564-37020586 CATGGGCTCTTGCAAACTGGGGG + Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
950133927 3:10567219-10567241 AATGCCCTTTTGGAATTTAGGGG + Intronic
952189158 3:31003972-31003994 AATGTCCTCTTGCACTCAGGAGG + Intergenic
952363872 3:32657835-32657857 AATGGGCTCTTATAAGCTGGTGG - Intergenic
952828181 3:37541204-37541226 ACCTGCCTCTTAGAATCTGGGGG - Intronic
956625838 3:71265935-71265957 GATGGCCTCTTGCACTTTGGAGG - Intronic
956758205 3:72411383-72411405 AATGGCTTCATGGGATATGGGGG - Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959493310 3:107019059-107019081 AATGTCTTATTGGAAACTGGAGG + Intergenic
962092412 3:132258486-132258508 CATGGCCTCATAGAATATGGAGG + Intronic
962685550 3:137844427-137844449 AATGGACTCTTGGATTCTAAGGG - Intergenic
965843062 3:172929757-172929779 AATGCCATGTTGGAATTTGGTGG - Intronic
965922728 3:173938714-173938736 AAGGGCCTCCTCTAATCTGGAGG - Intronic
965957173 3:174385203-174385225 AATGGACTCTGGGAAGCAGGGGG - Intergenic
966587902 3:181648051-181648073 AGTTGTCTCTTGGAATCTGCTGG - Intergenic
967505454 3:190247970-190247992 AATGGACTGTGGGAATTTGGGGG - Intergenic
969126375 4:4951297-4951319 AGTGGCCTCCTGGAATCCTGGGG - Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
976411983 4:84724499-84724521 AATGGCGTCTTGGACAATGGCGG + Exonic
976808367 4:89073203-89073225 AATGTGCACTGGGAATCTGGGGG + Intronic
977709453 4:100107862-100107884 TATGACCTCTTAGAATCTTGTGG + Intergenic
978482193 4:109205903-109205925 ACTGGGGTCATGGAATCTGGGGG - Intronic
981571978 4:146161282-146161304 AATGGCTTCCTTGAAACTGGAGG + Intergenic
981823889 4:148916999-148917021 AATGCCAACTGGGAATCTGGGGG - Intergenic
981827704 4:148962744-148962766 AATGGCTTATTGGAAACTTGGGG - Intergenic
984473850 4:180212937-180212959 AAAGGTCTCTTGGAAACTGGAGG + Intergenic
985499626 5:234456-234478 AATGGTTTTTTGGAATATGGTGG + Intronic
985555649 5:556728-556750 GCTGGGTTCTTGGAATCTGGAGG + Intergenic
986187781 5:5460955-5460977 AATGAACTCATGGAATCTGAAGG + Exonic
987162673 5:15160534-15160556 ATTGGTTTCTTTGAATCTGGTGG + Intergenic
988798333 5:34673386-34673408 AATGTCCCCTTTGAATCTGCAGG - Intronic
990419955 5:55621592-55621614 AATTGCTTTTTAGAATCTGGTGG - Intergenic
993418572 5:87669694-87669716 AGTGGTCTCTTGGTATCTGTGGG + Intergenic
994661627 5:102661119-102661141 AGTGGCCTCCTGGCATCTGCCGG - Intergenic
995797711 5:115959546-115959568 AATGGACTCTGGGAACTTGGGGG + Intergenic
997819645 5:137053385-137053407 AATGGCAACTTGGTATCTAGGGG - Intronic
999190820 5:149745945-149745967 ACTGGCCTCTGGGAGTCTGCAGG - Intronic
999422532 5:151457336-151457358 AATGGTCTCTAGGATTCTAGGGG + Intronic
999940695 5:156539422-156539444 AATGGCCTTTTGGGACTTGGGGG - Intronic
1000050792 5:157561468-157561490 AAGGGCTTCTGGGACTCTGGGGG - Intronic
1000205960 5:159058831-159058853 AATGGCCTTATGGAATCTGTTGG - Intronic
1001024399 5:168211368-168211390 AATGGCCACTGGGAGTGTGGTGG - Intronic
1001321135 5:170682682-170682704 CATGTTCTCTTGAAATCTGGTGG - Intronic
1001533938 5:172485370-172485392 AATGGCCTCAGGGAATTTGGTGG + Intergenic
1001823619 5:174728453-174728475 AATAGCATCTTTGAATTTGGGGG - Intronic
1002990045 6:2229940-2229962 CATGGCAGCTTGGAATGTGGAGG - Intronic
1004346643 6:14855372-14855394 AATGGCTTGTTGGGAGCTGGAGG + Intergenic
1005005537 6:21283706-21283728 AATGGCAGCTTGTAATATGGTGG - Intergenic
1011225652 6:85102954-85102976 AATGGACTTTGGGAATTTGGGGG + Intergenic
1012021846 6:93932269-93932291 AATGGCATCATTGAAACTGGAGG + Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1012612632 6:101234608-101234630 AGAGTCCTCTTGGAAGCTGGAGG + Intergenic
1013177673 6:107691222-107691244 AAAGGCCTCTGGGAACCAGGAGG - Intergenic
1014003233 6:116388129-116388151 AATGGGCTTTTGTAATTTGGAGG + Intronic
1014325370 6:119986700-119986722 AATGGCCTGTTGGCATCTGCTGG - Intergenic
1017307376 6:152934803-152934825 AATAGCCTTTTGAAATCTAGGGG - Intergenic
1019055475 6:169220038-169220060 AATGGCTGCTTGGAATGTGCAGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021871192 7:25007807-25007829 AAAGGCCTCTTGGTTACTGGTGG + Intergenic
1024111270 7:46149011-46149033 AATGGACTTTGGGAATTTGGGGG - Intergenic
1024641731 7:51334516-51334538 AAGGGCTTCTTGGATTTTGGAGG - Intergenic
1025097544 7:56108034-56108056 AATGGGCTCTGGGGATTTGGAGG + Intergenic
1026298654 7:69078221-69078243 ACTGGCCTCCTGGACTCAGGTGG - Intergenic
1027497692 7:78908673-78908695 AATTGCTTCTTGGAATCTAAAGG - Intronic
1027615917 7:80423968-80423990 AATTGACTCTTGGAATCAAGTGG + Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032155813 7:129466803-129466825 ACTGGCCGCTTGGAGTATGGGGG - Intronic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1032537666 7:132678208-132678230 CCTGGCCTCTTTGAATGTGGGGG - Intronic
1033634863 7:143202729-143202751 ATGGGCCTCTGGGAATGTGGTGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039285760 8:36039054-36039076 AATTTCTTCTTGGAAACTGGAGG + Intergenic
1040990818 8:53347655-53347677 AATGACCGCTTGGAGTCTGATGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042839179 8:73106508-73106530 AATGGGTTCTTGGAATGTGTAGG + Intronic
1046221221 8:111218172-111218194 AATGGCTTCTTTTAATTTGGAGG + Intergenic
1048956127 8:139537640-139537662 ATAGGCCTCTTGAAATTTGGAGG - Intergenic
1049784314 8:144443378-144443400 CAGGGTCTCTGGGAATCTGGCGG - Intronic
1050433842 9:5588751-5588773 AATGGACTCTTGTTATCTGTAGG + Intergenic
1053086935 9:35232946-35232968 AATGGTGTCTTGGAAGCTGAGGG + Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057666097 9:97046520-97046542 AACGCCCTCCTGGAAGCTGGTGG - Intergenic
1058271964 9:102984322-102984344 AATGTCTTATTGGAAACTGGAGG + Intergenic
1058343244 9:103923750-103923772 AATGGACTTTGGGAATTTGGGGG + Intergenic
1060045958 9:120340925-120340947 GATGGCCTCTAAGAAACTGGAGG + Intergenic
1060657465 9:125381751-125381773 CATGGCCTCTTAGCCTCTGGTGG + Intergenic
1060943990 9:127559274-127559296 GATGGCCTCCTGCAATGTGGAGG + Intronic
1061703646 9:132435543-132435565 ACTGGCCTCTTGGATTCAGGGGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185887289 X:3794063-3794085 AATGGACTCTGGGACTCAGGGGG - Intergenic
1187259396 X:17671216-17671238 AATTAGCTCTTGGAATCTGCAGG - Intronic
1190123781 X:47685504-47685526 AATGACTTCTTGGAAGCTGAGGG - Intergenic
1194117590 X:89922070-89922092 ATAAGCCTCTTGGAATATGGAGG + Exonic
1194215391 X:91124397-91124419 ATTGGTGTCTTGGAATCTTGAGG + Intergenic
1194850682 X:98864899-98864921 ATTGGGGTCTTGGAATCTTGAGG + Intergenic
1195535842 X:106008485-106008507 ACTGGCTTCTTGGAAACTTGTGG + Intergenic